Understanding how genotypic variation influences variation in brain structures and behavioral phenotypes represents a central challenge in behavioral genetics. In Drosophila melanogaster, the neuralized (neur) gene plays a key role in development of the nervous system. Different P-element insertional mutations of neur allow the development of viable and fertile adults with profoundly altered behavioral phenotypes that depend on the exact location of the inserted P element. The neur mutants exhibit reduced responsiveness to noxious olfactory and mechanosensory stimulation and increased aggression when limited food is presented after a period of food deprivation. These behavioral phenotypes are correlated with distinct structural changes in integrative centers in the brain, the mushroom bodies, and the ellipsoid body of the central complex. Transcriptional profiling of neur mutants revealed considerable overlap among ensembles of coregulated genes in the different mutants, but also distinct allele-specific differences. The diverse phenotypic effects arising from nearby P-element insertions in neur provide a new appreciation of the concept of allelic effects on phenotype, in which the wild type and null mutant are at the extreme ends of a continuum of pleiotropic allelic effects.

---

BEHAVIORS are complex traits. Their manifestation depends on interactions among multiple genes and their interplay with the environment. In contrast to other complex traits, behaviors are the quintessential expression of the nervous system, which mediate adaptive responses to changes in the environment. Previous studies have shown that the genetic architectures that shape behaviors are composed of modular ensembles of pleiotropic genes (ANHOLT et al. 2003; ANHOLT 2004; VAN SWINDEREN and GREENSPAN 2005). Furthermore, subtle disruptions of key genes within such ensembles have widespread effects on transcriptional regulation throughout the genome (ANHOLT et al. 2003) and can display a range of allelic effects that differentially affect different traits (ROLLMANN et al. 2006). For example, nearby P-element insertions in the Tre1-Gr5a region that interact epistatically with components of the insulin-signaling pathway differentially affect life span, resistance to heat stress and starvation, and preference for trehalose intake (ROLLMANN et al. 2006).

Understanding how genotypic variation results in variation in behavioral phenotypes requires corresponding insights into how variations in structure and function in the nervous system give rise to variation in these behaviors. To begin to understand pleiotropic effects of key genes in epistatic networks that orchestrate behaviors in the context of this "genes–brain–behavior" paradigm, we have studied P-element insertional mutants of neuralized (neur). The Drosophila melanogaster neur gene encodes a ubiquitin ligase, which processes the Notch ligand Delta and is involved in cell fate commitment during development of the nervous system (DIETRICH and CAMPOS-ORTEGA 1984; YEH et al. 2000; LAI and RUBIN 2001; LAI et al. 2001; PAVLOPOULOS et al. 2001; TIMMUSK et al. 2002). P-element insertions at neur can result in changes in the number of mechanosensory bristles (NORGA et al. 2003) and reduced olfactory avoidance behavior (SAMBANDAN et al. 2006). In addition, lines selected for increased and decreased aggression show altered transcriptional regulation of neur compared to unselected lines (EDWARDS et al. 2006).

We identified three co-isogenic P-element insertions in neur (NORGA et al. 2003; SAMBANDAN et al. 2006) and studied their effects on olfactory avoidance behavior, aggression, and locomotor reactivity in adult flies. We also performed morphometric neuroanatomical analyses to assess structural changes in integrative centers in the brain, the mushroom bodies, and the ellipsoid body of the central complex. Our observations demonstrate that mutations from nearby P-element insertions in a single gene can give rise to pleiotropic behavioral effects associated with neuroanatomical alterations.

Drosophila stocks:

The neur^BG02391, neur^BG02542, and neur^BG02587 P-element insertion lines each contain a single p[GT1] insertion (LUKACSOVICH et al. 2001; BELLEN et al. 2004) in the neur (CG11988) gene region in the co-isogenic Canton-S (B) background. All flies were reared on an agar–yeast–molasses medium in vials at 25° and under a 12-hr light/dark cycle.

P-element excision lines:

P-element excision lines were constructed in a controlled Canton-S (B) background by crossing w;CS(B);neur^BG02391 or w;CS(B);neur^BG02542 females to w;Cy/Sp;Sb2-3/TM6,Tb males. Male offspring of the genotype w;Cy/CS(B);P/Sb2-3 were then crossed to w;CS(B);H/TM3,Sb females, and single male offspring, w;CS(B);P^–/H, were crossed to w;CS(B);H/TM3,Sb females. Progeny in which the P element has been excised, w;CS(B);P^–/TM3,Sb, were mated inter se to generate a homozygous P-element excision line.

Bristle numbers:

Abdominal and sternopleural bristle numbers were scored for males and females. Abdominal bristle number is the number of microchaetae on the sixth sternite in females or the fifth sternite in males and sternopleural bristle number reflects the total number of macrochaetae and microchaetae on the right and left sternopleural plates. Four replicates of 10 flies per sex and line were counted. Abdominal and sternopleural bristle numbers were analyzed separately by two-way fixed effects ANOVA according to the model Y = µ + L + S + L x S + E, where L denotes line, S denotes sex, and E denotes environmental variation. Abdominal bristle number differed by line and sex as shown by a significant line-by-sex interaction term. Thus, abdominal bristle scores were subsequently analyzed separately for each sex according to the ANOVA model Y = µ + L + E, where L denotes line and E denotes environmental variation. Post-hoc Tukey's tests were used to determine significant mean differences among the lines, where applicable.

