- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sudi, J.
- Articles by Zhang, P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sudi, J.
- Articles by Zhang, P.
Genetics, Vol. 179, 227-235, May 2008, Copyright © 2008
doi:10.1534/genetics.107.085498
Coincidence of P-Insertion Sites and Breakpoints of Deletions Induced by Activating P Elements in Drosophila
Jyotsna Sudi1, Sen Zhang2, Gino Intrieri, Ximing Hao and Ping Zhang3
Department of Molecular and Cell Biology, University of Connecticut, Storrs, Connecticut 06269-2131
3 Corresponding author: Department of Molecular and Cell Biology, University of Connecticut, Beach Hall, Room 328, Storrs, CT 06269-2131.
E-mail: ping.zhang{at}uconn.edu
We isolated a set of seven deletions in the 67B region by activating a nearby P-element insertion. The structures of the deletions were characterized by cloning and sequencing. The results showed that the P-induced deletions occurred nonrandomly in the genomic sites. One breakpoint of the deletions was located precisely at the end of the starting element, i.e., at the end of the inverted terminal repeats. The other breakpoint was nearby the retained starting element and coincided with preferential P-element insertion sites that harbor transcription initiation activities. It is known that P elements induce male recombination near the starting elements, giving rise to deletions with one breakpoint precisely located at an inverted terminal repeat of the retained starting element. Database analyses further revealed that deletions generated in P-induced male recombination also contained the other breakpoint in genomic regions that coincided with preferential P-insertion sites. The results suggest that nonrandom distribution of the deletion breakpoints is characteristic of the mechanism by which P elements induce deletions near the starting elements.
TRANSPOSON insertional mutagenesis has been systematically employed to study genetic function in Drosophila melanogaster (COOLEY et al. 1988; SPRADLING et al. 1999). Among the
15,000 genes in the Drosophila genome, more than one-third have been mutated by P insertions alone (BELLEN et al. 2004). A collection of
38,000 molecularly mapped insertions of transposons including P elements are currently available (CROSBY et al. 2007). The genomic target sites of P elements were diverse (LIAO et al. 2000), but their distribution was apparently nonrandom. While many genes were hotspots for P insertions, the majority of the Drosophila genes have not been mutated by the insertions (SPRADLING et al. 1999; BELLEN et al. 2004).
Nonrandom distribution of insertion sites not only was seen as hotspots and coldspots among genes, but also was characteristic of P insertions within genes. The insertion sites within a collection of 49 genes showed an overwhelming preference of P insertions in the 5'-noncoding regions (SPRADLING et al. 1995). Nonrandom distributions of P insertions, either among genes, or within genes, were also seen when P elements transposed locally (TIMAKOV et al. 2002). Local insertions nearby a starting element in the polytene chromosome region of 67B2-3 were exclusively located in 5'-promoter regions of a selective set of genes. For example, among 32 local insertions in a
12 kb segment, 17 insertions (53%) were located in the Hsp26 gene, indicating that this was a hotspot. However, several other genes located between the hotspots were coldspots without hits.
P insertions have greatly facilitated the characterization of Drosophila gene functions, although their preferential locations in the 5'-regulatory regions often disrupted only the functions of a subset of the regulatory elements. To generate a null mutation, targeted mutagenesis by homologous recombination has widely been used in recent years (RONG et al. 2002). Null phenotypes could also be uncovered with small deficiencies that remove genomic DNA of a single gene. DrosDel is a system to construct deficiencies for specific genomic segments, including a single gene (RYDER et al. 2004). The method is based on the FLP site-specific recombinase activity on two closely located and genetically engineered P insertions that carry the FRT sites (GOLIC and GOLIC 1996). More than 500,000 FRT-containing insertions for DrosDel have been generated. Similar techniques have also been applied in a deletion project that produced many large deficiencies (PARKS et al. 2004).
P elements transpose by a cut-and-paste mechanism (ENGELS 1989; RIO 2002). The excision of an element generates double-strand DNA breaks on the chromosome. Repair of the double-strand DNA breaks is erroneous, resulting in the production of partial P elements that appear as imprecisely excised transposons. The imprecise excision is frequently accompanied by loss of genomic sequences immediately flanking the starting P element, which became a tool to produce null mutations for genes whose 5' regulatory sequences were tagged with P insertions. In genetic screens to recover deficiencies from P imprecise excision, phenotypes associated with deletions extending into the flanking genes (TSUBOTA and SCHEDL 1986; SALZ et al. 1987), molecular detections of flanking genomic rearrangements (ZHANG and SPRADLING 1993), or a combination of phenotypic selection and molecular detection (MELLERICK et al. 1992; EANES et al. 2006; XU et al. 2006; HAO et al. 2007), were applied. Here, we characterized seven deletions generated by activating a nearby P element. The results showed an intriguing correlation between the breakpoints of P-induced deletions and P-insertion sites. Our data suggest that preferential P-insertional activity at genomic sites with transcription initiation activities plays a significant role in inducing genomic deficiencies flanking P elements.
