A canonical Ras–ERK signaling pathway specifies the fate of the excretory duct cell during Caenorhabditis elegans embryogenesis. The paralogs ksr-1 and ksr-2 encode scaffolding proteins that facilitate signaling through this pathway and that act redundantly to promote the excretory duct fate. In a genomewide RNAi screen for genes that, like ksr-2, are required in combination with ksr-1 for the excretory duct cell fate, we identified 16 "ekl" (enhancer of ksr-1 lethality) genes that are largely maternally required and that have molecular identities suggesting roles in transcriptional or post-transcriptional gene regulation. These include the Argonaute gene csr-1 and a specific subset of other genes implicated in endogenous small RNA processes, orthologs of multiple components of the NuA4/Tip60 histone acetyltransferase and CCR4/NOT deadenylase complexes, and conserved enzymes involved in ubiquitination and deubiquitination. The identification of four small RNA regulators (csr-1, drh-3, ego-1, and ekl-1) that share the Ekl phenotype suggests that these genes define a functional pathway required for the production and/or function of particular germline small RNA(s). These small RNAs and the other ekl genes likely control the expression of one or more regulators of Ras–ERK signaling that function at or near the level of kinase suppressor of Ras (KSR).

---

THE Ras–Raf–MEK–ERK signaling pathway is used repeatedly during metazoan development to control many different cellular events (for example, see SIMON et al. 1991; MELNICK et al. 1993; JOHNSON et al. 1997; WOJNOWSKI et al. 1997; SUNDARAM 2006; SCHOLL et al. 2007). The kinase suppressor of Ras (KSR) scaffolding protein facilitates signaling through this pathway, at least in part by binding the kinase MEK and promoting its colocalization with the kinases Raf and ERK (CLAPERON and THERRIEN 2007). KSR also binds other partners that may contribute to Raf kinase activation (DOUZIECH et al. 2006; RITT et al. 2007). Although KSR is clearly important for signaling in vivo, its precise role and mode of regulation are not well understood. KSR was originally discovered in Caenorhabditis elegans and Drosophila (KORNFELD et al. 1995; SUNDARAM and HAN 1995; THERRIEN et al. 1995), and genetic screens in these systems are one approach for identifying additional factors important for KSR function.

In C. elegans, as in mammals, KSR is encoded by two paralogous genes, ksr-1 and ksr-2, which have both overlapping and unique functions (OHMACHI et al. 2002; CHANNAVAJHALA et al. 2003). For example, ksr-1 and ksr-2 are redundantly required for Ras–ERK-dependent specification of vulval and excretory duct cell fates, while ksr-1 alone is required for Ras–ERK-dependent sex myoblast migration, and ksr-2 alone is required for Ras–ERK-dependent germline meiotic progression. At least some of the unique functions of these paralogs probably can be explained by differences in soma vs. germline expression, with ksr-1 (like most X-linked genes in C. elegans) being more highly expressed in the soma (REINKE et al. 2000; KELLY et al. 2002; MACIEJOWSKI et al. 2005), leaving ksr-2 responsible for most germline functions.

One of the earliest developmental events that requires ksr-1 and ksr-2 is specification of the excretory duct cell fate (OHMACHI et al. 2002). The excretory duct is a component of the worm's primitive renal system that functions in osmoregulation and is essential for viability (NELSON and RIDDLE 1984). It is located in the head, just ventral to the posterior pharynx, and it can be easily visualized with the reporter transgene lin-48::gfp (Figure 1) (JOHNSON et al. 2001). The duct forms during embryogenesis from the left member of the excretory duct/G1 neuroblast equivalence group (SULSTON et al. 1983). In let-60 ras loss-of-function mutants, both members of this equivalence group adopt a G1 fate, whereas in let-60(gf) mutants, both adopt a duct fate (YOCHEM et al. 1997). let-60 ras functions cell autonomously within the duct precursor and appears to mediate an inductive signaling event in the embryo that promotes the duct (vs. G1) fate (YOCHEM et al. 1997). LIN-3/EGF is likely to be the relevant signaling ligand, as lin-3 mutants lack an excretory duct cell, and lin-3 is expressed in nearby embryonic cells at the relevant time (M. SUNDARAM, unpublished data). Loss of the excretory duct cell can explain the zygotic "rod-like lethality" of let-60 ras and other Ras pathway mutants, since without this cell larvae rapidly fill with fluid, become turgid, and die (NELSON and RIDDLE 1984; YOCHEM et al. 1997). Although animals lacking either ksr-1 or ksr-2 usually have an excretory duct cell and are viable, animals lacking both ksr-1 and ksr-2 lack a duct cell and are rod-like lethal (Figure 1), thus demonstrating that ksr-1 and ksr-2 are redundantly required for Ras-dependent excretory duct cell fate specification (OHMACHI et al. 2002).

View larger version (85K): In this window In a new window Download PPT slide   FIGURE 1.— Absence of the excretory duct cell in ekl; ksr-1 animals. Differential interference contrast (DIC) (A, C, and E) and GFP fluorescence (B, D, and F) images of L1 larvae carrying the plin-48::gfp transgene saIs14 (JOHNSON et al. 2001; SEWELL et al. 2003) are shown. plin-48::GFP is expressed in the excretory duct cell (arrow), as well as a few other cells (arrowheads) in the head and the tail of L1-stage saIs14; ksr-1(n2526) larvae (A and B). In contrast, no excretory duct cell is visible in dying larvae from ksr-2(RNAi); saIs14; ksr-1(n2526) (C and D) and csr-1(RNAi); saIs14; ksr-1(n2526) (E and F) strains, although plin-48::GFP expression is still apparent elsewhere. Similar results were obtained with the other ekl genes (data not shown).

 
To identify genes required for KSR function, we conducted a genomewide RNAi screen for "ekl" (enhancer of ksr-1 lethality) genes whose depletion mimics loss of ksr-2 and causes excretory duct loss in a ksr-1 null mutant background. The majority of genes identified in this screen appear to be required in the maternal germline to regulate gene expression at the transcriptional or the post-transcriptional level. These include the Argonaute gene csr-1 and a specific subset of other genes implicated in endogenous small RNA processes, orthologs of multiple components of the NuA4/Tip60 histone acetyltransferase complex and the CCR4/NOT deadenylase complex, and conserved enzymes involved in ubiquitination and deubiquitination. We hypothesize that these genes cooperate to affect the expression and/or function of targets critical for KSR scaffold activity.

General methods and alleles:

General methods for the handling, culturing, and EMS mutagenesis of nematodes were as previously described (BRENNER 1974). C. elegans var Bristol strain N2 is the wild-type parent for all strains used in this work. Specific genes and alleles are described on Wormbase (http://www.wormbase.org) unless otherwise noted here. Deletion alleles ubc-25(tm1531) I, ccr-4(tm1312) IV, and ekl-5(tm2531) X were kindly provided by S. Mitani (National Bioresource Project, Japan). Deletion allele ubc-25(cs77) I was isolated by PCR screening of an EMS-mutagenized worm library made in our own laboratory. All except ekl-5 were outcrossed at least six times prior to analysis. The ego-1(om84) allele was used to test for genetic interactions with ksr-1(n2526) (QIAO et al. 1995). Transgene saIs14 [lin-48::gfp] II was obtained from Helen Chamberlin (JOHNSON et al. 2001; SEWELL et al. 2003). Transgene czIs10 [unc-119(+); pie-1::GFP::KSR-2a] was obtained from Monica Gotta (ETH Zürich) and is described below.

RNAi-feeding screen:

RNAi feeding was performed essentially as described in KAMATH et al. (2001). RNA production was induced using 1 mM IPTG. For chromosome I, the screen was performed in duplicate using both ksr-1(n2526) single mutants (strain MT8677) and the RNAi-hypersensitive strain rrf-3(pk1426); ksr-1(n2526) (strain UP1017); however, all chromosome I ekl genes were identified in both strain backgrounds. Subsequent chromosomes were screened with only the ksr-1(n2526) strain. Multiple L2–L3 animals were plated on each bacterial strain expressing a different RNAi clone and the progeny were screened 3 and 4 days later for the presence of rod-like lethality. All clones in which the rod-like lethality was perceived to be higher than background were retested in triplicate. For clones that passed this retest, the rod-like lethal phenotype was quantified by collecting eggs laid by multiple RNAi-treated mothers over an 8- to 16-hr period and then counting the numbers of rod-like larvae and live progeny (dead embryos and other dying larvae were often present but not counted). Clones that consistently resulted in a rod/(rod + live) ratio of at least 20% were considered positive. The identities of these positive clones were verified by PCR amplification and restriction digestion, sequencing, and/or RNAi with an independent clone. This verification step was important as we found several positive hits whose identities differed from the expected clone in that library well.