Behavioral assays:

Avoidance responses to benzaldehyde and locomotor reactivity assays were measured as described previously (ANHOLT et al. 1996; JORDAN et al. 2006; SAMBANDAN et al. 2006). Statistically significant differences from the Canton-S (B) control line were evaluated by two-way fixed effects ANOVA according to the model Y = µ + L + S + L x S + E, where L designates line, S designates sex, and E designates the environmental variation. A post-hoc Tukey's test was used to determine line differences in mean scores, where applicable. Male aggressive behavior was scored using the eight-fly assay described previously by measuring the number of aggressive encounters observed during a 2-min period in an arena with a droplet of food following a period of food deprivation (EDWARDS et al. 2006). Data were analyzed by a one-way fixed effects ANOVA according to the model Y = µ + L + E, where L denotes line and E denotes environmental variation, with a subsequent post-hoc Tukey's test to determine significant mean differences among the lines. All P-element insertion lines and the Canton-S (B) control were tested contemporaneously for each behavior, and behavioral data were accumulated over multiple days or weeks to randomize environmental variation. Measurements for each behavior were always made during the same time of day to minimize experimental variation by avoiding differential sampling of circadian fluctuations.

Immunohistochemistry and morphometric analysis:

Adult Drosophila brains were fixed in phosphate buffered saline (PBS)–37% formaldehyde for 15 min at room temperature, washed extensively with PBS, and blocked in PAXD [PBS containing 5% bovine serum albumin (Roche Biochemicals), 0.3% Triton X-100, 0.3% sodium deoxycholate] for 10 min at room temperature. Incubation with a 100-fold dilution of antifasciclin II MAb 1D4 (Developmental Studies Hybridoma Bank; under the auspices of the National Institute of Child Health and Human Development and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA) was done overnight at 4°. After washing with PAXD, brains were incubated with a 100-fold dilution of Cy^TM3-conjugated Affinipure goat anti-mouse IgG (H + L) (Jackson ImmunoResearch Laboratories, West Grove, PA) for 2 hr at room temperature, followed by washing with PAXD. Brain samples were mounted in Vectashield mounting medium (Vector Laboratories, Burlingame, CA) and visualized under an Olympus BX61 epifluorescence microscope equipped with a DP70 digital camera controlled with analySIS Software. For ease of analysis, relevant dimensions (length and width of - and β-lobes and diameters of ellipsoid body; see Figure 2g for color-coded schematic) were measured on screen and were subsequently converted to values (expressed as percentages) relative to the distance between the two mushroom body heels per brain. Statistical significance was determined using two-way ANOVA with post-hoc Tukey's tests. Images for Figure 2, a–d, were generated using a Leica TCS SE confocal laser microscope.

View larger version (57K): In this window In a new window Download PPT slide   FIGURE 2.— Morphometric analysis of wild-type Canton S (B) controls and the P-element-tagged neuralized alleles BG02542, BG02391, and BG02587. (a–f) Antifasciclin 2 staining of adult brains using the 1D4 monoclonal antibody. (a) Canton S (B) control: , -lobes of mushroom bodies; β, β-lobes of mushroom bodies. (b–d) Mushroom body defects observed in neurBG02542: short and thinner -lobe (arrow in b); -lobe missing (arrow in c); aberrant ball-shaped axonal projections instead of regular -lobe (d). (e) Canton S (B) control: typical appearance of the ellipsoid body (eb) upon staining with antifasciclin 2 antibody reveals two concentric rings. (f) The ellipsoid body in neurBG02542 often appears less organized and smaller. The dashed lines in e and f, which are at the same magnification, are of the same length, illustrating the fact that the ellipsoid body in neurBG02542 is smaller. (g) Schematic of the measurements that were made for morphometry. - and β-lobe diameters (red and green arrows, respectively) were measured and diameters D1 and D2 were determined for the ellipsoid body to calculate the ellipsoid body surface. The blue arrow indicates the distance between the -lobe heels that was used to normalize the measurements for each brain. (h) Key for histograms in i–k. (i) Mushroom body - and β-lobe widths in Canton S (B), neurBG02542, neurBG02391, neurBG02587, neurBG02542Rev1,2, and neurBG02391Rev. (j) Mushroom body - and β-lobe lengths in Canton S (B), neurBG02542, neurBG02391, neurBG02587, neurBG02542Rev1,2, and neurBG02391Rev. (k) Ellipsoid body surfaces in Canton S (B), neurBG02542, neurBG02391, neurBG02587, neurBG02542Rev1,2, and neurBG02391Rev. For the Canton S (B) controls, 43 hemispheres were scored for mushroom body defects and 22 brains for ellipsoid body defects. For the neur alleles, we examined 77 brain hemispheres for mushroom body defects and 39 brains for ellipsoid body defects for neurBG02542, 75 brain hemispheres and 39 brains for neurBG02391, and 74 brain hemispheres and 38 brains for neurBG02587. For the neurBG02542Rev1,2 and neurBG02391Rev revertant alleles, we analyzed 22, 23, and 21 brain hemispheres and 11, 12, and 11 brains, respectively. Lobe width and length were normalized to the distance between the -lobe heels and are expressed as percentages. The ellipsoid body surface values shown in the y-axis in k were calculated by multiplying the radii (R1 = D1/2 and R2 = D2/2) expressed as percentages after normalization. The constant value of the formula surface = x R1 x R2 was omitted from the calculation.

 

Transcriptional profiling:

Flies were frozen on dry ice 5–7 days post eclosion and total RNA was isolated for two replicate groups of males and females for each line. First- and second-strand cDNA were synthesized followed by synthesis of biotinylated cRNA targets. These targets were hybridized to GeneChip Drosophila genome arrays (Affymetrix) and visualized with a streptavidin–phycoerythrin conjugate, as described in the Affymetrix GeneChip Expression Analysis Technical Manual (2000). An estimate of expression of each probe set is the signal metric, which is the weighted averaged signal from all probes within the probe set. Signal values were analyzed by two-way ANOVA according to the model Y = µ + L + S + L x S + E, where L denotes line, S denotes sex, and E denotes the environmental variation. Corrections for multiple testing were done using the false-discovery-rate q-statistic (STOREY and TIBSHIRANI 2003), with a false-discovery-rate threshold for significance set at q < 0.05.