Drosophila strains:
Flies were maintained on standard cornmeal/agar media at 25°. hsp27–0.7 is a deletion induced by activating a P-element insertion in the promoter of the Hsp27 gene (TIMAKOV et al. 2002; HAO et al. 2007). It retained the EP(3)3583 starting element along with the genomic sequences immediately flanking both ends of the element, but lost a 707-bp-genomic segment that contains the Hsp27 ORF.
Genetic screen to isolate strains that carried deletions:
The EP(3)3583 element was activated in the male germ line with the
2–3 transposase (Figure 1). Male progeny that displayed elevated eye color were selected to establish individual lines with a balancer chromosome (TM6, Tb).
|
Mapping with PCR:
Drosophila genomic DNA was isolated using a standard protocol as described in (ASHBURNER 1989). The polymerase chain reactions were carried out using the GeneAmp system (PE Applied Biosystems, Foster City, CA) under standard conditions on a Robocycler (Stratagene, La Jolla, CA). PCR primers used to map P-element-induced breakpoints of genomic sequences were derived from either the P element (RUBIN and SPRADLING 1983) or from the genomic sequences (CROSBY et al. 2007).Primers originated in the P element are as follows: Pp31, 5' CGACGGGACCACCTTATGTTATTTCATCATG 3'; PE5', 5' AATTCGTCCGCACACAAC 3'.
Primers derived from the genomic sequences are as follows: R-a, 5' ACATTGGGTGTGTTGTGG 3'; L-a, 5' GAGCCAGAAGATGCGAGA 3'; L-b, 5' CTTGGGAATACTGACGGT 3'; L-c, 5' GATACAGCAAGTGAGTTT 3'; L1, 5' TGCCCTTCTATGAGCCCTAC 3'; L2, 5' GCCTGCTGCTCTACCTCT 3'; L3, 5' GGTCCCACTTGCTGAA 3'; L4, 5' CCGTCAACAAGGATGGCTAC 3'; L5, 5' CATTCTGGAAGAGATCCGATG 3'; L6, 5' ATGTTCGCACTTCTTGCA 3'; R1, 5' CCTCCTTGGGATTCTCCTTC 3'; R2, 5' TAGCTGCACATTTGCTTG 3'; R3, 5' GCGCGTACGACAACAACT 3'; R4, 5' CTACTGACTGGCGGCTTTGT 3'; R5, 5' TGCCAGATATTCCCTTTGTCT 3'; R6, 5' ACAGATGGCGCGAGAAAC 3'.
Inverse PCR analysis:
To clone genomic sequences flanking P elements, inverse polymerase chain reaction was used by adopting the IPCR protocols in the Berkeley Drosophila Genome Project (CROSBY et al. 2007). Two restriction enzymes each with a 4-bp recognition site were used in our experiments (MspI and HhaI). Two IPCR primers complementary to the 5' end of the EP element were Plac1, 5' CACCCAAGGCTCTGCTCCCACAAT 3'; Pwht1, 5' GTAACGCTAATCACTCCGAACAGGTCACA 3'.
Sequencing:
The PCR products were purified by using a PCR purification kit (QIAGEN, Valencia, CA) to remove primers and nucleotides and were then used as templates in subsequent sequencing reactions with nested primers.Production of P-element-induced deficiencies:
In D. melanogaster, a cluster of four small heat-shock genes, including Hsp22, Hsp23, Hsp26, and Hsp27, is located within a
12-kb segment of the 67B region on chromosome 3. In an attempt to generate deficiencies for all of the small Hsp genes by P-imprecise excision, we took a combination of genetic and molecular approaches that were similar to the methods described in (HAO et al. 2007). Briefly, the EP(3)3583 element retained in the hsp27–0.7 deletion was used as the starting element (MATERIALS AND METHODS). It was activated in males to produce progeny that displayed elevated eye pigmentation (Figure 1). Because the expression of the marker gene in the starting element, mini-white, is influenced by flanking genomic DNA, a rearrangement in the flanking sequences, such as a deletion, could modify the marker gene activity. Progeny with modified eye color were candidates for deficiencies that removed genomic sequences flanking the transposon. Since the mini-white marker gene of the starting element was expressed at a relatively low level, it was convenient to isolate progeny with elevated eye pigmentation, upon activation of the P element (Figure 1). A total of 382 strains were established from individual males with elevated eye pigmentation. The genomic DNA from each of these strains was isolated and subsequently analyzed to determine whether they contained novel deficiencies for the small Hsp genes.
