Genetics, Vol. 178, 127-143, January 2008, Copyright © 2008
doi:10.1534/genetics.107.077768

Enhancer Blocking and Transvection at the Drosophila apterous Locus

* Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544, {dagger} Department of Cell Biology, University of Basel, CH-4056 Basel, Switzerland and {ddagger} Department of Molecular Biology and Biochemistry, Rutgers University, Piscataway, New Jersey 08854

1 Corresponding author: Department of Molecular Biology, Princeton University, Washington Rd., Princeton, NJ 08544.
E-mail: pschedl{at}princeton.edu

Manuscript received June 16, 2007. Accepted for publication October 22, 2007.

ABSTRACT

Intra- and interchromosomal interactions have been implicated in a number of genetic phenomena in diverse organisms, suggesting that the higher-order structural organization of chromosomes in the nucleus can have a profound impact on gene regulation. In Drosophila, homologous chromosomes remain paired in somatic tissues, allowing for trans interactions between genes and regulatory elements on the two homologs. One consequence of homolog pairing is the phenomenon of transvection, in which regulatory elements on one homolog can affect the expression of a gene in trans. We report a new instance of transvection at the Drosophila apterous (ap) locus. Two different insertions of boundary elements in the ap regulatory region were identified. The boundaries are inserted between the ap wing enhancer and the ap promoter and have highly penetrant wing defects typical of mutants in ap. When crossed to an ap promoter deletion, both boundary inserts exhibit the interallelic complementation characteristic of transvection. To confirm that transvection occurs at ap, we generated a deletion of the ap wing enhancer by FRT-mediated recombination. When the wing-enhancer deletion is crossed to the ap promoter deletion, strong transvection is observed. Interestingly, the two boundary elements, which are inserted ~10 kb apart, fail to block enhancer action when they are present in trans to one another. We demonstrate that this is unlikely to be due to insulator bypass. The transvection effects described here may provide insight into the role that boundary element pairing plays in enhancer blocking both in cis and in trans.


HIGHER-ORDER intrachromosomal and interchromosomal interactions play an important role in regulating gene expression. While such long-range regulatory interactions were first documented in Drosophila, recent studies indicate that they occur in many different organisms. For example, in mammalian cells, genes have been found to colocalize in a nonrandom fashion with one another and with RNA polymerase in transcription factories (OSBORNE et al. 2004). Intrachromosomal interactions have been found in the Igf2/H19 imprinting locus, as well as in the β-globin locus (CARTER et al. 2002; TOLHUIS et al. 2002; MURRELL et al. 2004). Long-range interchromosomal interactions have also been detected between the Igf2/H19 imprinting locus and Wsb1/Nf1 (LING et al. 2006), between the TH2 cytokine locus and the interferon-gamma gene (SPILIANAKIS and FLAVELL 2004; SPILIANAKIS et al. 2005), and between various olfactory receptor (OR) genes and the OR enhancer element (LOMVARDAS et al. 2006). In addition, chromosome pairing has been implicated in the regulation of many genetic phenomena in diverse organisms, such as paramutation in plants, X inactivation in mammals, and repeat-induced point mutation (RIP) in Neurospora (WU and MORRIS 1999).

In Dipterans, such as Drosophila, somatic pairing between homologous chromosomes allows for cross talk between genes and regulatory elements on the two homologs (STEVENS 1908; METZ 1916). To date, a number of trans-regulatory interactions that depend on chromosome pairing have been reported. For example, several types of pairing-dependent silencing have been observed, such as trans repression by the bwD mutant and pairing-sensitive silencing mediated by polycomb response elements (PREs) (HENIKOFF and DREESEN 1989; DREESEN et al. 1991; KASSIS 1994; HAGSTROM et al. 1997; MÜLLER et al. 1999; SASS and HENIKOFF 1999; CSINK et al. 2002). Another pairing-dependent regulatory interaction is the phenomenon of transvection, in which regulatory elements such as enhancers or silencers on one homolog can affect the expression of a gene in trans (DUNCAN 2002). Transvection was first described by E. B. Lewis for the pairing-dependent complementation between bx34e and Ubx1, two alleles of the Ultrabithorax (Ubx) gene (LEWIS 1954). Since then, transvection effects have been reported for over a dozen loci in Drosophila (reviewed in WU and MORRIS 1999; DUNCAN 2002; SIPOS and GYURKOVICS 2005).