After screening the entire RNAi library and identifying 15 positive hits, we performed selective retesting of genes related to our initial hits—i.e., known components of the core Ras pathway and genes implicated in small RNA processes, the NuA4/Tip60 complex, the CCR4/NOT complex, and protein ubiquitination. These retests of initially negative clones (supplemental Table S1 at http://www.genetics.org/supplmental/) identified another three positive hits (trr-1, gfl-1, and let-711/ntl-1). Notably, other than cnk-1, we did not identify known Ras pathway genes in our screen, and when deliberately retested, 0/6 such genes showed a strong ekl phenotype. This high false negative rate indicates that our screen has identified only a small proportion of the genes that could potentially interact with ksr-1.

Phenotype analysis:

Newly hatched L1 larvae from RNAi-treated mothers were scored for the presence or the absence of the excretory duct cell using the plin-48::gfp transgene in strain UP1252 [saIs14; ksr-1(n2526)]. We specifically scored larvae that were already beginning to accumulate pockets of fluid and thus were destined to manifest the rod-like lethal phenotype. All ekl dsRNAs caused a high proportion of duct loss in this assay, whereas unrelated rod-like lethal mutants such as ceh-10 and vha-5 did not, demonstrating that fluid accumulation itself does not obscure lin-48::gfp expression.

All ekl dsRNAs were tested in additional strain backgrounds to probe the nature of their effect on excretory duct development. With the exception of rab-7 and cnk-1, the ekl dsRNAs did not significantly increase rod-like lethality in any of the following strain backgrounds tested: N2 [wild-type], UP189 [lin-45(ku112)], MH731 [mek-2(ku114)], UP1199 [cnk-1(ok836)], and MT1175 [lin-25(n545)]. For zygotic RNAi experiments, mothers from strain UP916 [rde-1(ne300) unc-42(e270); lon-2(e678) ksr-1(n2526)] were exposed to dsRNA and then mated to ksr-1(n2526)/0 males.

For the ksr-2 rescue experiments, full-length ksr-2a cDNA was amplified from clone yk343d6 using the oligos (forward: atgagcgatgaaaagaagaaaaagc) and (reverse: ctaaaacagtggattctcgtg) and cloned into the modified Gateway vector pID3.01 to create an amino-terminal GFP fusion, pMG290 (pie-1::GFP::KSR-2a). The pID3.01 vectors utilize the pie-1 5'- and 3'-UTR sequences to drive expression in the maternal germline (PELLETTIERI et al. 2003; HAO et al. 2006). Integrated transgenic strains were made by microparticle bombardment as described in PRAITIS et al. (2001) to create the strain ZU32 {unc-119(ed3) III; czIs10[unc-119(+); pie-1::GFP::KSR-2a]}. Germline expression of ksr-2(+) is sufficient to rescue the sterility, rod-like lethality, and Vulvaless phenotypes of ksr-2(dx27); ksr-1(n2526) animals (Figure 2D and data not shown). The ekl RNAi feeding was performed, as described above, using unc-119(ed3); lon-2(e678) ksr-1(n2526); czIs10 and either ksr-1(n2526) or lon-2(e678) ksr-1(n2526) as a control.

View larger version (33K): In this window In a new window Download PPT slide   FIGURE 2.— RNA-mediated interference of ekl genes enhances the rod-like lethality of ksr-1 larvae. (A) For each ekl gene, the progeny of dsRNA-fed MT8677 [ksr-1(n2526)] mothers were collected at least 24 and not more than 48 hr after the initial dsRNA exposure (except for let-711/ntl-1, where progeny were collected as early as 5 hr after the initial dsRNA exposure to minimize embryonic lethality). The percentage of rod-like lethality was calculated as no. rods/(no. rods + no. live), thus excluding embryonic and other pleiotropic lethals. Shown is average rod-like lethality across all experiments. Error bars indicate actual range of percentages obtained across different experiments. In general, longer maternal preexposure resulted in higher rod-like lethality and increased pleiotropy. All P < 0.001 by Fisher's exact test compared to GFP control. (B) For each ekl gene, the progeny of two dsRNA-fed MH734 [ksr-1(ku68)] mothers were collected and scored as above. All P < 0.001 by Fisher's exact test compared to GFP control, except let-711/ntl-1 and ekl-6, P < 0.01. ku68 is a missense allele with slight dominant-negative properties (SUNDARAM and HAN 1995; ROCHELEAU et al. 2002). (C) For each ekl gene, the progeny of two dsRNA-treated UP1260 [rrf-1; ksr-1(n2526)] mothers were collected and scored as above (solid bars); the broods of similarly treated MT8677 mothers were scored in parallel (shaded bars). All P < 0.001 by Fisher's exact test compared to GFP control, except trr-1 (P = 0.002), gfl-1 (P = 0.02), let-711/ntl-1 (P = 0.14, not significant), and ekl-6 (P = 0.012) in the UP1260 background. There is a trend for the UP1260 values to be lower than the MT8677 values, suggesting some somatic contribution; this difference is significant at P < 0.001 for csr-1, trr-1, let-711/ntl-1, ntl-2, math-33, ekl-5, ekl-6, and cnk-1 and at P < 0.01 for ccr-4 and rab-7. (D) ksr-2(dx27); ksr-1(n2526) animals are maternally rescued for viability but sterile. The germline-expressed transgene pie-1::GFP::KSR-2 (czIs10) rescues the sterility and rod-like lethality of ksr-2; ksr-1, allowing the homozygous strain to be propagated. pie-1::GFP::KSR-2 only partially rescues other ekl gene phenotypes. For each ekl gene, the progeny of two or four dsRNA-treated unc-119(ed3); lon-2(e678) ksr-1(n2526); czIs10 mothers were collected and scored as above (solid bars); the broods of similarly treated MT8677 and/or UP166 [lon-2(e678) ksr-1(n2526)] mothers were scored in parallel (shaded bars). All P < 0.001 by Fisher's exact test compared to ksr-2(dx27) control, except drh-3 (P = 0.0012), trr-1 (P = 0.028), gfl-1 (P = 0.2, not significant), and rab-7 (P = 0.074, not significant) in the ksr-1; czIs10 background. There is a trend for the ksr-1; czIs10 values to be lower than the ksr-1 values, suggesting that increasing germline ksr-2(+) can partially rescue ekl(RNAi), ksr-1(n2526), or both; this difference is significant at P < 0.01 for all except ekl-1, ntl-2, and math-33. Data for let-711/ntl-1 were not included due to high embryonic lethality.

 
Tests for the Rde phenotype were performed by feeding the viable deletion mutants ccr-4(tm1312), ekl-5(2531), ubc-25(cs77), and ubc-25(tm1531) dsRNA corresponding to pos-1, which is required for embryonic viability (TABARA et al. 1999). L4-stage animals for each genotype were plated on pos-1(RNAi) feeding plates and eggs laid between 25 and 48 hr postplating were scored for viability (hatching). For all four deletion strains, 100% (n > 100) of eggs from pos-1(RNAi) animals failed to hatch after 24 hr. These data plus the RNAi data from the synergy tests (Figure 4) suggest that ccr-4, ekl-5, and ubc-25 are not required for RNAi.

View larger version (36K): In this window In a new window Download PPT slide   FIGURE 4.— Synergistic interactions among the ekl genes. For each ekl gene, the progeny of multiple dsRNA-fed (A) UP1573 [ccr-4(tm1312); ksr-1(n2526)], (B) UP1372 [ubc-25(cs77); ksr-1(n2526)], or (C) UP1576 [lon-2 ksr-1(n2526) ekl-5(tm2531)] mothers were collected 24–40 hr after the initial dsRNA exposure. None, strain grown on standard NGM/OP50 plates as shown in Table 2. Shown is average rod-like lethality (no. rods/no. (rod + live)) across all broods. Error bars indicate the actual range of values obtained in different broods. All P < 0.001 by Fisher's exact test compared to GFP control, except P > 0.05 for drh-3 and ubc-25 in UP1372 and ekl-5 in UP1576. ^, these dsRNAs caused extensive embryonic and/or other larval lethality, preventing meaningful assessment of rod-like lethality.