Detection of P-element induced deficiencies:
To detect genomic rearrangements 5' to EP(3)3583, we used a simple PCR experiment with a pair of primers, Pp31 and L1. Pp31 was derived from the 31-bp-inverted-terminal repeats of the P element in an outward orientation, while L1 is located
1.9 kp from EP(3)3583 and is oriented toward the P element (Figure 2). Among the 382 genomic DNA samples, a total of 33 failed to produce PCR products with Pp31 and L1. To determine whether the candidate strains contained deficiencies for the Hsp genes, the 33 candidate strains were further examined by PCR with a pair of primers derived from the Hsp23 gene, L1 and R1 (Figure 2). This PCR experiment was facilitated by the presence of flies homozygous for the candidate chromosome in all 33 strains. The results from PCR using genomic templates isolated from each of the homozygotes showed that 7 of the 33 strains failed to produced a PCR product with L1 and R1, indicating that this set of 7 strains contained mutations for the Hsp23 gene (Table 1).
|
|
We then asked if the original P element was retained in this set of seven strains. A pair of primers, Pp31 and R-a, was used to amplify the genomic sequence flanking the 3' end of EP(3)3583 associated with the hsp27–0.7 allele (Figure 2). Due to the 707-bp genomic deletion, the hsp27-0.7 allele was expected to produce a
0.4-kb band, instead of the
1.1-kb band that would have originated without the deletion adjacent to the starting element. We have determined that all of the seven strains in this set produced a
0.4-kb band with the pair of Pp31 and R-a, indicating that at least the 3' end of the initial P element was retained in each of the strains (Table 1). The remaining 26 strains among the initial 33 strains each produced a product of the wild-type size with the L1 and R1 pair. Thus, these strains carried genomic arrangements in either the 31-bp-terminal-inverted repeat of the P element or in the genomic DNA immediately flanking the 5' end of the P element. These strains were not further characterized.
Mapping seven deficiencies and determining their breakpoints:
The breakpoints in seven deficiency candidates for the small Hsp genes were mapped by using PCR with primers mainly distributed in a
12-kb genomic region distal to EP(3)3583 (Figure 2). An additional pair, L6 and R6, was derived from the CG4452 gene, which is located at a more distal segment on the genomic map (
6 kb to the left of Hsp22 in Figure 2).
The results obtained from PCR mapping using genomic templates isolated from each of the homozygous deficiency candidates are summarized in Table 1. The data indicate that each of the seven strains contained breakpoints within the
12-kb genomic region shown in Figure 2. The data also suggest that only the 204 strain retained the genomic DNA immediately flanking the starting P element. In addition, two primer pairs distal to the Hsp67Bb gene (L5 and R5 and L6 and R6) were used to map the distal breakpoints of the deletions. With both of the primer pairs, all of the deficiencies produced PCR products of the sizes of the wild-type control, indicating that the deficiency breakpoints were restricted in the mapping region.
To determine the breakpoints for each of the deficiencies at the molecular level, genomic sequences containing the breakpoints were cloned and sequenced. Two complementary methods were used to clone the genomic sequences. One was to clone the breakpoints using inverse PCR (IPCR), while the other was to clone the sequences directly with PCR by using the mapping data described in Table 1. The IPCR method to clone genomic sequences flanking a P element was provided in detail by the FlyBase (CROSBY et al. 2007). In the second method, the breakpoints were cloned directly from genomic DNA, which was facilitated from the mapping results in Table 1. With a primer derived from the 5' end of the P element in an outward orientation (e.g., Plac1 or Pp31), and another primer that was located near the breakpoints of a deficiency and orientated toward EP(3)3583 (e.g., L-b or L-c), a genomic fragment containing the breakpoints was amplified. The cloned fragments were then sequenced with nested primers.
The results obtained from the cloning and sequencing are summarized in Table 2 and schematically presented in Figure 2. Among the seven deficiencies, five contained deletions of genomic sequences beginning precisely at the 5' end of the EP(3)3583 transposon. Another deletion, the 321 deficiency, also had a precise deletion at the 5' end of EP(3)3583, but contained an additional 26-bp sequence of GGACCACCTTATGTTATTTCATCATG, a nearly complete direct copy of the 31-bp inverted terminal repeats. In contrast, the 204 deficiency retained the genomic sequence immediately flanking EP(3)3583, but contained a deletion beginning at 779 bp distal to the 5' end of the transposon. In addition, three extra nucleotides, ATG, were inserted at the junction of the breakpoints of the 204 deficiency. Interestingly, the ATG trinucleotides were also present on one side of the breakpoints that were apparently derived from the parental genomic sequence (Table 2).
|
The coincidence of the P-induced-deletion breakpoints with genomic sites of P insertions:
Our mapping and sequencing data showed that, in all but one deficiency, one of the breakpoints was in a genomic site where a nearby small Hsp gene initiated its transcription, while the other was precisely located at the 5' end of EP(3)3583 (Table 2). The exception was the 204 deficiency, in which one of the breakpoints was different. Despite containing no breakpoint at the 5' end of EP(3)3583, the distal breakpoints in the 204 deficiency were located in the 5' region of the Hsp22 genes (Table 2, Figure 2).P elements are known to preferentially insert into 5' ends of genes (SPRADLING et al. 1995). A collection of P insertions into the small Hsp genes at the FlyBase also showed that the insertions were located predominantly within the promoter regions of the target genes (Figure 2). When EP(3)3583 was activated, local insertions into the nearby small Hsp genes were located exclusively within the promoter regions of the target genes (Figure 2). Thus, P insertions into the small Hsp genes, whether they were generated through local or nonlocal transpositions, were preferentially localized in the promoter regions of the small Hsp genes.