Quantitative RT–PCR:

RNA was isolated from three replicate groups of 25 animals each of control and neuralized mutant adults, as described above. cDNA was generated from 1 µg RNA of each sample using the Transcriptor First Strand cDNA synthesis kit (Roche Biochemicals). The qPCR Mastermix Plus for SYBR Green I (Eurogentec) was used in quantitative RT–PCR (qRT–PCR) reactions that were performed on an ABI7000 instrument. For each replicate group, four technical replicates were measured. Expression levels of transcripts from the various samples were normalized to actin5C expression. We used the following primers: Neur-AB F, 5'-GTCTCGAAGTTGTCGTCGTCGG, and Neur-AB R, 5'-AGCGATAGAGTTCTTCTTCG; Neur-CD F, 5'-GCTCACGGTGCACATAATATCG, and Neur-CD R, 5'-CAGCCACAACAACTAGGACACAC; actin5C F, AGTCCGGCCCCTCCATT, and actin5C R, CTGATCCTCTTGCCCAGACAA. Primers Neur-AB F and Neur-AB R anneal to exon 2 (shared by transcripts A and B) and will allow quantification of the combined amounts of transcripts A and B, while primers Neur-CD F and Neur-CD R anneal to exon 1 (shared by transcripts C and D) and will allow quantification of the combined amounts of transcripts C and D. Further discrimination between transcripts A vs. B and C vs. D was technically not possible.

P-element insertions at the neur locus of D.melanogaster:

Drosophila neur is a neurogenic gene with a role in cell fate commitment. The Drosophila neur gene contains three exons, which generate four alternatively spliced transcripts: neur-RA, neur-RB, neur-RC, and neur-RD (NCBI accession no. AE014297). These transcripts differ in the first exon, but share their second and third exons with transcripts neur-RA and neur-RC differing by 3 bp in the lengths of their second intron and third exon compared to neur-RB and neur-RD, respectively (Figure 1a). The 3-bp difference is most likely due to alternative splice acceptor site usage. We identified three different p[GT1]-element insertions at the neur locus (neur^BG02391, neur^BG02542, and neur^BG02587; BELLEN et al. 2004). The p[GT1] insertion sites are 70 bp upstream of exon 1 of transcripts neur-RA and neur-RB and in the first intron (5350 bp downstream of exon 1) of transcripts neur-RC and neur-RD. All insertions are in the same orientation (Figure 1a).

View larger version (27K): In this window In a new window Download PPT slide   FIGURE 1.— Behavioral effects of transposon-mediated disruption of the neur gene. (a) neur gene structure and P-element insertion sites. The horizontal line represents genomic DNA with open boxes representing exons of neur. Alternative transcripts of neur-designated neur-RA, neur-RB, neur-RC, and neur-RD are shown with solid areas in intron 2 and exon 3 denoting small differences in the lengths of the transcripts. Three independent p[GT1] insertions in the first intron of neur-RC and neur-RD and upstream of the first exon of neur-RA and neur-RB were identified. P-element insertion sites are indicated by arrowheads. Translation initiation sites are denoted by ATG with an arrow. The end of the coding region is indicated by a vertical dashed line in exon 3. The inset shows a magnified view of the region containing the P-element insertion sites. Flanking sequences at the 3'-ends of the P-element insertions of BG02391 and BG02542 are CCAGTACTATCCGTTACTCTCCAGCTGAGCTGCGTCAGCGACGTCGCGC and CTCCAGCTGAGCTGCGTCAGCGACGTCGCGC, respectively. Flanking sequences at the 5'-ends of the P-element insertions of BG02542 and BG02587 are CAGTACTATCCGTTACT-CTCCAGCT and GCGCCAGTACTATCCGTTACTCTCCAGCTGAGCTGCGTCAGCGA, respectively. (b) Olfactory avoidance responses to benzaldehyde. The neurBG02391 (BG02391) flies showed reduced behavioral avoidance responses to benzaldehyde. Excision of the p[GT1] construct (BG02391Rev) resulted in phenotypic reversion of olfactory avoidance behavior. The red dashed line denotes the expected avoidance score that corresponds to indifference to the presence of the odorant. Post-hoc Tukey's test was used to determine significant difference among line means; *P < 0.05. (c) Locomotor reactivity following mechanical stimulation. A significant reduction in locomotor reactivity was observed for neurBG02542 (BG02542) and neurBG02587 (BG02587). No significant difference was observed for neurBG02391; ****P < 0.0001. (d) Phenotypic reversion of locomotor reactivity after P-element excision. Locomotor reactivity was reduced in the P-element insertion line neurBG02542 as compared to its Canton S (B) control. Precise excision of the P element in lines neurBG02542Rev1 and neurBG02542Rev2 restored locomotor reactivity to wild-type levels. Means designated by the same letter are not statistically significantly different from one another. (e) Aggressive behavior. A significant increase in aggressive encounters compared to the control was observed in neurBG02391 and neurBG02587. Excision of the P element (BG02391Rev) resulted in phenotypic reversion of aggressive encounters to wild-type Canton S (B) levels. ****P < 0.0001 (post-hoc Tukey's test).

 
Previous studies indicated that neur mutations can affect numbers of sensory bristles, consistent with the role of neur in peripheral nervous system development (NORGA et al. 2003). We observed a significant reduction of 1.84 sternopleural bristles in homozygous neur^BG02391 flies in both sexes, but the sternopleural bristle numbers of neur^BG02542 and neur^BG02587 were not significantly different from the control (Table 1). The line-by-sex interaction term was significant in the ANOVA of abdominal bristle number (F_4,390 = 5.73, P = 0.0002), indicating significant sex-specific effects of neur mutations on this trait. neur^BG02391 males and neur^BG02542 and neur^BG02587 females had reduced abdominal bristle numbers compared to the co-isogenic Canton-S (B) control (Table 1).