 
The remaining ekl genes were tested for the ability to suppress gfp(RNAi). L4-stage animals of the strain AZ212 that expresses GFP::H2B in the germline were plated on ekl(RNAi) for 24 hr and transferred to ekl(RNAi) + gfp(RNAi) plates for an additional 24 hr, after which animals were analyzed for germline GFP expression. Untreated animals show strong GFP expression in the germline, while animals treated with only gfp(RNAi) had no GFP expression. As expected, animals pretreated with ekl-1, ego-1, and drh-3 dsRNA displayed strong GFP expression. csr-1, let-711/ntl-1, and math-33 displayed reduced GFP expression, and little or no expression was seen with mys-1, epc-1, trr-1, gfl-1, ekl-4, ntl-2, ekl-6, and rab-7.

RNAi of the nine germline expressed genes that are known targets of the drh-3-dependent and eri-independent endo-siRNAs (DUCHAINE et al. 2006) were tested for the ability to enhance ksr-1 lethality or to suppress the drh-3(RNAi); ksr-1(n2526) Ekl phenotype. RNAi clones for T01A4.3, Y56A3A.14, F16D3.5, B0250.8, C04F12.9, B0047.1, T12G3.1, and F54F2.2 were obtained from the Ahringer library, and the F39F10.2 feeding clone was generated by cloning the corresponding genomic DNA into the L4440 feeding vector. All clones failed to enhance the rod-like lethal phenotype of ksr-1, producing 0–2% rod-like lethality (n > 176) as compared to <1% for gfp(RNAi) (n = 1095). To test for suppression of the drh-3 Ekl phenotype, bacteria expressing each clone were mixed with bacteria expressing dsRNA corresponding to drh-3. No significant reduction in rod-like lethality was observed [30–48% (n > 195) as compared to 36% for gfp + drh-3 (n = 951)].

cDNA and deletion mutant analysis:

ubc-25 gene structure was confirmed by sequencing the coding region of EST clone yk1102b10—this clone sequence differed at two coding base positions from a previously reported cDNA (SCHULZE et al. 2003), but matched the reported genomic sequence at those positions (www.wormbase.org). ekl-5 gene structure was confirmed by sequencing EST clones yk458f3 and yk497g4—these clone sequences perfectly matched prior predictions (www.wormbase.org). We could not detect evidence for trans-splicing of ekl-5, and no stop codons are present upstream of the predicted start codon in the EST clones, leaving open the possibility of additional 5' exons.

The molecular breakpoints of deletion alleles ccr-4(tm1312), ubc-25(tm1531), and ekl-5(tm2531) have been characterized (http://www.grs.nig.ac.jp/c.elegans/index.jsp). We further verified these deletions by PCR analysis using primers both within and outside the deletion. We sequenced ubc-25(cs77) to show that it is a 381-bp deletion plus 12-bp insertion that removes intron 2 and most of exon 3. With respect to the wild-type ubc-25 genomic sequence from ATG to stop (1–1364), the cs77 sequence is 1–458/CACATCTGAGGC/840–1364. There is also a C T point mutation at nucleotide 396, which would result in a Pro Leu substitution. Analysis of RT–PCR products shows that cs77 leads to a frameshift and truncation prior to the UBC catalytic domain. cs77 and the other deletion alleles all would be predicted to severely reduce and most likely eliminate gene function.

Mutant lethality was quantified by counting the total number of eggs laid by multiple mothers over an 8-hr period and then counting the numbers of rod-like larvae and live L4 progeny observed over the subsequent 2–5 days. Total lethality was calculated as (total – live)/total.

Real-time PCR:

ksr-2 mRNA levels in csr-1(RNAi), mys-1(RNAi), ccr-4(tm1312), ubc-25(cs77), and ekl-5(tm2531) mutants were compared to those in wild-type or GFP(RNAi) strains using Taqman (Applied Biosystems, Foster City, CA) real-time PCR. Total RNA was prepared from embryos using Trizol reagent (Invitrogen, Carlsbad, CA) and RNeasy (QIAGEN, Valencia, CA) and reverse transcribed using the Superscript first-strand synthesis kit (Invitrogen). Two independent biological samples were prepared for each of the RNAi experiments. Taqman primers for ksr-2 and the reference gene smr-1 were obtained from Applied Biosystems; the ksr-2 primers amplify regions of exons 6 and 7 and thus recognize both known splice isoforms (OHMACHI et al. 2002). All reactions were performed in triplicate on an ABI 7900 HT machine. ksr-2 levels were either equivalent or very slightly (less than twofold) higher in the experimental samples compared to controls. We also used this assay to verify that ksr-1(n2526) mutants do not have elevated levels of ksr-2 expression.

An RNAi screen for enhancers of ksr-1 lethality:

Specification of the excretory duct fate occurs during mid- to late embryogenesis (SULSTON et al. 1983) and relies on a combination of maternally provided and zygotically expressed Ras pathway gene products (SUNDARAM 2006). Maternally provided ksr-2 is sufficient to allow the duct fate, as ksr-2; ksr-1 double mutants, which lack zygotic gene function but retain maternal ksr-2, have a duct and are viable (though sterile) (OHMACHI et al. 2002), and germline-specific expression of ksr-2 rescues the lethality of ksr-2; ksr-1 double mutants (Figure 2D and MATERIALS AND METHODS). In the absence of ksr-1, maternally provided ksr-2 may also be necessary for the duct fate, since when we specifically RNAi depleted maternal ksr-2 in rrf-1; ksr-1 animals, which are RNAi-resistant somatically (SIJEN et al. 2001), those animals arrested as rod-like larvae (Figure 2C).

To identify genes important for KSR function, we screened the Ahringer RNAi feeding library (FRASER et al. 2000; KAMATH et al. 2003) for clones that could mimic the effect of ksr-2 and consistently cause strong rod-like lethality in the background of ksr-1(n2526), a nonsense mutation and putative null allele (KORNFELD et al. 1995) (see MATERIALS AND METHODS). After screening a total of 16,748 RNAi clones, we identified 18 clones that consistently caused strong rod-like larval lethality in multiple ksr-1 mutant backgrounds, but not in a wild-type background (Figure 2 and data not shown). We call this phenotype and the corresponding class of genes ekl for enhancer of ksr-1 lethality. In all cases, a significant proportion of ekl; ksr-1 animals lacked a plin-48::gfp-positive excretory duct cell, suggesting that these genes cooperate with ksr-1 and the Ras pathway to specify the excretory duct cell fate (Figure 1 and data not shown). Surviving animals had normal vulval development and normal P11/P12 ectoblast fates, suggesting that other Ras-dependent signaling events were unperturbed. The specific nature of this phenotype and the fact that only 0.1% of clones tested showed an Ekl phenotype indicate that ksr-1 enhancement does not result from a general reduction in health or vigor. Furthermore, many of the ekl genes point to specific processes or protein complexes whose perturbation leads to this phenotype (Table 1, see below).

View this table: In this window In a new window   TABLE 1 Molecular identities of ekl gene products

 

The ekl genes interact specifically with ksr-1 and not with other mutants in the Ras pathway:

Although the original goal of our RNAi screen was to identify genes that specifically regulate KSR function and/or EGFR/Ras/ERK signaling, the molecular identities of many of the ekl genes (Table 1) suggest a broader role in gene regulation. Furthermore, when we tested our ekl RNAi clones against a panel of other Ras pathway mutants (MATERIALS AND METHODS), including hypomorphic alleles of lin-45 raf and mek-2, we found that only 2 RNAi clones caused rod-like lethality in those backgrounds as would be expected if Ras signaling or the excretory duct fate were perturbed directly (data not shown); these corresponded to the known Ras pathway scaffold cnk-1 (ROCHELEAU et al. 2005) and the GTPase rab-7 (L. CHOTARD and C. E. ROCHELEAU, unpublished results). The remaining 16 ekl RNAi clones showed rod-like lethality exclusively in the background of ksr-1 alleles, suggesting that these ekl genes influence a process to which ksr-1 mutants are particularly sensitive.