Compared with the insertion sites of P elements in the Hsp22, Hsp23, and Hsp26 genes, the breakpoints of the deficiencies generated from activating EP(3)3583 coincided with the genomic sites where the P elements inserted (Figure 2, A–C). For example, clusters of P insertions, local or nonlocal insertions, were found in two discrete genomic regions upstream of the transcription initiation site of the Hsp26 gene. These two insertion sites coincided with three EP(3)3583-induced deficiencies. The 34 deficiency had a breakpoint coincide with one of the insertion sites, while the 235 and 247 deficiencies had breakpoints coincide with the other insertion site (Table 2 and Figure 2). Thus, the EP(3)3583 induced deletions had nonrandom breakpoints that coincided with P-insertion sites, suggesting the involvement of P-insertional activities in the induction of these deletions.
The correlation between deletion breakpoints of P-induced male recombination and P-insertion sites in the 50C19-20 region:
Of a total of seven deficiencies induced by activating EP(3)3583, six had a breakpoint located precisely at the 5' terminus of the retained P element. The deletions with a breakpoint precisely at a P-element terminus are notably reminiscent of deletions associated with P-induced male recombination (KIDWELL et al. 1977; GRAY et al. 1996; PRESTON and ENGELS 1996). Although Drosophila meiotic recombination does not normally occur in males, recombination in the male germ line could be induced at low levels (
1%) by P-element transposition activities (PRESTON and ENGELS 1996). Male recombination was often accompanied by chromosome rearrangements, including deletions and duplications, which contained one of the breakpoints precisely located at one of the 31-bp-terminal-inverted repeats of a retained P element (GRAY et al. 1996; PRESTON et al. 1996). A mechanism involving "hybrid element insertion" (HEI) was proposed to explain the occurrence of the chromosome rearrangements in male recombination. In the HEI model, the 5' end of a P element on a sister chromatid interacts with the 3' end of the P element copy on the other sister chromatid, to form an active hybrid element (GRAY et al. 1996; PRESTON et al. 1996). The hybrid element composed of two P-element copies on the sister chromatids of a chromosome inserts in a nearby position on the homolog, giving rise to the deletions and duplications adjacent to the retained P element. The similarity of the breakpoints at a terminus of the P-element inverted repeats between the deletions induced by activating EP(3)3583 and by P-induced male recombination raised a possibility that the seven deletions might be the results of male recombination induced by activating EP(3)3583. Since the deletion breakpoints produced from activating EP(3)3583 coincided with P-element preferential insertion sites, which were nearly exclusively located at the 5' end of the small Hsp genes (Figure 2), it is possible that this coincidence is a common feature for deletions of male recombination induced by HEI.
To examine the relationship between P-induced deletions in male recombination and P-insertional activity, we carried out a database search for P insertions in a small chromosome 2 region, in which a large number of deletions of male recombination were previously investigated. PRESTON et al. (1996) activated a P insertion in the male germ line, P{CaSpeR}Cp150c (PRESTON et al. 1996, 2002) and isolated 21 deletions within a
1.4-kb genomic segment in the polytene 50C19-20 region. The breakpoints of the deletions were disproportionately distributed, with the vast majority distal to the starting P element (17/21, or
81%, Figure 3A). This pattern of an unequal distribution was well-correlated with that of P insertions found in the FlyBase, which were also located predominantly in genomic sequences distal to the P{CaSpeR}Cp150c starting site (11/13, or
85%, Figure 3B).
|
It was intriguing to notice that the deletion breakpoints from both activating EP(3)3583 and P{CaSpeR}Cp150c were nonrandom, displaying a strong correlation with P-insertional sites. However, frequent targeting of P elements in 50C19-20, which is in an intron of the Cp1 gene, was puzzling, because introns were rarely targeted by P elements (SPRADLING et al. 1995; VENKEN and BELLEN 2005). Since P elements preferentially target transcription initiation regions, a database search was carried out to examine transcriptional activities in 50C19-20. As shown in Table 3, a total of 22 expression sequence tags (ESTs) with 5'-end sequences transcribed from 50C19-20 were identified in the FlyBase. Thus, despite being an intron, genomic sequences in the 50C19-20 region could serve as active transcription initiation sites, because of the identification of cDNA clones with 5'-end sequences localized in this intronic region. The transcriptional activities initiated in 50C19-20 could explain why P elements frequently targeted this genomic region.
|
|
In addition, the data also showed a nonrandom distribution of the ESTs. Similar to that of P insertions, all but one of these ESTs contained the 5'-end sequences localized to the distal side of the starting P element, indicating a correlation between P insertions and transcription initiation activities in 50C19-20 (Figure 3).