View this table: In this window In a new window   TABLE 1 Effects of P-element insertions at the neur locus on average (± standard error) sternopleural and abdominal bristle numbers

 

Pleiotropic behavioral effects of hypomorphic neur mutants:

In a previous study we demonstrated that neur^BG02391 homozygotes display decreases in olfactory avoidance behavior in adult flies (SAMBANDAN et al. 2006). We confirmed the aberrant olfactory avoidance behavior of neur^BG02391 mutant flies (Figure 1b). No significant differences in olfactory avoidance behavior from the control were observed for neur^BG02542 or neur^BG02587 (data not shown). To verify that the aberrant olfactory phenotype arose due to the insertion of the p[GT1] construct rather than from an independent mutation, we mobilized the p[GT1] transposon and showed that P-element excision restored normal olfactory avoidance behavior (Figure 1b). P-element excision also restored the wild-type sternopleural and abdominal bristle phenotype (Table 1).

Next, we asked whether reduced responsiveness to environmental cues was generalized or specific to particular sensory modalities by measuring a startle response (locomotor activity in response to a mechanical stimulus; JORDAN et al. 2006) and male aggressive behavior (EDWARDS et al. 2006). We observed a significant reduction in locomotor reactivity for both sexes in neur^BG02542 (F_1,116 = 33.45, P < 0.0001) and neur^BG02587 (F_1,116 = 20.47, P < 0.0001) compared to the Canton-S (B) control (Figure 1c). However, neur^BG02391, which showed reduced olfactory avoidance responses to benzaldehyde, showed normal locomotor reactivity, which indicates that these behavioral phenotypes are dependent on the specific insertion site of the P element. To verify that altered locomotor reactivity was indeed attributable to the transposon insertions, we generated two P-element excision lines of neur^BG02542 (neur^BG02542Rev1 and neur^BG02542Rev2) and demonstrated restoration of wild-type locomotor reactivity (F_3,192 = 14.28, P < 0.0001; Figure 1d).

Surprisingly, the average numbers of aggressive encounters by males competing for a limited food supply after a period of food deprivation were 1.8-fold greater in neur^BG02391 and neur^BG02587 than in the co-isogenic Canton-S (B) control (F_2,57 = 20.60, P < 0.0001; Figure 1e). We did not observe a significant effect of neur^BG02542 on aggressive behavior. Again, P-element excision in a controlled genetic background restored the level of aggressive behavior of the neur^BG02391 mutant to wild-type levels (Figure 1e). The increased level of aggression in these flies demonstrates that their impaired locomotor reactivity is not due to physical limitations on mobility.

Effects of P-element insertions in neur on brain structure:

Olfactory avoidance behavior, startle-induced locomotion, and aggression are behaviors that all involve input from different sensory modalities. This input is integrated and processed in higher brain structures and ultimately results in a motor response. We sought to determine whether the behavioral abnormalities that we observed in neur mutant flies could result from structural alterations in integrative centers in the brain, namely the mushroom bodies and the central complex. Sensorimotor coordination in Drosophila depends on the mushroom bodies and the central complex in the brain (MARTIN et al. 1998, 1999). The startle-induced locomotor response is distinct from spontaneous open-field locomotor activity, and not an a priori component of aggressive behavior. Thus, the neural circuits that mediate these different behaviors need not necessarily overlap.

In our analysis, we focused on the - and β-lobes of the mushroom bodies and on the ellipsoid body of the central complex as they integrate information for the execution of complex behaviors. For example, the -lobes of the mushroom bodies have been implicated in long-term memory formation, whereas short-term memory requires the gamma lobes (ZARS et al. 2000; PASCUAL and PREAT 2001; YU et al. 2006). - and β-lobe outputs serve in olfactory memory retrieval, but not in its formation or storage (DUBNAU et al. 2001; MCGUIRE et al. 2001; SCHWAERZEL et al. 2002). The ellipsoid body is also implicated in long-term memory consolidation (WU et al. 2007). Here, we conducted morphological and morphometric analyses of the ellipsoid body and the mushroom body - and β-lobes of the adult brain following immunohistochemical labeling with the antifasciclin 2 antibody 1D4. This antibody strongly labels the - and β-lobes of the mushroom bodies and, to a lesser extent, the gamma lobes (Figure 2a; CRITTENDEN et al. 1998). We first determined whether any gross morphological alterations could be seen. Next we measured widths and lengths of the - and β-lobes and diameters of the ellipsoid body. Mushroom bodies were scored individually (i.e., per hemisphere) while ellipsoid body scores were scored per brain. A direct relationship between gross structural brain defects and behavior has been demonstrated previously (see, e.g., STRAUSS 2002), but subtle alterations in brain neuroanatomy and behavioral changes have hardly been studied. The biological relevance of such subtle changes is illustrated by a recent study of the paper wasp, Polistes instabilis, where mushroom body volume was related to social aggression (MOLINA and O'DONNELL 2007).

We observed gross morphological defects in some of the mushroom bodies of neur^BG02542 flies. These defects included shorter and thinner -lobes (7/77; Figure 2b), missing -lobes (2/77; Figure 2c), and aberrant projections of the -lobe (1/77; Figure 2d). We did not observe such defects either in the co-isogenic controls (0/43) or in the neur^BG02391 (0/75) and neur^BG02587 (0/74) alleles. A G-test of independence (SOKAL and ROHLF 1995) indicates that the frequency of aberrations is significantly different for the different genotypes (G₃ = 26.04, P = 9.35 x 10^–6). In the central complex, the antifasciclin 2 antibody stains primarily the ellipsoid body, which is labeled in a characteristic pattern of two concentric rings (Figure 2e). We observed disorganized ellipsoid bodies (ranging from less distinct or poorly defined concentric rings to completely abnormal organization) or defects (ventral open) in 20 of 39 brains (Figure 2f) in the neur^BG02542 mutants. A comparable disorganization or poor structural definition but not the ventral open defect is occasionally observed in the wild-type control (4/22). We also did not see major disorganization in the neur^BG02391 (0/39) and neur^BG02587 (0/38) alleles. Again, a G-test reveals that the differences in frequency of ellipsoid body aberrations among these genotypes are significant (G₃ = 56.60, P = 3.12 x 10^–12).