We considered the hypothesis that the ekl genes affect ksr-2 expression or function, because as discussed above, ksr-1 mutants are particularly sensitive to loss of ksr-2. In contrast, other Ras pathway mutants do not show genetic interactions with ksr-2 (OHMACHI et al. 2002 and data not shown). Consistent with (though not proving) a defect at the level of KSR-2 scaffold function, the ekl genes appear to function in the germline (see below) and show similar patterns of epistasis to ksr-2: the Ekl phenotype was reduced but not eliminated by a constitutive allele of let-60 ras and was eliminated by mutation of the downstream MPK-1/ERK target lin-1 (Figure 3). However, using real-time PCR, we have not detected any reduction in endogenous ksr-2 mRNA expression in embryos from ekl RNAi or ekl mutant strains (see MATERIALS AND METHODS). Furthermore, a pie-1::GFP::KSR-2 transgene (which lacks endogenous ksr-2 regulatory elements) only partially rescued the ekl(RNAi); ksr-1 phenotype whereas it fully rescued the ksr-2; ksr-1 phenotype (Figure 2D). Thus, the ekl genes are unlikely to affect ksr-2 expression directly, but may instead alter the expression or function of an unknown interacting factor(s) (see DISCUSSION).

View larger version (16K): In this window In a new window Download PPT slide   FIGURE 3.— ekl epistasis. For each ekl gene, the progeny of dsRNA-fed MT8677 [ksr-1(n2526)] (shaded bars), UP754 [lon-2 ksr-1(n2526) lin-15(n309] (open bars), UP28 [let-60(n1046gf); ksr-1(n2526)] (solid bars), or UP764 [lin-1(n304); lon-2 ksr-1(n2526)] (bars with light shading; not visible for most ekl genes as lin-1 completely suppressed the rod-like lethality) mothers were collected in parallel 24–40 hr after the initial dsRNA exposure. Shown is average rod-like lethality across all broods. All ekl dsRNAs except trr-1 and gfl-1 enhanced UP28 with a significance of P < 0.01 (Fisher's exact test). lin-15 is a synthetic multivulva mutant believed to elevate lin-3/EGF expression (FERGUSON and HORVITZ 1989; CUI et al. 2006a). let-60(n1046gf) is a hypermorphic allele of the ras gene (BEITEL et al. 1990; HAN and STERNBERG 1990; HAN et al. 1990). lin-1(n304) is a null mutation of a Ras/ERK target gene encoding an Ets domain transcription factor (BEITEL et al. 1995). ^, no data. In the UP754 mutant background, these dsRNAs caused extensive embryonic and/or other larval lethality, which prevented meaningful quantification of rod-like lethality (which was also present). This may be due to the reported RNAi hypersensitivity of lin-15 mutants (WANG et al. 2005) or to a specific genetic interaction with lin-15.

 

The ekl genes act in the maternal germline:

Under strong RNAi conditions, many of the ekl genes have pleiotropic RNAi phenotypes that include significant embryonic lethality irrespective of the ksr-1 mutant background (Table 1), suggesting that these genes regulate the expression of multiple targets. Both the embryonic lethality and the Ekl phenotype reflect (at least in part) a maternal requirement for these genes, as germline-specific RNAi (in an rrf-1; ksr-1 background) continued to elicit both phenotypes (Figure 2C and data not shown), whereas zygotic-specific RNAi for ekl-1, drh-3, or ekl-4 (in the RNAi-competent rde-1/+; ksr-1 progeny of RNAi-defective rde-1; ksr-1 mothers) did not elicit these phenotypes (data not shown) (see HERMAN 2001 for a discussion of zygotic RNAi). Furthermore, for all ekl deletion mutants tested (ego-1, ccr-4, ubc-25, and ekl-5; see below), ekl; ksr-1 animals obtained from ekl/+; ksr-1 mothers were viable (data not shown). The maternal-effect phenotype of the ekl genes suggests that these genes must be expressed in the germline to influence excretory duct cell fate specification in the embryo. Available in situ hybridization data (http://nematode.lab.nig.ac.jp/db2/), microarray expression data (KIM et al. 2001; REINKE et al. 2004), and the sterile phenotypes of several existing deletion mutants (QIAO et al. 1995; SMARDON et al. 2000; CEOL and HORVITZ 2004; DUCHAINE et al. 2006; YIGIT et al. 2006) are also consistent with a germline function for the ekl genes.

Several ekl genes, including csr-1, may act together in small RNA biogenesis or function:

Four ekl genes have been previously implicated in RNAi-related processes and may define a novel small RNA pathway that regulates germline gene expression (Table 1). csr-1 is one of a large number of genes coding for Argonaute-like PAZ-PIWI domain proteins in C. elegans (GRISHOK et al. 2001) and is required for transgene-mediated cosuppression (ROBERT et al. 2005) and efficient RNAi in the germline (YIGIT et al. 2006). drh-3 encodes a Dicer-related helicase that is associated with the Dicer protein, DCR-1, and is required for the production of endogenous small RNAs as well as for RNAi in the germline (DUCHAINE et al. 2006). ego-1 encodes an RNA-dependent RNA polymerase (RdRP) required for multiple aspects of germline development and for RNAi in the germline (QIAO et al. 1995; SMARDON et al. 2000; MAINE et al. 2005; VOUGHT et al. 2005). ekl-1 (F22D6.6) encodes a Tudor-domain protein required for RNAi, transgene silencing, and transgene-mediated cosuppression in the germline (GRISHOK et al. 2005; KIM et al. 2005; ROBERT et al. 2005). ekl-1 also has a paralog, eri-5, that is an enhancer of RNAi (Eri phenotype) and whose protein product is associated with DCR-1 (DUCHAINE et al. 2006). Although we directly tested numerous other genes implicated in RNAi (supplemental Table S1), only one other (gfl-1, see below) was found to share the Ekl phenotype, suggesting some unique property of csr-1, drh-3, ego-1, and ekl-1. In addition to sharing the Ekl and RNAi-defective phenotypes, these four genes all share a similar chromosome segregation-defective and embryonic-lethal phenotype (DUCHAINE et al. 2006; YIGIT et al. 2006; K. M. PANG and C. C. MELLO, personal communication and our unpublished observations). These similarities suggest that CSR-1, DRH-3, EGO-1, and EKL-1 all function together to mediate the effects of small endogenous RNAs in the germline.

drh-3 together with dcr-1, rrf-3, eri-1, eri-3, and eri-5 is required for the production of several classes of endogenous small RNAs (DUCHAINE et al. 2006). Interestingly, only drh-3 is required for the production of a specific class of small RNAs corresponding to germline-expressed genes. Similarly, only drh-3 showed an Ekl phenotype, whereas dcr-1, rrf-3, eri-1, eri-3, and eri-5 did not (supplemental Table S1). We therefore hypothesized that drh-3, along with csr-1, ego-1, and ekl-1, might affect Ras signaling via a mechanism involving this unique class of small RNAs. However, RNAi against targets of the nine reported siRNAs in this class did not cause an Ekl phenotype and did not significantly suppress the drh-3 Ekl phenotype (see MATERIALS AND METHODS). Therefore, the group I genes may act through distinct siRNAs of this class or through an as yet uncharacterized class of drh-3-dependent but rrf-3- and Eri-independent small RNAs (see DISCUSSION).

ego-1 is required for histone H3K9 methylation of unpaired DNA in the meiotic germline (MAINE et al. 2005). As H3K9 methylation is usually associated with repressed chromatin (RICE and ALLIS 2001), the loss of this mark in ego-1 mutants implies that many X chromosome loci may be erroneously expressed; it is possible that such misexpression leads to the Ekl phenotype. However, csr-1, drh-3, and ekl-1 mutants do not lose H3K9 methylation (X. SHE and E. M. MAINE, personal communication) and we did not identify any putative histone methyltransferases (HMTases) in our RNAi screen. Thus the relationship between H3K9 methylation and the Ekl phenotype is still unclear.

We do note, however, that one shared feature of the group I ekl genes is that the Ekl phenotype is strongly reduced in a lin-15 mutant background (Figure 3). lin-15 is a "synthetic multivulva" (SynMuv) mutant believed to cause elevated lin-3/EGF transcription due to changes in chromatin structure (FERGUSON and HORVITZ 1989; CUI et al. 2006a; FAY and YOCHEM 2007). lin-15 mutants are also RNAi hypersensitive (Eri), another defect thought to be caused by changes in chromatin structure (WANG et al. 2005). Suppression of group I Ekl defects by lin-15 therefore could be a consequence of increased lin-3-dependent signaling or could be a consequence of other chromatin or RNAi-related changes.