Detecting an instance of transvection genetically generally requires an allele that specifically affects the enhancer or regulatory element and a second allele that specifically affects the promoter or coding region. Transvection is most commonly observed as interallelic complementation between two such alleles. Since this special set of mutations is required to detect transvection, it is unknown exactly how prevalent transvection is in Drosophila. However, on the basis of known pairing frequencies of homologous loci (GOLIC and GOLIC 1996b; VAZQUEZ et al. 2002; LOWENSTEIN et al. 2004; HARMON and SEDAT 2005) and the work of CHEN et al. (2002), in which it was shown using a Cre and FLP-mediated transgene coplacement system that the Drosophila genome is generally permissive for transvection, it is likely that the dozen or so known instances of transvection represent only a small fraction of all trans-regulatory effects in Drosophila.

While mutations that inactivate regulatory elements can be used to uncover transvection effects, trans-regulatory interactions have also been detected when a boundary element is interposed between a regulatory element and its target promoter. Boundary elements, or insulators, are sequences that block the action of enhancers or silencers when interposed between the regulatory element and its cognate gene (KELLUM and SCHEDL 1991, 1992; MIHALY et al. 1998; WEST et al. 2002). In fact, the bx34e mutation that Lewis used to first demonstrate transvection in the bithorax complex (BX-C) is caused by a gypsy retrotransposon insertion that contains a boundary element (PEIFER and BENDER 1986).

The best-studied instance of transvection involving a boundary element is that observed at the yellow (y) locus. The y2 allele is an insertion of the gypsy retrotransposon between the y gene and the y wing and body enhancers (GEYER et al. 1990; MORRIS et al. 1999a). The gypsy retrotransposon contains 12 degenerate binding sites for the Suppressor of Hairy-Wing (SuHw) protein, which are sufficient to function as a boundary element (PARKHURST et al. 1988; SPANA et al. 1988; GEYER and CORCES 1992). Both homozygous y2 flies and y2/Df flies have strong yellow phenotypes in their wings and bodies. However, when y2 is crossed to a y promoter deletion (y1#8), the trans-heterozygotes have wild-type levels of y expression (GEYER et al. 1990). Studies of transvection at y have been particularly interesting not only because they have provided insight into the phenomenon of transvection, but also because they have been informative about the mechanism of insulator action (MORRIS et al. 1998; GOLOVNIN et al. 2003; PARNELL et al. 2003).

Here we describe a novel instance of transvection at the apterous (ap) locus. We show that two different boundary element insertions, one that contains the suppressor of Hairy-wing [su(Hw)] insulator and the other that contains the Mcp element, are able to block the activation of ap by the upstream wing enhancer. The Mcp element from the Drosophila BX-C (KARCH et al. 1994; MÜLLER et al. 1999) contains a separable boundary element and a PRE (BUSTURIA et al. 2001; GRUZDEVA et al. 2005), and, like the su(Hw) element, is able to mediate long-range pairing within or even between chromosomes (SIGRIST and PIRROTTA 1997; MÜLLER et al. 1999; VAZQUEZ et al. 2006). When crossed to an ap promoter deletion, both boundary inserts exhibit the interallelic complementation characteristic of transvection. We confirmed that transvection takes place at ap by testing for complementation between ap wing-enhancer and promoter deletions in the presence and absence of the Mcp and su(Hw) boundaries. We also present evidence that promoter tethering of the ap wing enhancer in cis occurs at ap, but to a lesser extent than that observed at the y locus. While both the Mcp and su(Hw) boundary elements can be bypassed by an enhancer in trans, the trans enhancer bypass does not occur when there is a second paired boundary on the other homolog. Interestingly, loss of boundary activity is observed when the two insulators are present in trans to one another. The loss of boundary activity is unlikely to be an instance of insulator bypass. Instead, we propose a transvection-based model to explain the unexpected complementation between the Mcp and su(Hw) inserts. These results are consistent with a model in which boundary element pairing functions to separate independent regulatory domains and in which pairing is integral to the mechanism of enhancer blocking. The transvection effects described here also provide insights into the conditions and chromosomal contexts that are permissive for insulator function and the role of chromosomal conformation/local chromosome topology in boundary function.