Whereas gross morphological defects were not always apparent, a detailed morphometric analysis revealed consistent subtle differences in neuroanatomical organization. We quantified widths and lengths of - and β-lobes as well as surface areas of the ellipsoid bodies using the variables outlined in Figure 2g. To control for possible shrinkage effects due to fixation, all measurements were expressed as percentages relative to the distance between the two mushroom body heels (blue double arrow in Figure 2g). Behavioral alterations in the neur mutants reveal remarkable parallels with most neuroanatomical alterations. We found significant differences in -lobe (F_6,327 =2.991; P = 0.007) and β-lobe widths (F_6,327= 4.925; P < 0.001). - and β-lobe widths of neur^BG02391, which shows reduced olfactory responsiveness (Figure 1b) and hyperaggression (Figure 1e), were significantly different from the Canton-S (B) controls (P < 0.05; Figure 2i). Length measurements showed significant differences only for -lobes (F_6,327 = 6.420; P < 0.001). The -lobe lengths of neur^BG02391 were significantly different from controls (P < 0.05) (Figure 2j). The analysis of ellipsoid body surfaces also revealed significant differences among neur alleles (F_6,165 = 2.153; P = 0.050). The locomotor response-impaired neur^BG02542 mutant (Figure 1c) displayed a significantly reduced ellipsoid body surface relative to the Canton-S (B) control (P < 0.05). The other two neur alleles also showed a reduction in ellipsoid body surface, of which neur^BG02391 was also significantly different from Canton-S (B) (Figure 2k). We next asked whether the restoration of behavior to wild type seen for the neur^BG02391Rev, neur^BG02542Rev1, and neur^BG02542Rev2 alleles is accompanied by changes in morphology of mushroom bodies and ellipsoid bodies. None of the revertants displayed the gross morphological defects seen in the original alleles. Furthermore, we observed restoration of - and β-lobe width as well as of ellipsoid body surface of neur^BG02391Rev to levels not different from Canton-S (B) controls (see Figure 2, i and k). Furthermore, we found that the ellipsoid body surface of both revertants for neur^BG02542 is restored to the size of the Canton-S (B) control (see Figure 2k). The one parameter that did not revert to wild-type values in the revertant lines was -lobe length. We do not know the underlying reason for this observation, but our data indicate that the -lobe phenotype seen in neur^BG02391 does not depend on the P-element insertion. It was previously shown that neur^BG02542 is associated with locomotor reactivity deficits and neur^BG02391 with aggressive behavior. The observation that P-element excision results in reversion to wild-type levels of behavior and brain structure suggests that the alterations seen in the ellipsoid body and in ellipsoid body and mushroom body lobes, respectively, may be causally linked to the observed differences in behavior. This is consistent with the previously demonstrated roles of ellipsoid bodies and mushroom bodies in locomotor activity (MARTIN et al. 1998, 1999).

P-element insertions in neuralized affect ratios of alternative transcripts:

Small differences in the locations of the P elements might result in differences in expression levels or ratios of alternatively spliced transcripts which could impact different forms of adult behavior. To determine whether the different P-element insertions had differential effects on transcription, we performed qRT–PCR experiments, allowing us to discriminate transcripts A and B from transcripts C and D (Figure 3A). We found that there are indeed differential effects on these transcript pairs associated with the different P-element insertions (see Figure 3, B and C). This was most pronounced in females where transcripts A and B are significantly reduced in neur^BG02587 and neur^BG02391 when compared to the Canton-S (B) control. By contrast, no such differences were observed for the C and D transcripts in females. In males, a significant difference was seen between neur^BG02542 and neur^BG02587. The latter appears lower than neur^BG02391 and the Canton-S (B) control without, however, reaching statistical significance. The C and D transcripts again showed less variation although in neur^BG02391 an increase was seen that was, however, not statistically significant. These observations extend a previous study, in which we showed that neur transcript abundance is reduced in embryos and larvae of neur^BG02391 homozygotes and that this reduction resulted in decreased olfactory avoidance behavior in adult flies (SAMBANDAN et al. 2006).

View larger version (23K): In this window In a new window Download PPT slide   FIGURE 3.— qRT–PCR analysis of neuralized transcripts A-B and C-D in wild-type Canton S (B) controls and the P-element insertion alleles BG02542, BG02391 and BG02587. (A) Genomic structure of the neuralized gene. The neuralized gene consists of four exons (1–4). Alternative splice acceptor sites are located 3 bp apart at the 5'-end of exon 4 (arrow with asterisk; for the locations of the P-element insertion sites in the neur locus, see Figure 1a). (B) qRT–PCR analysis of A-B and C-D transcripts in RNA isolated from females of neurBG02542, neurBG02587, neurBG02391, and Canton S (B). Transcript levels are expressed as percentages of the Canton S (B) control. The A-B transcript levels in neurBG02587 and neurBG02391 are significantly lower than in Canton S (B), whereas reduction in neurBG02542 transcript levels does not reach statistical significance (F3,8 = 11.399; P = 0.003). The C-D transcripts do not differ. (C) qRT–PCR analysis of A-B and C-D transcripts in RNA isolated from males of neurBG02542, neurBG02587, neurBG02391, and Canton S (B). Transcript levels are expressed as percentages of the Canton S (B) control. The A-B transcript levels in neurBG02542 and neurBG02587 differ significantly (F3,8 = 4.570; P = 0.038). The apparent reduction in the level of neurBG02587 compared to neurBG02391 and the Canton S (B) control is not statistically significant. For the C-D transcripts, no statistically significant differences were observed although the levels in neurBG02391 appear higher. Statistical significance was determined with ANOVA and post-hoc analysis with Bonferroni correction.