Several ekl genes encode orthologs of the NuA4/Tip60 histone acetylase complex:

Five ekl genes encode orthologs of proteins found in the NuA4/Tip60 chromatin-remodeling complex. MYS-1 is related to yeast Esa1p and mammalian TIP60, the histone acetyltransferases (HATs) of the yeast NuA4 and mammalian Tip60 complexes (CEOL and HORVITZ 2004). TRR-1, EPC-1, GFL-1, and EKL-4 (Y105E8A.17) are related to other well-characterized components of these complexes (DUDLEY et al. 2002; CEOL and HORVITZ 2004; CUI et al. 2006b) (Table 1). The NuA4 and Tip60 complexes are thought to influence the expression of large numbers of genes via acetylation of histones (DOYON and COTE 2004; SQUATRITO et al. 2006). The molecular identities and shared Ekl phenotypes suggest that the C. elegans proteins are likely to form a related complex with similar properties.

Interestingly, mys-1, trr-1, and epc-1 were previously found to share a "SynMuv C" phenotype, suggesting that they antagonize Ras signaling during vulval development (CEOL and HORVITZ 2004). Furthermore, ekl-4 and gfl-1 function antagonistically to the SynMuv C genes to promote Ras-mediated vulval development (WANG et al. 2005; CUI et al. 2006b), whereas we have seen that ekl-4 and gfl-1 function cooperatively with mys-1, trr-1, and epc-1 to promote Ras-mediated excretory duct cell development. It is likely that multiple versions of a NuA4/Tip60-like chromatin remodeling complex exist in C. elegans and that these regulate different sets of genes. Recently, mys-1 and trr-1 were identified as having genetic interactions with several signal transduction pathways, including the Wnt and Notch pathways, consistent with their regulating the expression of a large number of genes (LEHNER et al. 2006). The SynMuv C and Ekl phenotypes probably result from misregulation of different specific targets that impact Ras signaling in opposite ways.

A potential link between the NuA4/Tip60-like (group II) and RISC-like (group I) ekl genes is suggested by the fact that gfl-1 (group II) is also required for RNAi (DUDLEY et al. 2002; KIM et al. 2005). However, other group II genes such as ekl-4 are not required for RNAi (CUI et al. 2006b and MATERIALS AND METHODS). Thus it is unlikely that the NuA4/Tip60 complex is required merely for the transcription of one or more group I ekl genes. Instead, we favor the model that group I and group II ekl genes cooperate, perhaps through chromatin modifications, to modulate some common target(s).

Several ekl genes encode orthologs of the CCR4/NOT deadenylase complex:

Three ekl genes encode orthologs of proteins found in the CCR4/NOT deadenylase complex. CCR-4 is related to the catalytic subunit of this complex, which in yeast possesses 3'–5' exonuclease activity toward single-stranded RNA and DNA (TUCKER et al. 2001, 2002; CHEN et al. 2002; TEMME et al. 2004) (Table 1). LET-711/NTL-1 and NTL-2 are related to NOT1 and NOT2, two other components of the complex (LIU et al. 1998). The CCR4/NOT complex appears to be a major mRNA deadenylase in yeast and Drosophila (TUCKER et al. 2001; TEMME et al. 2004) and has been implicated in miRNA-dependent mRNA degradation (BEHM-ANSMANT et al. 2006). In addition, the CCR4/NOT complex may have roles in transcriptional regulation (WINKLER et al. 2006) and protein ubiquitination (PANASENKO et al. 2006). In C. elegans, let-711/ntl-1, ntl-2, and most other putative subunits of the CCR/NOT complex are essential, as might be expected for genes that play widespread roles in mRNA metabolism (GONCZY et al. 2000; MAEDA et al. 2001; KAMATH et al. 2003; SIMMER et al. 2003; RUAL et al. 2004; MOLIN and PUISIEUX 2005; SONNICHSEN et al. 2005; DEBELLA et al. 2006). However, the ccr-4 gene does not appear to be essential, suggesting either that let-711/ntl-1 and ntl-2 have distinct ccr-4-independent functions or that the paralogous gene W02G9.5 compensates for ccr-4 loss.

We used a ccr-4 deletion allele (tm1312) to confirm our RNAi result and investigate further the genetic interaction with ksr-1 (Table 2, Figure 4A). tm1312 removes most of the predicted CCR-4 catalytic domain and thus is likely to be null (see MATERIALS AND METHODS). The majority of ccr-4(tm1312) homozygotes are viable and superficially normal, and while some do arrest as young larvae, none show the rod-like lethality characteristic of excretory defects. In contrast, the majority of ccr-4; ksr-1 animals arrest with rod-like morphology. The animals that survive have normal development of other Ras-dependent cell types such as the vulva (data not shown). Thus, consistent with our previous RNAi results, ccr-4 strongly enhances the ksr-1 excretory duct loss phenotype, but does not enhance other postembryonic ksr-1 phenotypes.

View this table: In this window In a new window   TABLE 2 Analysis of ccr-4, ubc-25, and ekl-5 deletion mutants

 

Additional ekl genes encode conserved proteins involved in ubiquitination and deubiquitination:

The remaining four ekl genes encode a variety of proteins with possible roles in transcriptional or post-transcriptional gene regulation.

ubc-25 encodes a putative E2 ubiquitin-conjugating enzyme (UBC) orthologous to mammalian Ube2q (SCHULZE et al. 2003) (Table 1). This particular UBC family is absent from yeast and its biochemical properties are not well characterized, although Ube2q can be ubiquitin charged in vitro by the E1 Ube1 (JIN et al. 2007). Consistent with our RNAi results, we found that ubc-25(cs77) or ubc-25(tm1531) deletion mutants are mostly viable and normal, but ubc-25; ksr-1 double mutants have strong rod-like lethal and excretory duct loss phenotypes (Table 2, Figure 4B, and data not shown). Both deletions are likely to severely reduce or eliminate ubc-25 activity (see MATERIALS AND METHODS). As was true for ccr-4, ubc-25 does not enhance other postembryonic ksr-1 phenotypes (data not shown).

math-33 encodes a putative ubiquitin-specific protease orthologous to Usp7/HAUSP (Table 1). Drosophila and mammalian Usp7 proteins have been found to deubiquitinate multiple substrates including histone H2B, the transcription factor FOXO, and the p53 regulator Mdm2 (LI et al. 2002; VAN DER KNAAP et al. 2005; TANG et al. 2006; VAN DER HORST et al. 2006). Mutants in math-33 are not yet available, but RNAi suggests that MATH-33 and UBC-25 act cooperatively, despite their predicted opposing molecular activities. Usp7 can process ubiquitin precursors in vitro to generate functional ubiquitin (LAYFIELD et al. 1999) and can also protect some E3 ubiquitin ligases from autoubiquitination and degradation (CANNING et al. 2004; TANG et al. 2006), suggesting two possible mechanisms by which MATH-33/Usp7 could promote a ubiquitin-dependent process. math-33(RNAi) causes a stronger Ekl phenotype than does ubc-25 and the two genes show additive effects (Figure 4B), indicating that math-33 does not act completely through effects on ubc-25.

ekl-5 encodes a novel protein with two copies of an unusual CCHC motif—it does not have obvious relatives outside of nematodes. Consistent with our RNAi results, we found that ekl-5(tm2531) deletion mutants are mostly viable and normal, but ksr-1 ekl-5 double mutants have partial rod-like lethal and excretory duct loss phenotypes (Table 2, Figure 4C). No other ras-like defects were observed in these double mutants (data not shown). The genetic behavior of ekl-5 is thus very similar to that of ccr-4 and ubc-25. Note, however, that the ekl-5(tm2531) phenotype is weaker than that seen with ekl-5 RNAi, yet cannot be further enhanced by ekl-5 RNAi (Figures 2A and 4C). This anomaly suggests either that partial depletion of ekl-5 causes a stronger ekl phenotype than complete ekl-5 loss or that there is some secondary modifier mutation in the ekl-5(tm2531) mutant strain. Note that ekl-5 is similar to the group I ekl genes in that the Ekl phenotype is strongly suppressed by the lin-15 SynMuv mutation (Figure 3).