MATERIALS AND METHODS

Fly methods and stocks:

Flies were grown on standard cornmeal agar. All crosses reported were carried out at 22°. apf00451 (also known as PBac{WH}f00451), PBac{RB}e01573, and apf08090 (PBac{WH}f08090), were obtained from the Exelixis stock collection at Harvard Medical School. apUGO35 was generously provided by Stephen Cohen. apUGO35 was created by imprecise excision of the enhancer trap insert aprk568 (COHEN et al. 1992). aprk568 is inserted 42 bp 5' of the longest ap cDNA (COHEN et al. 1992). This places aprk568 23 bp 5' of the annotated ap transcription start site (FlyBase). Published information suggests that the distal apUGO35 breakpoint coincides with the aprk568 insertion site. Thus, apUGO35 likely deletes the ap transcription start site and parts of the promoter. su(Hw)v, su(Hw)f, and mod(mdg4)u1 mutants were generously provided by Victor Corces. ap4 [Bloomington (BL)#223], ap56f (BL#4189), aprk568 (BL#5374), Df(2R)nap1 (BL#1006), Df(2R)nap2 (BL#6386), P{hsFLP}12, y1 w* (BL#1929), TM6B, P{Crew}DH2, Tb1 (BL#1501), w1118; CyO, P{Tub-PBac\T}2/wgSp-1 (BL#8285), and P{w[+mC]=ActGFP}JMR1 (BL#4533) were all obtained from the Bloomington Drosophila Stock Center.

Construction of the Flipper 2 element:

The construction of Flipper 2 (see Figure 1A) was a multi-step cloning procedure. Details can be obtained upon request. In brief, the backbone of Flipper 2 consists of the intronless yellow gene (referred to as Dint in GEYER and CORCES 1987) cloned into the P-element vector Carnegie 4 (RUBIN and SPRADLING 1983). In this plasmid (from here on referred to as C4yellow), the wing and body-color enhancers are located 5' of the yellow cDNA. It was kindly provided by Pam Geyer. The mini-white gene (PIRROTTA 1988) was introduced into the SalI- and XbaI-restricted C4yellow as an XhoI–XbaI fragment. The resulting plasmid is called pC4YM. This P-element vector contains unique XhoI and NotI sites on the 5' side of the mini-white gene. These two sites were used to introduce an XhoI–NotI fragment consisting of two parts, one of which is the 661-bp NdeI–PstI bxd element (SIGRIST and PIRROTTA 1997) flanked by FRT sites (GOLIC and LINDQUIST 1989). The FRT-bxd-FRT cassette was excised from plasmid pBSscriptII+FPREF, which was kindly provided by Christian Sigrist. The other part is the 2.9-kb EcoRI Mcp element (MÜLLER et al. 1999) flanked by LoxP sites (SIEGAL and HARTL 1996). The orientation of Mcp is such that the end normally adjacent to iab-4 is closer to FRT-bxd-FRT.


Figure 1
View larger version (37K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

Insertion of an Mcp-containing P element in the apterous regulatory region. (A) A schematic of the Flipper 2 element (top). apMM-Mcp-bxd is an insertion of the Flipper 2 element 403 bp upstream of the ap transcriptional start site (D. melanogaster Genome Release 5.1 coordinates 1614738). (B) Wing phenotypes of the apMM-Mcp, apMM, and apMM-bxd inserts. apMM-Mcp homozygotes have wing defects (N ≥ 684). (C) The following method was used for scoring the severity and penetrance of the ap phenotype: class 1, wild-type wings; class 2, mild-to-severe notching; class 3, approximately normal amount of wing tissue present, but wing blistered or crumpled; class 4, strap-like wings; and class 5, very little or no wing tissue. (D) A representative apMM-Mcp homozygous (class 3) wing. (E) When the Mcp element is deleted, the wings of apMM flies are completely wild type. (F) Expression of white in apMM-Mcp wing discs. Because ap expression is disrupted by the Mcp insert, the wing disc is reduced in size and malformed; however, white expression is evident. (G) In apMM-Mcp/+ wing discs, white is clearly expressed in the ap pattern.