 

Genes with altered transcriptional regulation in adult neur mutants:

Previously, we showed that single P-element insertions cause genomewide alterations in expression of coregulated genes (ANHOLT et al. 2003). To determine to what extent the p[GT1]-element insertion alleles of neur alter the transcriptional context of neur expression, we examined genomewide transcriptional profiles in the Canton-S (B) control and neur^BG02391, neur^BG02542, and neur^BG02587 mutants using Affymetrix high-density oligonucleotide Drosophila GeneChips. Analysis of whole-genome transcriptional profiles resulted in 135 probe sets with altered expression levels at a false discovery rate of q < 0.05 (STOREY and TIBSHIRANI 2003; supplemental Table S1). We observed considerable overlap among the ensembles of genes with altered expression in the different mutants. Of the 135 probe sets, 85 (63%) were altered in two or more mutant lines compared to the co-isogenic Canton-S (B) control. However, 22 were altered only in neur^BG02391, 11 only in neur^BG02542, and 8 only in neur^BG02587, consistent with different behavioral, morphological, and neuroanatomical phenotypes observed for each mutant allele (supplemental Table S1). In addition, 9 lines showed a significant line-by-sex interaction (supplemental Tables S1 and S2). Precedence for such different phenotypic effects arising from nearby P elements, or even from P elements at the same insertion site but in different orientations, has been documented previously for P-element insertions in the Tre1-Gr5a region that differentially affect starvation and heat stress resistance, gustatory behavior, and life span (ROLLMANN et al. 2006). In addition, 9 probe sets showed sex-specific differences in expression (supplemental Table S2). It is of interest that, among the genes with altered transcriptional regulation in one or both of our hyperaggressive neur mutants, 34 exhibited differential regulation in lines selected for increased or decreased aggression (EDWARDS et al. 2006; <15 genes would be expected by chance).

We assigned coregulated genes to the gene ontology categories of molecular function and biological process (DENNIS et al. 2003). The five most significant biological process categories are highlighted in Table 2 and the complete data set is presented in supplemental Table S3. In contrast to transcripts expected to be associated with the function of neur in early development of the nervous system, such as Notch and Delta, transcripts with altered regulation in the neur mutant background in adult flies are predominantly associated with proteolysis. This is in line with the ubiquitin ligase function of the neur gene product and could reflect a role in the dynamics of synaptic organization, as implied previously for Tequila, which is transiently upregulated in the mushroom bodies during memory formation (DIDELOT et al. 2006) and shows altered regulation in the neur mutants.

View this table: In this window In a new window   TABLE 2 Overrepresented gene ontology categories of coregulated transcripts in neur mutants

 

We have shown that distinct P-element insertions at nearby locations in the neur gene give rise to profoundly different effects on adult behaviors and that aberrant startle-induced locomotor responses, olfactory responses, and aggression correlate with different structural alterations in integrative brain centers, the mushroom bodies, and the ellipsoid body of the central complex. Similar pleiotropic allelic effects with differential effects on life span, resistance to heat stress and starvation, and preference for trehalose intake were observed previously for P-element insertions in the Tre1-Gr5a region (ROLLMANN et al. 2006). In addition, different naturally occurring polymorphisms in Catsup, which encodes a negative regulator of tyrosine hydroxylase, are associated with phenotypic variation in sternopleural bristle number, environmental plasticity of abdominal bristle number, and starvation resistance (CARBONE et al. 2006). The diverse phenotypic effects arising from nearby P-element insertions in neur contribute to an emerging new appreciation of the concept of allelic effects on phenotype, in which the wild type and null mutant are at the extreme ends of a continuum of pleiotropic allelic effects. Subtle alterations in transcript abundance for splice variants may contribute to these pleiotropic effects, which would be in line with the subtle regulatory variations that have been associated with phenotypic effects on human and rodent behaviors (e.g., KRISHNAN et al. 2007; JENSEN et al. 2008).

Previous studies have shown that the introduction of a single P-element in the genome gives rise to widespread altered transcriptional regulation and that about two-thirds of genes with altered transcriptional regulation in a P-element-disrupted background are candidate genes affecting the trait (ANHOLT et al. 2003). Moreover, such altered transcriptional profiles can define a functional context for the disrupted gene (ROLLMANN et al. 2005). The results from our expression microarray analysis show that insertions of P elements in neur result in a genomewide cascade of transcripts with altered expression. Proteolytic and degradative enzymes feature prominently among coregulated genes. One protease-encoding transcript that features notably in these transcriptional profiles is Tequila, which has previously been implicated in synaptic plasticity in the mushroom bodies during memory formation (DIDELOT et al. 2006; supplemental Table S3). One could speculate that the different, yet overlapping patterns of transcriptional profiles with altered expression of proteolytic enzymes and peptidoglycan recognition precursor proteins (Table 2) may reflect alterations in neural connectivity, which could contribute to the different behavioral effects. In addition, changes in structure of the mushroom bodies and ellipsoid body could also arise from developmental effects of neuralized (SAMBANDAN et al. 2006).

The behavioral phenotypes of neur mutant flies are reminiscent of those encountered in patients suffering from neuropsychiatric and neurodegenerative disorders, including reduced responsiveness to environmental stimuli and increased aggressive behavior. Neurodegenerative and neuropsychiatric disorders ranging from bipolar disorder, schizophrenia, and antisocial personality disorder to Alzheimer's and Parkinson's disease are often accompanied by behavioral alterations, such as indifference to stimuli, hypokinesia, hyperactivity, and aggression (PAVEZA et al. 1992; AARSLAND et al. 1999; MORAN 1999; OQUENDO et al. 2000; BRIEDEN et al. 2002; HALLER and KRUK 2006). Apathy and aggressive behavior have a catastrophic impact on the social functioning of neuropsychiatric patients. In addition, these behaviors represent some of the most difficult to treat symptoms. Whereas it is likely that underlying genetic architectures that may predispose to such behavioral syndromes are heterogeneous and complex, we have demonstrated that reduced responsiveness to environmental stimuli together with increased aggressive behavior can arise from a single hypomorphic mutation at the neur locus in Drosophila and that these behavioral defects are associated with distinct subtle alterations in neuroanatomy.