Finally, ekl-6 encodes a novel protein with a predicted armadillo-like helical motif—it has uncharacterized relatives in fish and mammals. Available RNAi and mutant data suggest that ekl-6 may be an essential gene (Table 1).

ekl-5 may act with the group I (RISC-like) ekl genes in a subset of processes:

As discussed above, the molecular identities of many of the ekl genes suggest three likely functional groupings (RISC-like, Tip60/NuA4-like, and CCR4/NOT-like). If true, then removing two members of a group should have consequences no more severe than removing just one member. Unfortunately, the nonnull nature of RNAi treatments and the essential requirements for the individual genes preclude such rigorous tests of interdependency. Nevertheless, additional shared phenotypes (see above) and genetic interactions (e.g., Figures 3 and 4C) tend to support these functional groupings.

To test if any of the nonessential ekl genes could act closely with each other or with one of the three molecularly defined groups, we tested the effects of RNAi-depleting various ekl genes in the viable ccr-4, ubc-25, and ekl-5 deletion backgrounds (Figure 4). We also analyzed true double mutants where possible (Table 2). In most cases, strong additive or synergistic effects were observed, suggesting that the different ekl genes can function independently of ccr-4, ubc-25, and ekl-5. This was true even of the ntl-2 and ccr-4 combination (Figure 4A), consistent with the idea that there is a CCR-4-independent (though potentially W02G9.5-dependent) NOT complex. It is striking, however, that RNAi depletion of the group I (RISC-like) ekl genes did not have more severe consequences in the ksr-1 ekl-5 background compared to the ksr-1 single-mutant background (compare Figures 2A and 4C). These data, together with the similar lin-15 epistasis data (Figure 3), suggest that group I is a bona fide functional group and that the group I genes could function in part through ekl-5 to promote Ras signaling. However, unlike the group I genes, ekl-5 is not required for viability, fertility, or efficient germline RNAi (MATERIALS AND METHODS) and thus does not appear to function with the group I genes in all processes.

We have described 16 ekl genes that are required in combination with ksr-1 for Ras-dependent excretory duct cell fate specification. These ekl genes appear to affect excretory duct development only under conditions where ksr-1 is absent and not in any other strain backgrounds in which the Ras pathway is compromised. On the basis of the genetic properties and molecular identities of the ekl gene products, we hypothesize that these genes are not directly involved in signal transduction, but rather that ekl depletion alters the expression of one or more target genes that ultimately influence a KSR-dependent step of Ras signaling.

The role we are proposing for the ekl genes would be similar conceptually to that of the previously characterized synthetic multivulva (SynMuv) genes, which encode nuclear factors whose depletion mimics Ras pathway activation in the vulva and elsewhere (FERGUSON and HORVITZ 1989; FAY and YOCHEM 2007). The SynMuv gene class includes the C. elegans Retinoblastoma (Rb) and E2F orthologs (CEOL and HORVITZ 2004) as well as other proteins found in the conserved DREAM and Myb-MuvB chromatin remodeling complexes (LIPSICK 2004). Although the mechanism by which the SynMuv genes affect Ras signaling was mysterious for many years and is still not completely understood, the shared genetic properties of SynMuv genes allowed researchers to propose that these genes function together, a prediction that has been borne out by subsequent molecular and biochemical studies. The SynMuv genes have recently been shown to prevent ectopic lin-3/EGF expression (CUI et al. 2006a).

By analogy to the SynMuv genes, we propose that the ekl genes act coordinately to regulate the expression of one or more targets that ultimately impinge on the Ras-dependent excretory duct cell fate in the embryo (Figure 5). Since the ekl genes are largely maternally required, they may regulate target expression in the maternal germline or in the early embryo. Although the simplest model would be that the ekl genes affect maternal ksr-2 expression, we find no evidence that this is the case. Instead, the ekl genes may normally promote the expression of other target(s) that facilitate KSR scaffold function, or they may normally inhibit the expression of target(s) that antagonize KSR scaffold function. We consider the latter possibility most likely for the group I (RISC-like) and group III (CCR4/NOT-like) ekl genes, given that small RNAs and the CCR4 deadenylase most often inhibit target gene expression. On the other hand, there is mounting evidence that some small RNAs can promote target gene expression (KUWABARA et al. 2004; LI et al. 2006; LIN 2007; YIN and LIN 2007). The group II (NuA4/Tip60-like) ekl genes also could act through either mechanism, as the Tip60 complex is implicated in both target gene activation and repression (SAPOUNTZI et al. 2006). Of course it is possible that the ekl genes act on targets that are several steps removed from the ultimate relevant effector(s) of Ras signaling.

View larger version (26K): In this window In a new window Download PPT slide   FIGURE 5.— Model for regulation of embryonic Ras signaling by the ekl genes The ekl genes are required maternally and affect Ras-dependent excretory duct fate specification in the embryo; they may regulate expression of their unknown targets in the maternal germline or in the early embryo. Genes are grouped according to molecular identities. See text for details.

 
Our study provides the first evidence that a novel small RNA pathway involving csr-1, drh-3, ego-1, and ekl-1, but not the Eri genes, acts in the C. elegans germline to regulate endogenous gene expression. Germline-specific small RNAs known as "piRNAs" and "rasiRNAs" have been described recently in Drosophila and mammals; these interact with Piwi- rather than Argonaute-subfamily proteins and are generated from single-stranded precursors in a Dicer-independent manner (VAGIN et al. 2006; ARAVIN et al. 2007; HARTIG et al. 2007; LIN 2007). The small RNAs relevant to the C. elegans Ekl phenotype could be analogous to piRNAs, as CSR-1 is equally similar to the Piwi and Argonaute subfamilies (YIGIT et al. 2006) and we have been unable to detect an Ekl phenotype after dcr-1 depletion (supplemental Table S1 and data not shown), suggesting that these RNAs also may be generated in a Dicer-independent manner. However, C. elegans has numerous Piwi–Argonaute family proteins (YIGIT et al. 2006) and numerous types of small RNAs (AMBROS et al. 2003; RUBY et al. 2006; PAK and FIRE 2007), none of which (so far) closely resemble piRNAs.

Our screen identified additional genes whose functions could be relevant to those of the group I (RISC-like) ekl genes. In particular, genetic interaction data are consistent with the model that a CSR-1-containing RISC modulates its relevant target via a mechanism that involves the novel protein EKL-5. As ekl-5 mutants do not share many of the other pleiotropic defects seen in csr-1, drh-3, ego-1, or ekl-1 mutants, these mutants should prove useful in identifying a relevant target responsible for the Ekl phenotype and elucidating its mechanism of regulation.

We thank Priti Batta, Ariel Junio, Ishmail Abdus-Saboor, Marc-André Sylvain, and Yunling Wang for technical assistance; X. She and E. M. Maine (Syracuse University, Syracuse, NY) for comments on the manuscript; R. Roy and lab (McGill University, Montreal) for support and sharing reagents; and M. Gotta (ETH Zürich, Zurich, Switzerland), H. Chamberlin (Ohio State University, Columbus, OH), S. Mitani (Tokyo Women's Medical University School of Medicine, Tokyo), C. Mello (University of Massachusetts, Worcester, MA), and Y. Kohara (National Institute of Genetics, Shizuoka, Japan) for strains and reagents. Some nematode strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health (NIH) National Center for Research Resources. This work was supported by a NIH grant (GM58540) and a University of Pennsylvania Research Foundation award to M.V.S. and in part by a Natural Sciences and Engineering Research Council of Canada grant to C.E.R. C.E.R. is a Canadian Research Chair in Signaling and Development and was a NIH Developmental Biology trainee and a postdoctoral fellow of the Jane Coffin Childs Memorial Fund for Medical Research. A.C.S. was supported by a fellowship from Boehringer Ingelheim Fonds.

¹ These authors contributed equally to this work.