 

P-element-mediated transformation:

Flipper 2-containing transgenic lines were generated according to standard procedures (SPRADLING and RUBIN 1982). DNA was co-injected along with the P-turbo helper plasmid into Df(1)w67c23, y embryos. Transformants were detected by rescue of the white eye-color phenotype and/or the rescue of the yellow body-color and wing phenotypes. A total of 30 independent Flipper 2 lines, which will be described in more detail elsewhere (M. MÜLLER, I. HOGGA and V. PIRROTTA, unpublished results), were established. One of these lines (isolation no. 81.38.2) was found to be inserted in the apterous gene and from here on will be referred to as apMM-Mcp-bxd. The mini-white reporter is dominantly suppressed in apMM-Mcp-bxd flies and its derivatives, but the insert could be identified thanks to strong yellow+ expression in the wings and variegated expression in the adult abdominal cuticle. In the abdominal cuticle, yellow+ expression is dosage dependent. There is no sign of pairing-dependent silencing.

Deletion of Mcp and bxd from the Flipper 2 element:

yw;apMM-Mcp-bxd/SM6a females were crossed with yw;TM6B P[w+, cre]/MKRS, hsFLP males (SIEGAL and HARTL 1996; stock obtained from Francois Karch). The progeny of this cross were heat-shocked twice for 1 hr during late embryogenesis and the first instar larval stage. Among the emerging adults, yw; apMM-Mcp-bxd/+;TM6B P[w+, cre]/+ and yw; apMM-Mcp-bxd/+; MKRS, hsFLP/+ males were collected and crossed with yw;l(2)/SM6a virgins. The progeny of these two crosses were screened for loss of Mcp or loss of bxd, respectively. On the basis of experience with other Flipper 2 transgenes, a change in the expression of the yellow and/or the mini-white reporter gene was expected. However, compared to apMM-Mcp-bxd/+ control flies, apart from a moderate increase in yellow expression on the abdomen, no striking differences were apparent. Therefore, a number of single putative yw;apMM-Mcp/SM6a and yw;apMM-bxd/SM6a males were selected and independent stocks were established. The presence of a deletion chromosome was confirmed with the following PCR reactions: apMM-bxd, primer 1 (mini-white 5', AAGGCGGACATTGACG) and primer 2 (5328, TGGAGTACGAAATGCG). On an agarose gel, the loss of Mcp is accompanied by the change of a 4.5-kb band to a 1.3-kb band: apMM-Mcp, primer 1 (miniwhite 5', see above) and primer 2 (Mcp22/7, CTTCCCTTTCCGAGCG). On an agarose gel, the loss of bxd is accompanied by the change of a 1.26-kb band to a 0.42-kb band.

apMM was made by deleting bxd from apMM-bxd. Briefly, 0- to 24-hr embryos from P{hsFLP}12, y1 w* (from BL#1929); apMM-bxd/CyO flies were collected in bottles, allowed to age for 24 hr, and then heat-shocked for 1.5 hr/day in a 38° water bath until the majority of larvae had formed pupae. Heat-shocked P{hsFLP}12, y1 w*; apMM-bxd/CyO females were collected and crossed to yw; bTf/CyO males and multiple stocks were established and screened for the loss of bxd by PCR. The following primers were used to confirm the deletion of bxd in apMM: primer 1 (8-2, TGTTCAGATGCTCGGCAGATGG) and primer 2 (PEP5'in, GTGACTGTGCGTTAGGTCCTGTT).