We thank Richard Lyman for assistance in the analysis of bristle phenotypes, Stefanie Heinsohn and Stacy Williams for technical assistance, Ann Schellens for help with the qRT–PCR analyses, Mimi Deprez for help with preparing the figures and Zsuzsanna Callaerts-Vegh for help with the statistical analysis of the morphometric and qRT–PCR data. K.N. is a Senior Clinical Investigator of the Fonds voor Wetenschappelÿk Onderzoek-Flanders. L.Z. is supported by the Institute for the Promotion of Innovation through Science and Technology in Flanders (Instituut voor de Aanmoediging van Innovatie door Wetenschap en Technologie in Vlaandeven). This work was supported by grants from the National Institutes of Health (to R.R.H.A. and T.F.C.M.) and in part by a Belgian Federal Science Policy Return Grant (to K.N.), a Marie-Curie International Reintegration Grant (to K.N.), and Vlaams Instituut voor Biotechnologie. This is a publication of the W. M. Keck Center for Behavioral Biology at North Carolina State University.

¹ These authors contributed equally to this work.

² Present address: Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 45221.

AARSLAND, D., J. P. LARSEN, N. G. LIM, C. JANVIN, K. KARLSEN et al., 1999 Range of neuropsychiatric disturbances in patients with Parkinson's disease. J. Neurol. Neurosurg. Psychiatry 67: 492–496.[Abstract/Free Full Text]

ANHOLT, R. R. H., 2004 Genetic modules and networks for behavior: lessons from Drosophila. BioEssays 26: 1299–1306.[CrossRef][Medline]

ANHOLT, R. R. H., R. F. LYMAN and T. F. C. MACKAY, 1996 Effects of single P-element insertions on olfactory behavior in Drosophila melanogaster. Genetics 143: 293–301.[Abstract]

ANHOLT, R. R. H., C. L. DILDA, S. CHANG, J. J. FANARA, N. H. KULKARNI et al., 2003 The genetic architecture of odor-guided behaviour in Drosophila: epistasis and the transcriptome. Nat. Genet. 35: 180–184.[CrossRef][Medline]

BELLEN, H. J., R. W. LEVIS, G. LIAO, Y. HE, J. W. CARLSON et al., 2004 The BDGP gene disruption project: single transposon insertions associated with 40% of Drosophila genes. Genetics 167: 761–781.[Abstract/Free Full Text]

BRIEDEN, T., M. UJEYL and D. NABER, 2002 Psychopharmacological treatment of aggression in schizophrenic patients. Pharmacopsychiatry 35: 83–89.[CrossRef][Medline]

CARBONE, M. A., K. W. JORDAN, R. F. LYMAN, S. T. HARBISON, J. LEIPS et al., 2006 Phenotypic variation and natural selection at Catsup, a pleiotropic quantitative trait gene in Drosophila. Curr. Biol. 16: 912–919.[CrossRef][Medline]

CRITTENDEN, J. R., E. M. SKOULAKIS, K. A. HAN, D. KALDERON and R. L. DAVIS, 1998 Tripartite mushroom body architecture revealed by antigenic markers. Learn. Mem. 5: 38–51.[Abstract/Free Full Text]

DENNIS, G., JR., B. T. SHERMAN, D. A. HOSACK, J. YANG, W. GAO et al., 2003 DAVID: database for annotation, visualization and integrated Discovery. Genome Biol. 4: 3.[CrossRef]

DIDELOT, G., F. MOLINARI, P. TCHENIO, D. COMAS, E. MILHIET et al., 2006 Tequila, a neurotrypsin ortholog, regulates long-term memory formation in Drosophila. Science 313: 851–853.[Abstract/Free Full Text]

DIETRICH, U., and J. A. CAMPOS-ORTEGA, 1984 The expression of neurogenic loci in imaginal epidermal cells of Drosophila melanogaster. J. Neurogenet. 1: 315–332.[Medline]

DUBNAU, J., L. GRADY, T. KITAMOTO and T. TULLY, 2001 Disruption of neurotransmission in Drosophila mushroom body blocks retrieval but not acquisition of memory. Nature 411: 476–480.[CrossRef][Medline]

EDWARDS, A. C., S. M. ROLLMANN, T. J. MORGAN and T. F. C. MACKAY, 2006 Quantitative genomics of aggressive behavior in Drosophila melanogaster. PLoS Genet. 2: 1386–1395.

HALLER, J., and M. KRUK, 2006 Normal and abnormal aggression: human disorders and novel laboratory models. Neurosci. Biobehav. Rev. 30: 292–303.[CrossRef][Medline]

JENSEN, K. P., J. COVAULT, T. S. CONNER, H. TENNEN, H. R. KRANZLER et al., 2008 A common polymorphism in serotonin receptor 1B mRNA moderates regulation by miR-96 and associates with aggressive human behaviors. Mol. Psychiatry (in press).

JORDAN, K. W., T. J. MORGAN and T. F. C. MACKAY, 2006 Quantitative trait loci for locomotor behavior in Drosophila melanogaster. Genetics 174: 271–284.[Abstract/Free Full Text]

KRISHNAN, V., M. H. HAN, D. L. GRAHAM, O. BERTON, W. RENTHAL et al., 2007 Molecular adaptations underlying susceptibility and resistance to social defeat in brain reward regions. Cell 131: 391–404.[Medline]

LAI, E. C., and G. M. RUBIN, 2001 neuralized is essential for a subset of Notch pathway-dependent cell fate decisions during Drosophila eye development. Proc. Natl. Acad. Sci. USA 98: 5637–5642.[Abstract/Free Full Text]

LAI, E. C., G. A. DEBLANDRE, C. KINTNER and G. M. RUBIN, 2001 Drosophila neuralized is a ubiquitin ligase that promotes the internalization and degradation of delta. Dev. Cell 1: 783–794.[CrossRef][Medline]