P-induced deletions and imprecise excision:
Excision of P elements generates double-strand breaks, which are substrates of DNA repair machineries (ENGELS 1989; RIO 2002; PRESTON et al. 2006). Double-strand repairs are often aberrant, resulting in imprecise excision of P elements with deletions or additions of extra sequences (TAKASU-ISHIKAWA et al. 1992; JOHNSON-SCHLITZ and ENGELS 1993; STAVELEY et al. 1995). Deletions induced by imprecise excision could extend into the flanking genomic sequences (TSUBOTA and SCHEDL 1986; SALZ et al. 1987), which has been a widely used tool to generate null mutations near known P insertions (VENKEN and BELLEN 2005). In addition to genomic deletions extended from the imprecisely excised P elements, activating P insertions could also produce flanking genomic deletions while retaining the starting elements (ZHANG and SPRADLING 1993; HAO et al. 2007).In this report, all of the seven deletions isolated by activating EP(3)3583 apparently retained the starting element. First, the mini-white marker gene of the element was expressed in each deletion strain. Second, the inverted repeats on both ends of the transposon were present in each deletion strain (e.g., Table 1). Third, the genomic sequence proximal to EP(3)3583 was retained in each deletion strain. Finally, at least 1,000 bp sequences of the 5' end of the starting EP(3)3583 appear to be retained. This is because the restriction sites used in IPCR, as well as P sequences corresponding to the PE5', Plac1 and Pwht1 primers, were retained. The presence of some of these 5' sequences was confirmed in the sequencing experiments.
In the genetic screen to isolate the deletions, a change of the marker gene expression could result from either a rearrangement of genomic sequences flanking the starting element or an insertion in another chromosomal location. The selection of the marker expression could thus be a main factor in the retentiveness of the starting transposon. However, this selection should not prevent the isolation of genomic rearrangements that contained small deletions or additions of P-element sequences, which were often associated with imprecise excision. To explain the isolation of the seven deletions with no obvious rearrangements of the starting element, we propose that a mechanism other than imprecise excision played a role in inducing the deletions.
P-induced deletions and the HEI model:
Mechanistically, the production of deletions from P-induced male recombination is best explained by the HEI model, in which a hybrid element inserts into a nearby site on the homolog, resulting in deletions and duplications (SVOBODA et al. 1995; GRAY et al. 1996; PRESTON et al. 1996). The hybrid element is composed of the 5' end of one transposon on a chromatid and the 3' end of the transposon copy on the sister chromatid (Figure 4).The deletions induced by activating EP(3)3583 also fit the HEI model, since they shared a number of molecular characteristics with deletions produced from P-induced male recombination. One of the breakpoints in the deletions produced from activating EP(3)3583 was precisely located at the P-inverted terminal repeat (Table 2), resembling those of deletions isolated from P-induced male recombination (SVOBODA et al. 1995; GRAY et al. 1996; PRESTON et al. 1996). The similarities between the deletions described here and deletions of the male recombination extended to the genomic sites of the other breakpoint, which were nonrandomly distributed in targets of P insertions and harbored transcription initiation activities (Figures 2 and 3). Another shared feature is that these deletions involved only one end of the starting elements (Figures 2 and 3).
The 321 deficiency contained a 26-bp imperfect duplication of the 31-bp-inverted-terminal repeats (Table 2). Interestingly, a deletion from P-induced male recombination also had a 26-bp imperfect duplication of the terminal repeats at the deletion junction (PRESTON et al. 1996). These two duplications might result from P-element transposition into the starting element copy on the sister chromatid followed by an imprecise excision (PRESTON et al. 1996).
In addition to the deletions that were presumably induced by HEI, the 204 deficiency apparently resulted from a different mechanism. It did not contain a breakpoint precisely at the end of the starting element. This deletion could be explained by an insertion to a nearby genomic site followed by an imprecise excision of the newly inserted element. At its deletion junction, there was a trinucleotide insertion (ATG). The hsp27–0.7 deletion contained similar features, including both of the breakpoints located within flanking genomic sequences and a trinucleotide insertion (GAA) at the deletion junction (HAO et al. 2007). In both deletions, the extra trinucleotide was identical to the junction sequence, as if it were a direct duplication of the genomic sequence at the junction (Table 2; and in (HAO et al. 2007).
Alternatively, the 204 deficiency could result from a more complicated rearrangement. A 13-nucleotide sequence at the junction of the deletion (underlined), AAGTTCTTGACTACACCCATGATGAAATAATTACGTGCATGCACACAT, is also homologous to the P-end inverted repeats. It is possible that this breakpoint is the result of a P-element insertion at the distal region, followed by base pairing to break-induced DNA replication from the original P-element excision site.