Determining the insertion site of apMM-Mcp-bxd by inverse PCR:

Inverse PCR was performed as previously described BELLEN et al. (2004), with several minor modifications. Briefly, DNA was isolated from apMM-Mcp-bxd flies. A total of 50 flies were frozen in liquid nitrogen, homogenized in lysis buffer (0.1 M Tris–HCl, pH 8.0, 0.4 M NaCl, 25 mM EDTA, 1% SDS), mixed with an equal volume of Tris-buffered phenol, and centrifuged to remove debris. The supernatant was then phenol–chloroform extracted three times, washed once with chloroform, ethanol precipitated, and resuspended in 100 µl dH2O. After treatment with 10 µg of RNaseA for 1 hr at 37°, 10 µl of apMM-Mcp-bxd DNA was digested with HinP1I (New England Biolabs, Beverly, MA). The HinP1I enzyme was heat inactivated by incubation at 65° for 30 min, and the sample was diluted 40-fold and ligated with T4 DNA ligase (New England Biolabs). The ligation reaction was carried out overnight at 4° to favor intramolecular ligation. DNA was isolated from the ligation reaction by ethanol precipitation and amplified by nested PCR using the following primers: 5'-end, PCR 1 (plac1, CACCCAAGGCTCTGCTCCCACAAT, and pwht1, GTAACGCTAATCACTCCGAACAGGTCACA); 5'-end, PCR 2 (sp1, ACACAACCTTTCCTCTCAACAA, and pwht1, see above); 3'-end, PCR 1 (pry1, CCTTAGCATGTCCGTGGGGTTTGAAT, and pry4, CAATCATATCGCTGTCTCACTCA); and 3'-end, PCR 2 (pry2, CTTGCCGACGGGACCACCTTATGTTATT, and pry1, see above).

The PCR products were excised from a gel and isolated using the QIAquick gel extraction kit (QIAGEN, Valencia, CA). The PCR products were then sequenced using the sp1 (5') and pry2 (3') primers. The insertion site of apMM-Mcp-bxd was determined to be 403 bp upstream of the apterous transcriptional start site (D. melanogaster Genome Release 5.1 coordinates 1614738). The insertion site and orientation were confirmed by PCR and sequencing between sp1 and apPromR and between plac1 and apPromR:

apPromR, TGGTCTGCAGCTGATCTA.

Scoring the apterous wing phenotypes:

In general, crosses were set up between five to six virgin females and three to four males. Two to three vials were set up in duplicate (for a total of four to six vials). These replicates were compared to calculate a standard deviation. Flies were allowed to lay eggs for 4 days and then the crosses were brooded into new vials. Wing phenotypes were scored each day, until all of the flies in each vial had eclosed. Individual wings were given a score from 1 to 5 on the basis of the severity of the wing defect (for representative wings, see Figure 1C). Wings that were wild type or that had only very minor bristle or wing-vein defects were scored as class 1. Wings with mild-to-severe notching were scored as class 2. Wings that were of approximately normal size, but were blistered or crumpled, were scored as class 3. Wings that were significantly reduced in size or were strap-like in appearance were scored as class 4. Finally, when little or no wing tissue was present, this was scored as class 5. All graphs depict the mean percentage of wings in each of the five classes. Error bars in each graph represent one standard deviation from the mean. Wing specimens shown in the various figures were dissected in 95% ethanol and mounted in Hoyer's medium. Pictures were taken using a Nikon DXM200F digital camera on a Nikon Microphot-SA light microscope.

In situ hybridizations:

In situ hybridizations were done as previously described (TAUTZ and PFEIFLE 1989). Briefly, probes for white or yellow were prepared by in vitro transcription in the presence of digoxigenin (DIG)-labeled dNTPs (Roche). The probe for white was made using T7 polymerase from a white-containing plasmid obtained from Jumin Zhou. A portion of the yellow coding region was amplified by PCR using the following primers: yellow for (GGATTCCGGCCACTCTGACCTAT) and yellow rev (CTGGTCTGAGGTTTCTGTGGCAA).