AMBROS, V., R. C. LEE, A. LAVANWAY, P. T. WILLIAMS and D. JEWELL, 2003 MicroRNAs and other tiny endogenous RNAs in C. elegans. Curr. Biol. 13: 807–818.[CrossRef][Medline]

ARAVIN, A. A., G. J. HANNON and J. BRENNECKE, 2007 The Piwi-piRNA pathway provides an adaptive defense in the transposon arms race. Science 318: 761–764.[Abstract/Free Full Text]

BEHM-ANSMANT, I., J. REHWINKEL, T. DOERKS, A. STARK, P. BORK et al., 2006 mRNA degradation by miRNAs and GW182 requires both CCR4:NOT deadenylase and DCP1:DCP2 decapping complexes. Genes Dev. 20: 1885–1898.[Abstract/Free Full Text]

BEITEL, G. J., S. G. CLARK and H. R. HORVITZ, 1990 Caenorhabditis elegans ras gene let-60 acts as a switch in the pathway of vulval induction. Nature 348: 503–509.[CrossRef][Medline]

BEITEL, G. J., S. TUCK, I. GREENWALD and H. R. HORVITZ, 1995 The Caenorhabditis elegans gene lin-1 encodes an ETS-domain protein and defines a branch of the vulval induction pathway. Genes Dev. 9: 3149–3162.[Abstract/Free Full Text]

BRENNER, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71–94.[Abstract/Free Full Text]

CANNING, M., C. BOUTELL, J. PARKINSON and R. D. EVERETT, 2004 A RING finger ubiquitin ligase is protected from autocatalyzed ubiquitination and degradation by binding to ubiquitin-specific protease USP7. J. Biol. Chem. 279: 38160–38168.[Abstract/Free Full Text]

CEOL, C. J., and H. R. HORVITZ, 2004 A new class of C. elegans synMuv genes implicates a Tip60/NuA4-like HAT complex as a negative regulator of Ras signaling. Dev. Cell 6: 563–576.[CrossRef][Medline]

CHANNAVAJHALA, P. L., L. WU, J. W. CUOZZO, J. P. HALL, W. LIU et al., 2003 Identification of a novel human kinase supporter of Ras (hKSR-2) that functions as a negative regulator of Cot (Tpl2) signaling. J. Biol. Chem. 278: 47089–47097.[Abstract/Free Full Text]

CHEN, J., Y. C. CHIANG and C. L. DENIS, 2002 CCR4, a 3'-5' poly(A) RNA and ssDNA exonuclease, is the catalytic component of the cytoplasmic deadenylase. EMBO J. 21: 1414–1426.[CrossRef][Medline]

CLAPERON, A., and M. THERRIEN, 2007 KSR and CNK: two scaffolds regulating RAS-mediated RAF activation. Oncogene 26: 3143–3158.[CrossRef][Medline]

CUI, M., J. CHEN, T. R. MYERS, B. J. HWANG, P. W. STERNBERG et al., 2006a SynMuv genes redundantly inhibit lin-3/EGF expression to prevent inappropriate vulval induction in C. elegans. Dev. Cell 10: 667–672.[CrossRef][Medline]

CUI, M., E. B. KIM and M. HAN, 2006b Diverse chromatin remodeling genes antagonize the Rb-involved SynMuv pathways in C. elegans. PLoS Genet. 2: e74.[CrossRef][Medline]

DEBELLA, L. R., A. HAYASHI and L. S. ROSE, 2006 LET-711, the Caenorhabditis elegans NOT1 ortholog, is required for spindle positioning and regulation of microtubule length in embryos. Mol. Biol. Cell 17: 4911–4924.[Abstract/Free Full Text]

DOUZIECH, M., M. SAHMI, G. LABERGE and M. THERRIEN, 2006 A KSR/CNK complex mediated by HYP, a novel SAM domain-containing protein, regulates RAS-dependent RAF activation in Drosophila. Genes Dev. 20: 807–819.[Abstract/Free Full Text]

DOYON, Y., and J. COTE, 2004 The highly conserved and multifunctional NuA4 HAT complex. Curr. Opin. Genet. Dev. 14: 147–154.[CrossRef][Medline]

DUCHAINE, T. F., J. A. WOHLSCHLEGEL, S. KENNEDY, Y. BEI, D. CONTE, JR. et al., 2006 Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways. Cell 124: 343–354.[CrossRef][Medline]

DUDLEY, N. R., J. C. LABBE and B. GOLDSTEIN, 2002 Using RNA interference to identify genes required for RNA interference. Proc. Natl. Acad. Sci. USA 99: 4191–4196.[Abstract/Free Full Text]

FAY, D. S., and J. YOCHEM, 2007 The SynMuv genes of Caenorhabditis elegans in vulval development and beyond. Dev. Biol. 306: 1–9.[CrossRef][Medline]

FERGUSON, E. L., and H. R. HORVITZ, 1989 The multivulva phenotype of certain Caenorhabditis elegans mutants results from defects in two functionally redundant pathways. Genetics 123: 109–121.[Abstract/Free Full Text]

FERNANDEZ, A. G., K. C. GUNSALUS, J. HUANG, L. S. CHUANG, N. YING et al., 2005 New genes with roles in the C. elegans embryo revealed using RNAi of ovary-enriched ORFeome clones. Genome Res. 15: 250–259.[Abstract/Free Full Text]

FRASER, A. G., R. S. KAMATH, P. ZIPPERLEN, M. MARTINEZ-CAMPOS, M. SOHRMANN et al., 2000 Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408: 325–330.[CrossRef][Medline]

GONCZY, P., C. ECHEVERRI, K. OEGEMA, A. COULSON, S. J. JONES et al., 2000 Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature 408: 331–336.[CrossRef][Medline]

GRISHOK, A., A. E. PASQUINELLI, D. CONTE, N. LI, S. PARRISH et al., 2001 Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106: 23–34.[CrossRef][Medline]

GRISHOK, A., J. L. SINSKEY and P. A. SHARP, 2005 Transcriptional silencing of a transgene by RNAi in the soma of C. elegans. Genes Dev. 19: 683–696.[Abstract/Free Full Text]

HAN, M., and P. W. STERNBERG, 1990 let-60, a gene that specifies cell fates during C. elegans vulval induction, encodes a ras protein. Cell 63: 921–931.[CrossRef][Medline]

HAN, M., R. V. AROIAN and P. W. STERNBERG, 1990 The let-60 locus controls the switch between vulval and nonvulval cell fates in Caenorhabditis elegans. Genetics 126: 899–913.[Abstract]

HAO, Y., L. BOYD and G. SEYDOUX, 2006 Stabilization of cell polarity by the C. elegans RING protein PAR-2. Dev. Cell 10: 199–208.[CrossRef][Medline]

HARTIG, J. V., Y. TOMARI and K. FORSTEMANN, 2007 piRNAs–the ancient hunters of genome invaders. Genes Dev. 21: 1707–1713.[Abstract/Free Full Text]

HERMAN, M., 2001 C. elegans POP-1/TCF functions in a canonical Wnt pathway that controls cell migration and in a noncanonical Wnt pathway that controls cell polarity. Development 128: 581–590.[Abstract]

JIN, J., X. LI, S. P. GYGI and J. W. HARPER, 2007 Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature 447: 1135–1138.[CrossRef][Medline]

JOHNSON, A. D., D. FITZSIMMONS, J. HAGMAN and H. M. CHAMBERLIN, 2001 EGL-38 Pax regulates the ovo-related gene lin-48 during Caenorhabditis elegans organ development. Development 128: 2857–2865.[Abstract/Free Full Text]

JOHNSON, L., D. GREENBAUM, K. CICHOWSKI, K. MERCER, E. MURPHY et al., 1997 K-ras is an essential gene in the mouse with partial functional overlap with N-ras. Genes Dev. 11: 2468–2481.[Abstract/Free Full Text]

KAMATH, R. S., M. MARTINEZ-CAMPOS, P. ZIPPERLEN, A. G. FRASER and J. AHRINGER, 2001 Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol. 2: RESEARCH0002.[Medline]

KAMATH, R. S., A. G. FRASER, Y. DONG, G. POULIN, R. DURBIN et al., 2003 Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231–237.[CrossRef][Medline]

KELLY, W. G., C. E. SCHANER, A. F. DERNBURG, M. H. LEE, S. K. KIM et al., 2002 X-chromosome silencing in the germline of C. elegans. Development 129: 479–492.[Medline]

KIM, J. K., H. W. GABEL, R. S. KAMATH, M. TEWARI, A. PASQUINELLI et al., 2005 Functional genomic analysis of RNA interference in C. elegans. Science 308: 1164–1167.[Abstract/Free Full Text]

KIM, S. K., J. LUND, M. KIRALY, K. DUKE, M. JIANG et al., 2001 A gene expression map for Caenorhabditis elegans. Science 293: 2087–2092.[Abstract/Free Full Text]