Local insertion and HEI:
P elements preferentially insert into genomic sites near the starting elements (TOWER et al. 1993; ZHANG and SPRADLING 1993). The local insertions were nonrandomly distributed among genes, showing a pattern similar to that of nonlocal insertions with hotspots and coldspots (Figure 2). Local insertions seem to target only at promoter regions, since the insertion sites were mapped exclusively to nearby transcription initiation sites (TIMAKOV et al. 2002; SHILOVA et al. 2006).Similar to local transposition, P-induced male recombination occurred mostly near the starting element (DUTTAROY et al. 1990; MCCARRON et al. 1994; PRESTON and ENGELS 1996). The HEI sites were also frequent P-insertion targets (Figure 3). The deletions induced by activating EP(3)3583, which were presumably induced by HEI, showed similar coincidence among the deletion breakpoints, P-insertions sites, and transcription initiation sites (Figure 2). These similarities between local insertion sites and the sites of P-induced male recombination suggest that local insertion and HEI share some mechanistic aspects that mediate these two P-insertional activities.
A difference between local insertion and HEI seems to be the chromosomal apparatus on which P elements operate. In HEI, P-induced male recombination occurs between a pair of homologs (Figure 4). Although whether P elements transpose locally between a pair of homologs remains unclear, a study found that such nearby insertions on the homolog, if any, were rare (TOWER and KURAPATI 1994). Thus, preferential local insertions appear to be restricted to the donor chromosome. There is also evidence indicating that local insertions were further restricted on the two sister chromatids of the chromosome where the starting element was excised. If P elements transposed locally onto the chromatid on which the starting element was excised, the "cut-and-paste" model would predict loss of the starting element or imprecise excision due to aberrant double-strand DNA repair (ENGELS 1989). The vast majority of the local insertions were, on the contrary, isolated along with the retained starting elements (TOWER et al. 1993; ZHANG and SPRADLING 1993; TIMAKOV et al. 2002; SHILOVA et al. 2006). The retaining of the starting elements indicates that the donor chromatid, on which a P element is excised, rarely serves as a target for local insertions (Figure 4).
The HEI model also predicts insertion of a hybrid element in a sister chromatid of the chromosome where the hybrid element was generated (Figure 4). Such sister-chromatid HEI insertions were implicated in a prior study using a ring X chromosome (SVED and LIANG 2006). The results from the present study could not be used to investigate if sister-chromatid HEIs, or homolog HEIs, were involved in generating the deletions, since the chromosome region distal to the starting element was not marked. However, a recent study suggests that HEI on sister chromatids of the starting element might occur infrequently. In an effort to characterize the Hsp27 function, HAO et al. (2007) used genetic and molecular methods, which are identical to those used here, to isolate genomic deletions proximal to EP(3)3583 (Figure 2). Because the genomic region of interest is between EP(3)3583 in 67B and the transposase source,
2-3 in 99B (linked with Sb), a male recombination in this region would produce a product together with the right arm carrying Sb and
2-3 (for the relative positions, see Figure 1). Since the resulting chromosome with Sb and
2-3 was selected against in subsequent genetic crosses, these experiments should have excluded the recovery of proximal deletions from HEI male recombination between a pair of homologs. Nonetheless, other proximal deletions derived from HEI on the EP(3)3583 chromosome were recoverable, if sister-chromatid HEIs were to occur. Among a collection of 145 candidate strains, a deletion, hsp27–0.7, was isolated (Figure 2). However, this deletion does not contain a breakpoint precisely located at the end of a 31-bp-inverted-terminal repeat, which is characteristic of HEI, although it retained the starting element. It also retained the genomic sequences immediately flanking both sides of the element. In addition, it carried three extra nucleotides inserted at the junction of the breakpoints. Thus, deletions proximal to the EP(3)3583 element that might be produced from sister-chromatid HEIs were not recovered in the experiments (0/145, (HAO et al. 2007). The results suggest that HEI occurs infrequently on the sister chromatids, although it is also possible that the genetic screen, i.e., eye color change after activating the starting element, played a role in the failure of isolating proximal deletions that were expected from sister-chromatid HEIs.
We propose that an excised P element preferentially inserts locally in a sister chromatid other than the one on which the starting element is excised, whereas an active HEI complex may frequently result in an insertion in the homologous chromosome (Figure 4). To explain frequent local insertion (ZHANG and SPRADLING 1993), proteins bound to P-element termini (LEE et al. 1996; BEALL and RIO 1998; TANG et al. 2005) are thought to tether the excised element to the unexcised copy on the sister chromatid, giving rise to a local insertion event near the starting element. An alternative explanation is that local transposition may occur shortly after DNA replication, during which the two copies of the P elements are still in a close association. The excised copy inserts locally due to its association with the unexcised copy on the sister chromatid (ZHANG and SPRADLING 1993). HEI, on the other hand, may occur by and large at a different stage of the mitotic cell cycles of the spermatocytes, during which homologous sequences are paired in a preparation for meiosis. Perhaps, HEI not only requires a close proximity of insertion targets that are transcriptionally active, but also needs the presence of other factors, which are assembled only on the paired homolog complex at later stages of spermatogenesis, to resolve its products containing rearranged chromosomes.