The yellow PCR product was cloned into the pCRII-TOPO vector (Invitrogen, San Diego), and the yellow probe was made using SP6 polymerase. apMM-Mcp was balanced over CyO, P{w[+mC]=ActGFP}JMR1 (BL#4533) to select homozygous apMM-Mcp larvae. Homozygous apMM-Mcp or apMM larvae were selected and the imaginal discs and central nervous system (CNS) were dissected in PBS. Tissues were fixed in 4% formaldehyde in PBS for 20 min at room temperature, while rocking. The tissues were then washed thoroughly with phosphate-buffered saline + 0.1% Triton X-100 (PBST) and allowed to prehybridize in hybridization buffer (50% formamide, 5x SSC, 50 µg/ml heparin, 0.1% Tween 20, 100 µg/ml sonicated salmon sperm DNA) for 2 hr at 55°. The DIG-labeled probes were then diluted 1:100, heated to 80°, added to the tissue, and incubated at 55° overnight to hybridize. The probe was then removed and the sample was washed extensively with hybridization buffer, followed by PBST. The sample was then probed with 1:2000 HRP-conjugated anti-DIG antibody (Roche) for 1.5 hr. Upon removal of the antibody, the sample was washed extensively with PBST and then washed twice with developing solution (0.1 M NaCl, 0.1 M Tris–HCl, pH 9.0, 0.05 M MgCl2, 0.1% Tween 20). The tissues in developing solution were transferred to a glass dish and 20 µl of solution [18.75 mg/ml Nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3'-indolyl phosphate, toluidine salt, in 67% dimethyl sulfoxide (w/v) (Roche)] was added. In situs were developed for between 30 and 60 min. The reaction was stopped by washing twice with PBST. Imaginal discs and brains were then mounted on slides in 70% glycerol and pictures were taken using a Nikon DXM200F digital camera on a Nikon Microphot-SA light microscope.

Reverting the apf00451 insertion by mobilizing the piggyBac element:

apf00451 virgins were crossed with w1118; CyO, P{Tub-PBac\T}2/wgSp-1 (BL#8285) males. w; apf00451/CyO, P{Tub-PBac\T}2 males or females were selected from this cross and mated with w; Sp Pin/CyO virgins or males, respectively. A total of 19 independent crosses were set up. Among the progeny of these 19 crosses, apf00451revertant males with white eyes due to the loss of the PBac{WH} transposon were isolated and individually crossed with w; Sp Pin/CyO virgins. In this way, nine independent apf00451 revertant stocks were established. All nine stocks were homozygous viable and had normal wings.

Deleting the apterous wing enhancer:

The region containing the apterous wing enhancer was deleted by FLP-mediated recombination between the FRT site present in apMM-Mcp and the FRT site present in PBac{RB}e01573 (GOLIC and GOLIC 1996a; PARKS et al. 2004; THIBAULT et al. 2004). Briefly, P{hsFLP}12, y1 w* (from BL#1929); apMM-Mcp/CyO virgin females were crossed to PBac{RB}e01573 males. Embryos (0–24 hr) were collected in bottles, allowed to age for 24 hr, and then heat-shocked for 1.5 hr/day in a 38° water bath until the majority of larvae had formed pupae. P{hsFLP}12, y1 w*; apMM-Mcp/PBac{RB}e01573 males were selected and crossed to yw; bTf/CyO virgin females. In the next generation, progeny were scored for the absence of the yellow marker from apMM-Mcp and the white marker from PBac{RB}e01573. Two yw flies (indicative of a deletion of the intervening DNA, apDG-Mcp) were recovered, as well as one y+w+ fly (indicative of a duplication of the ap wing-enhancer region, ap2xE). ap2xE homozygotes carrying a duplication of the ap wing enhancer had no obvious phenotype. Presence of a recombinant P element in apDG-Mcp and ap2xE was confirmed by PCR and sequencing. The following primers were used: apMM-Mcp 5', Mcpout (CCACAGAACTTCTTCCCTTTCCGA); apMM-Mcp 3', 8-2 (see above); PBac{RB}e01573 5', w2Down (GACCTGTTCGGAGTGATTAGCGTT); and PBac{RB}e01573 3', RB2 (GCCCAATTCGCCCTTGAAGATCTA).

PCR was also done on DNA isolated from wild type and apDG-Mcp and ap2xE homozygotes to show that primers to the deleted region failed to form a product in apDG-Mcp flies. The following primers were used: apE1 (CCCCGGTTAAGTCGGAACTGATT), apE2 (AGGTTCCTGCCCCCTTCTTTTACA), apE5 (GAGCCCGGCTCTATTCACACTTT), apE6 (CTCGCCCTTCCAGGACTATGTTT), apPromF2 (TACCGACTTTGGTCTGCAGCTGAT), and apPromR2 (GCTACCGCTGCCTTATTCACGTT).