KORNFELD, K., D. B. HOM and H. R. HORVITZ, 1995 The ksr-1 gene encodes a novel protein kinase involved in Ras-mediated signaling in C. elegans. Cell 83: 903–913.[CrossRef][Medline]

KUWABARA, T., J. HSIEH, K. NAKASHIMA, K. TAIRA and F. H. GAGE, 2004 A small modulatory dsRNA specifies the fate of adult neural stem cells. Cell 116: 779–793.[CrossRef][Medline]

LAYFIELD, R., K. FRANKLIN, M. LANDON, G. WALKER, P. WANG et al., 1999 Chemically synthesized ubiquitin extension proteins detect distinct catalytic capacities of deubiquitinating enzymes. Anal. Biochem. 274: 40–49.[CrossRef][Medline]

LEHNER, B., C. CROMBIE, J. TISCHLER, A. FORTUNATO and A. G. FRASER, 2006 Systematic mapping of genetic interactions in Caenorhabditis elegans identifies common modifiers of diverse signaling pathways. Nat. Genet. 38: 896–903.[CrossRef][Medline]

LETUNIC, I., R. R. COPLEY, B. PILS, S. PINKERT, J. SCHULTZ et al., 2006 SMART 5: domains in the context of genomes and networks. Nucleic Acids Res. 34: D257–D260.[Abstract/Free Full Text]

LI, L. C., S. T. OKINO, H. ZHAO, D. POOKOT, R. F. PLACE et al., 2006 Small dsRNAs induce transcriptional activation in human cells. Proc. Natl. Acad. Sci. USA 103: 17337–17342.[Abstract/Free Full Text]

LI, M., D. CHEN, A. SHILOH, J. LUO, A. Y. NIKOLAEV et al., 2002 Deubiquitination of p53 by HAUSP is an important pathway for p53 stabilization. Nature 416: 648–653.[CrossRef][Medline]

LIN, H., 2007 piRNAs in the germ line. Science 316: 397.[Abstract/Free Full Text]

LIPSICK, J. S., 2004 synMuv verite–Myb comes into focus. Genes Dev. 18: 2837–2844.[Free Full Text]

LIU, H. Y., V. BADARINARAYANA, D. C. AUDINO, J. RAPPSILBER, M. MANN et al., 1998 The NOT proteins are part of the CCR4 transcriptional complex and affect gene expression both positively and negatively. EMBO J. 17: 1096–1106.[CrossRef][Medline]

MACIEJOWSKI, J., J. H. AHN, P. G. CIPRIANI, D. J. KILLIAN, A. L. CHAUDHARY et al., 2005 Autosomal genes of autosomal/X-linked duplicated gene pairs and germ-line proliferation in Caenorhabditis elegans. Genetics 169: 1997–2011.[Abstract/Free Full Text]

MAEDA, I., Y. KOHARA, M. YAMAMOTO and A. SUGIMOTO, 2001 Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr. Biol. 11: 171–176.[CrossRef][Medline]

MAINE, E. M., J. HAUTH, T. RATLIFF, V. E. VOUGHT, X. SHE et al., 2005 EGO-1, a putative RNA-dependent RNA polymerase, is required for heterochromatin assembly on unpaired DNA during C. elegans meiosis. Curr. Biol. 15: 1972–1978.[CrossRef][Medline]

MELNICK, M. B., L. A. PERKINS, M. LEE, L. AMBROSIO and N. PERRIMON, 1993 Developmental and molecular characterization of mutations in the Drosophila-raf serine/threonine protein kinase. Development 118: 127–138.[Abstract]

MOLIN, L., and A. PUISIEUX, 2005 C. elegans homologue of the Caf1 gene, which encodes a subunit of the CCR4-NOT complex, is essential for embryonic and larval development and for meiotic progression. Gene 358: 73–81.[CrossRef][Medline]

NELSON, F. K., and D. L. RIDDLE, 1984 Functional study of the Caenorhabditis elegans secretory-excretory system using laser microsurgery. J. Exp. Zool. 231: 45–56.[CrossRef][Medline]

OHMACHI, M., C. E. ROCHELEAU, D. CHURCH, E. LAMBIE, T. SCHEDL et al., 2002 C. elegans ksr-1 and ksr-2 have both unique and redundant functions and are required for MPK-1 ERK phosphorylation. Curr. Biol. 12: 427–433.[CrossRef][Medline]

PAK, J., and A. FIRE, 2007 Distinct populations of primary and secondary effectors during RNAi in C. elegans. Science 315: 241–244.[Abstract/Free Full Text]

PANASENKO, O., E. LANDRIEUX, M. FEUERMANN, A. FINKA, N. PAQUET et al., 2006 The yeast Ccr4-Not complex controls ubiquitination of the nascent-associated polypeptide (NAC-EGD) complex. J. Biol. Chem. 281: 31389–31398.[Abstract/Free Full Text]

PELLETTIERI, J., V. REINKE, S. K. KIM and G. SEYDOUX, 2003 Coordinate activation of maternal protein degradation during the egg-to-embryo transition in C. elegans. Dev. Cell 5: 451–462.[CrossRef][Medline]

PRAITIS, V., E. CASEY, D. COLLAR and J. AUSTIN, 2001 Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217–1226.[Abstract/Free Full Text]

QIAO, L., J. L. LISSEMORE, P. SHU, A. SMARDON, M. B. GELBER et al., 1995 Enhancers of glp-1, a gene required for cell-signaling in Caenorhabditis elegans, define a set of genes required for germline development. Genetics 141: 551–569.[Abstract]

REINKE, V., H. E. SMITH, J. NANCE, J. WANG, C. VAN DOREN et al., 2000 A global profile of germline gene expression in C. elegans. Mol. Cell 6: 605–616.[CrossRef][Medline]

REINKE, V., I. S. GIL, S. WARD and K. KAZMER, 2004 Genome-wide germline-enriched and sex-biased expression profiles in Caenorhabditis elegans. Development 131: 311–323.[Abstract/Free Full Text]

RICE, J. C., and C. D. ALLIS, 2001 Histone methylation versus histone acetylation: new insights into epigenetic regulation. Curr. Opin. Cell Biol. 13: 263–273.[CrossRef][Medline]

RITT, D. A., M. ZHOU, T. P. CONRADS, T. D. VEENSTRA, T. D. COPELAND et al., 2007 CK2 is a component of the KSR1 scaffold complex that contributes to Raf kinase activation. Curr. Biol. 17: 179–184.[CrossRef][Medline]

ROBERT, V. J., T. SIJEN, J. VAN WOLFSWINKEL and R. H. PLASTERK, 2005 Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences. Genes Dev. 19: 782–787.[Abstract/Free Full Text]

ROCHELEAU, C. E., R. M. HOWARD, A. P. GOLDMAN, M. L. VOLK, L. J. GIRARD et al., 2002 A lin-45 raf enhancer screen identifies eor-1, eor-2 and unusual alleles of Ras pathway genes in Caenorhabditis elegans. Genetics 161: 121–131.[Abstract/Free Full Text]

ROCHELEAU, C. E., A. RONNLUND, S. TUCK and M. V. SUNDARAM, 2005 Caenorhabditis elegans CNK-1 promotes Raf activation but is not essential for Ras/Raf signaling. Proc. Natl. Acad. Sci. USA 102: 11757–11762.[Abstract/Free Full Text]

RUAL, J. F., J. CERON, J. KORETH, T. HAO, A. S. NICOT et al., 2004 Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Res. 14: 2162–2168.[Abstract/Free Full Text]

RUBY, J. G., C. JAN, C. PLAYER, M. J. AXTELL, W. LEE et al., 2006 Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell 127: 1193–1207.[CrossRef][Medline]

SAPOUNTZI, V., I. R. LOGAN and C. N. ROBSON, 2006 Cellular functions of TIP60. Int. J. Biochem. Cell Biol. 38: 1496–1509.[CrossRef][Medline]

SCHOLL, F. A., P. A. DUMESIC, D. I. BARRAGAN, K. HARADA, V. BISSONAUTH et al., 2007 Mek1/2 MAPK kinases are essential for mammalian development, homeostasis, and Raf-induced hyperplasia. Dev. Cell 12: 615–629.[CrossRef][Medline]

SCHULTZ, J., F. MILPETZ, P. BORK and C. P. PONTING, 1998 SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95: 5857–5864.