2 Present address: Department of Biology, Shanghai Normal University, Shanghai 200234, People's Republic of China. ![]()
ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BEALL, E. L., and D. C. RIO, 1998 Transposase makes critical contacts with, and is stimulated by, single-stranded DNA at the P element termini in vitro. EMBO J. 17: 2122–2136.[CrossRef][Medline]
BELLEN, H. J., R. W. LEVIS, G. LIAO, Y. HE, J. W. CARLSON et al., 2004 The BDGP gene disruption project: single transposon insertions associated with 40% of Drosophila genes. Genetics 167: 761–781.
COOLEY, L., R. KELLEY and A. SPRADLING, 1988 Insertional mutagenesis of the Drosophila genome with single P elements. Science 239: 1121–1128.
CROSBY, M. A., J. L. GOODMAN, V. B. STRELETS, P. ZHANG and W. M. GELBART, 2007 FlyBase: genomes by the dozen. Nucleic Acids Res. 35: D486–D491.[CrossRef][Medline]
DUTTAROY, A., M. MCCARRON, K. SITARAMAN, G. DOUGHTY and A. CHOVNICK, 1990 The relationship between P elements and male recombination in Drosophila melanogaster. Genetics 124: 317–329.[Abstract]
EANES, W. F., T. J. MERRITT, J. M. FLOWERS, S. KUMAGAI, E. SEZGIN et al., 2006 Flux control and excess capacity in the enzymes of glycolysis and their relationship to flight metabolism in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 103: 19413–19418.
ENGELS, W. R., 1989 P elements in Drosophila melanogaster, pp. 437–484 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington, D.C.
GOLIC, K. G., and M. M. GOLIC, 1996 Engineering the Drosophila genome: chromosome rearrangements by design. Genetics 144: 1693–1711.[Abstract]
GRAY, Y. H., M. M. TANAKA and J. A. SVED, 1996 P-element-induced recombination in Drosophila melanogaster: hybrid element insertion. Genetics 144: 1601–1610.[Abstract]
HAO, X. M., S. ZHANG, B. TIMAKOV and P. ZHANG, 2007 The Hsp27 gene is not required for Drosophila development but its activity is associated with starvation resistance. Cell Stress Chaperones 12: 364–372.[Medline]
JOHNSON-SCHLITZ, D. M., and W. R. ENGELS, 1993 P-element-induced interallelic gene conversion of insertions and deletions in Drosophila melanogaster. Mol.Cell Biol. 13: 7006–7018.
KIDWELL, M. G., J. F. KIDWELL and J. A. SVED, 1977 Hybrid dysgenesis in Drosophila melanogaster: a syndrome of aberrant traits including mutation, sterility, and male recombination. Genetics 86: 813–833.
LEE, C. C., Y. M. MUL and D. C. RIO, 1996 The Drosophila P-element KP repressor protein dimerizes and interacts with multiple sites on P-element DNA. Mol. Cell Biol. 16: 5616–5622.[Abstract]
LIAO, G. C., E. J. REHM and G. M. RUBIN, 2000 Insertion site preferences of the P transposable element in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 97: 3347–3351.
MCCARRON, M., A. DUTTAROY, G. DOUGHTY and A. CHOVNICK, 1994 Drosophila P element transposase induces male recombination additively and without a requirement for P element excision or insertion. Genetics 136: 1013–1023.[Abstract]
MELLERICK, D. M., J. A. KASSIS, S. D. ZHANG and W. F. ODENWALD, 1992 castor encodes a novel zinc finger protein required for the development of a subset of CNS neurons in Drosophila. Neuron 9: 789–803.[CrossRef][Medline]
PARKS, A. L., K. R. COOK, M. BELVIN, N. A. DOMPE, R. FAWCETT et al., 2004 Systematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome. Nat. Genet. 36: 288–292.[CrossRef][Medline]
PRESTON, C. R., W. ENGELS and C. FLORES, 2002 Efficient repair of DNA breaks in Drosophila: evidence for single-strand annealing and competition with other repair pathways. Genetics 161: 711–720.
PRESTON, C. R., and W. R. ENGELS, 1996 P-element-induced male recombination and gene conversion in Drosophila. Genetics 144: 1611–1622.[Abstract]
PRESTON, C. R., C. C. FLORES and W. R. ENGELS, 2006 Differential usage of alternative pathways of double-strand break repair in Drosophila. Genetics 172: 1055–1068.