LUKACSOVICH, T., Z. ASZTALOS, W. AWANO, K. BABA, S. KONDO et al., 2001 Dual-tagging gene trap of novel genes in Drosophila melanogaster. Genetics 157: 727–742.[Abstract/Free Full Text]

MARTIN, J. R., R. ERNST and M. HEISENBERG, 1998 Mushroom bodies suppress locomotor activity in Drosophila melanogaster. Learn. Mem. 5: 179–191.[Abstract/Free Full Text]

MARTIN, J. R., T. RAABE and M. HEISENBERG, 1999 Central complex substructures are required for the maintenance of locomotor activity in Drosophila melanogaster. J. Comp. Physiol. A 185: 277–288.[CrossRef][Medline]

MCGUIRE, S. E., P. T. LE and R. L. DAVIS, 2001 The role of Drosophila mushroom body signaling in olfactory memory. Science 293: 1330–1333.[Abstract/Free Full Text]

MOLINA, Y., and S. O'DONNELL, 2007 Mushroom body volume is related to social aggression and ovary development in the paperwasp Polistes instabilis. Brain Behav. Evol. 70: 137–144.[CrossRef]

MORAN, P., 1999 Epidemiology of antisocial personality disorder. Soc. Psychiatry Psychiatr. Epidemiol. 34: 231–242.[CrossRef][Medline]

NORGA, K. K., M. C. GURGANUS, C. L. DILDA, A. YAMAMOTO, R. F. LYMAN et al., 2003 Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development. Curr. Biol. 13: 1388–1396.[CrossRef][Medline]

OQUENDO, M. A., C. WATERNAUX, B. BRODSKY, B. PARSONS, G. L. HAAS et al., 2000 Suicidal behavior in bipolar mood disorder: clinical characteristics of attempters and nonattempters. J. Affect. Disord. 59: 107–117.[CrossRef][Medline]

PASCUAL, A., and T. PREAT, 2001 Localization of long-term memory within the Drosophila mushroom body. Science 294: 1115–1117.[Abstract/Free Full Text]

PAVEZA, G. J., D. COHEN, C. EISDORFER, S. FREELS, T. SEMLA et al., 1992 Severe family violence and Alzheimer's disease: prevalence and risk factors. Gerontologist 32: 493–497.[Abstract]

PAVLOPOULOS, E., C. PITSOULI, K. M. KLUEG, M. A. MUSKAVITCH, N. K. MOSCHONAS et al., 2001 neuralized encodes a peripheral membrane protein involved in delta signaling and endocytosis. Dev. Cell 1: 807–816.[CrossRef][Medline]

ROLLMANN, S. M., T. F. C. MACKAY and R. R. H. ANHOLT, 2005 Pinocchio, a novel protein expressed in the antenna, contributes to olfactory behavior in Drosophila melanogaster. J. Neurobiol. 63: 146–158.[CrossRef][Medline]

ROLLMANN, S. M., M. M. MAGWIRE, T. J. MORGAN, E. D. OZSOY, A. YAMAMOTO et al., 2006 Pleiotropic fitness effects of the Tre1-Gr5a region in Drosophila melanogaster. Nat. Genet. 38: 824–829.[CrossRef][Medline]

SAMBANDAN, D., A. YAMAMOTO, J. J. FANARA, T. F. C. MACKAY and R. R. H. ANHOLT, 2006 Dynamic genetic interactions determine odor-guided behavior in Drosophila melanogaster. Genetics 174: 1349–1363.[Abstract/Free Full Text]

SCHWAERZEL, M., M. HEISENBERG and T. ZARS, 2002 Extinction antagonizes olfactory memory at the subcellular level. Neuron 35: 951–960.[CrossRef][Medline]

SOKAL, R. R., and F. J. ROHLF, 1995 Biometry, Ed. 3. W. H. Freeman, New York.

STOREY, J. D., and R. TIBSHIRANI, 2003 Statistical significance for genome-wide studies. Proc. Natl. Acad. Sci. USA 100: 9440–9445.[Abstract/Free Full Text]

STRAUSS, R, 2002 The central complex and the genetic dissection of locomotor behaviour. Curr. Opin. Neurobiol. 12: 633–638.[CrossRef][Medline]

TIMMUSK, T., K. PALM, N. BELLUARDO, G. MUDO and T. NEUMAN, 2002 Dendritic localization of mammalian neuralized mRNA encoding a protein with transcription repression activities. Mol. Cell. Neurosci. 20: 649–668.[CrossRef][Medline]

VAN SWINDEREN, B., and R. J. GREENSPAN, 2005 Flexibility in a gene network affecting a simple behavior in Drosophila melanogaster. Genetics 169: 2151–2163.[Abstract/Free Full Text]

WU, C.-L., S. XIA, T.-F. FU, H. WANG, Y.-H. CHEN et al., 2007 Specific requirement of NMDA receptors for long-term memory consolidation in Drosophila ellipsoid body. Nat. Neurosci. 10: 1578–1586.[CrossRef][Medline]

YEH, E., L. ZHOU, N. RUDZIK and G. L. BOULIANNE, 2000 Neuralized functions cell autonomously to regulate Drosophila sense organ development. EMBO J. 19: 4827–4837.[CrossRef][Medline]

YU, D., D.-B.G. AKALAL and R.L. DAVIS, 2006 Drosophila /β mushroom body neurons form a branch-specific, long-term cellular memory trace after spaced olfactory conditioning. Neuron 52: 845–855.[CrossRef][Medline]

ZARS, T., M. FISCHER, R. SCHULZ and M. HEISENBERG, 2000 Localization of a short-term memory in Drosophila. Science 288: 672–675.[Abstract/Free Full Text]

Communicating editor: L. HARSHMAN

International Access Link

Online ISS 1091-6490
Copyright 2008 by the Genetics Society of America
phone: 412-268-1812   fax: 412-268-1813   email: genetics-gsa{at}andrew.cmu.edu