PRESTON, C. R., J. A. SVED and W. R. ENGELS, 1996 Flanking duplications and deletions associated with P-induced male recombination in Drosophila. Genetics 144: 1623–1638.[Abstract]
RIO, D. C., 2002 P transposable elements in Drosophila melanogaster, pp. 484–518 in Mobile DNA II, edited by E N. L. CRAIG, R. CRAIGIE, M. GELLERT and A. M. LAMBOWITZ. American Society for Microbiology, Washington, DC.
RONG, Y. S., S. W. TITEN, H. B. XIE, M. M. GOLIC, M. BASTIANI et al., 2002 Targeted mutagenesis by homologous recombination in D. melanogaster. Genes Dev. 16: 1568–1581.
RUBIN, G. M., and A. C. SPRADLING, 1983 Vectors for P element-mediated gene transfer in Drosophila. Nucleic Acids Res. 11: 6341–6351.
RYDER, E., F. BLOWS, M. ASHBURNER, R. BAUTISTA-LLACER, D. COULSON et al., 2004 The DrosDel collection: a set of P-element insertions for generating custom chromosomal aberrations in Drosophila melanogaster. Genetics 167: 797–813.
SALZ, H. K., T. W. CLINE and P. SCHEDL, 1987 Functional changes associated with structural alterations induced by mobilization of a P element inserted in the Sex-lethal gene of Drosophila. Genetics 117: 221–231.
SHILOVA, V. Y., D. G. GARBUZ, E. N. MYASYANKINA, B. CHEN, M. B. EVGEN'EV et al., 2006 Remarkable site specificity of local transposition into the Hsp70 promoter of Drosophila melanogaster. Genetics 173: 809–820.
SPRADLING, A. C., D. M. STERN, I. KISS, J. ROOTE, T. LAVERTY et al., 1995 Gene disruptions using P transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. USA 92: 10824–10830.
SPRADLING, A. C., D. STERN, A. BEATON, E. J. RHEM, T. LAVERTY et al., 1999 The Berkeley Drosophila Genome Project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153: 135–177.
STAVELEY, B. E., T. R. HESLIP, R. B. HODGETTS and J. B. BELL, 1995 Protected P-element termini suggest a role for inverted-repeat-binding protein in transposase-induced gap repair in Drosophila melanogaster. Genetics 139: 1321–1329.[Abstract]
SVED, J. A., and X. LIANG, 2006 Evidence of P-element-induced sister-chromatid exchange in a ring-X chromosome in Drosophila, with implication for a high rate of formation of hybrid elements. Genetics 172: 975–979.
SVOBODA, Y. H., M. K. ROBSON and J. A. SVED, 1995 P-element-induced male recombination can be produced in Drosophila melanogaster by combining end-deficient elements in trans. Genetics 139: 1601–1610.[Abstract]
TAKASU-ISHIKAWA, E., M. YOSHIHARA and Y. HOTTA, 1992 Extra sequences found at P element excision sites in Drosophila melanogaster. Mol. Gen. Genet. 232: 17–23.[CrossRef][Medline]
TANG, M., C. CECCONI, H. KIM, C. BUSTAMANTE and D. C. RIO, 2005 Guanosine triphosphate acts as a cofactor to promote assembly of initial P-element transposase-DNA synaptic complexes. Genes Dev. 19: 1422–1425.
TIMAKOV, B., X. LIU, I. TURGUT and P. ZHANG, 2002 Timing and targeting of P-element local transposition in the male germline cells of Drosophila melanogaster. Genetics 160: 1011–1022.
TOWER, J., and R. KURAPATI, 1994 Preferential transposition of a Drosophila P element to the corresponding region of the homologous chromosome. Mol. Gen. Genet. 244: 484–490.[CrossRef][Medline]
TOWER, J., G. H. KARPEN, N. CRAIG and A. C. SPRADLING, 1993 Preferential transposition of Drosophila P elements to nearby chromosomal sites. Genetics 133: 347–359.[Abstract]
TSUBOTA, S., and P. SCHEDL, 1986 Hybrid dysgenesis-induced revertants of insertions at the 5' end of the rudimentary gene in Drosophila melanogaster: transposon-induced control mutations. Genetics 114: 165–182.
VENKEN, K. J., and H. J. BELLEN, 2005 Emerging technologies for gene manipulation in Drosophila melanogaster. Nat. Rev. Genet. 6: 167–178.[Medline]
XU, Y., M. CONDELL, H. PLESKEN, I. EDELMAN-NOVEMSKY, J. MA et al., 2006 A Drosophila model of Barth syndrome. Proc. Natl. Acad. Sci. USA 103: 11584–11588.
ZHANG, P., and A. C. SPRADLING, 1993 Efficient and dispersed local P element transposition from Drosophila females. Genetics 133: 361–373.[Abstract]
Communicating editor: K. G. GOLIC
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sudi, J.
- Articles by Zhang, P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sudi, J.
- Articles by Zhang, P.