The two primer pairs for the ap wing-enhancer region (apE1/apE2 and apE5/apE6) did not form a product in apDG-Mcp flies, while the amplification of the primer pair in the vicinity of the ap promoter (apPromF2/apPromR2) was normal (data not shown).

apDG was generated by excising Mcp from apDG-Mcp using Cre recombinase (TM6B, P{Crew}DH2, Tb1: BL#1501). PCR and sequencing was done to confirm the presence (primer pair RB2/Mcpout; see above for sequence) or absence (primer pair RB2/PEP5'in; see above) of Mcp. Both apDG-Mcp and apDG delete the ~26.8-kb region between apMM-Mcp and PBac{RB}e01573 (D. melanogaster Genome Release 5.1 coordinates 1614738–1641533).


RESULTS

apterous phenotype caused by an Mcp-containing P-element insertion:

The ap gene encodes a LIM-homeodomain transcription factor that is necessary for specifying dorsal cell fate and defining the dorsal/ventral compartment boundary in the developing wing (BOURGOUIN et al. 1992; COHEN et al. 1992). Perturbing ap expression in the wing disc can lead to defects in the adult wing blade. Weak ap mutants cause a held-out wing phenotype (WILSON 1981), while stronger hypomorphic alleles lead to reductions in wing size, as well as blistering or crumpling of the wing blade. Null mutants in ap, such as apUGO35, cause a complete loss of wings and halteres in adult flies (COHEN et al. 1992). In addition to its role in wing patterning, ap is also expressed in the haltere, leg, and eye-antennal imaginal discs in the developing CNS, the peripheral nervous system, brain, and in a subset of embryonic muscle precursors (BOURGOUIN et al. 1992; COHEN et al. 1992). The enhancers that drive the expression of ap in the wing and CNS are located ~6–12 kb upstream of the ap promoter (LUNDGREN et al. 1995), while the embryonic muscle enhancer is located in downstream of the ap transcriptional start site in intronic regions (CAPOVILLA et al. 2001).

An insertion of the Flipper 2 transposon carrying the Mcp element that had a strong ap phenotype was isolated (see MATERIALS AND METHODS) (Figure 1A). This insertion, called apMM-Mcp, failed to complement Df(2R)nap1 and Df(2R)nap2, two deficiencies that delete the ap gene. apMM-Mcp/Df as well as homozygous apMM-Mcp flies have wing defects that range from a complete lack of wings to wings that are severely blistered or crumpled (Figure 1, B and D) and also frequently lack halteres. In addition, like other strong ap alleles, apMM-Mcp flies are short lived and cannot be maintained as a homozygous stock. The insertion site of apMM-Mcp was mapped by inverse PCR (BELLEN et al. 2004). apMM-Mcp was determined to be inserted 403 bp upstream of the ap transcriptional start site between the wing enhancer and the ap promoter (Figure 1A). Using the Cre recombinase, a derivative of apMM-Mcp lacking Mcp was created (apMM). The wings of apMM flies are completely normal (Figure 1, B and E), implying that the Mcp element is responsible for the wing defect seen in apMM-Mcp flies. In addition, apMM flies are homozygous viable and a homozygous stock has been maintained for many generations.

Since the Mcp element present in apMM-Mcp contains both a boundary element and a PRE (BUSTURIA et al. 1997; MÜLLER et al. 1999; GRUZDEVA et al. 2005), two possible models could account for the ap phenotype in apMM-Mcp flies. It is possible that the Mcp PRE silences ap; alternately, the Mcp boundary may block the wing enhancer, which is located 6–12 kb upstream of the ap gene (LUNDGREN et al. 1995).

If the wing phenotype observed in apMM-Mcp flies is due to the silencing of the ap gene by the Mcp PRE, one would predict that the y and w transformation markers in the transposon would also be silenced in the wing. On the other hand, if the Mcp boundary prevents the wing enhancer from activating the ap gene, then the apMM-Mcp transposon transformation markers would likely be expressed in an ap pattern. Our results are consistent with the boundary model. First, in contrast to ap, y is strongly expressed in the wings of apMM-Mcp flies (Figure 1, D and E) and variegated y expression is also seen in the abdomen (data not shown). The y expression observed in the adult wing of apMM-Mcp flies is likely driven by a combination of the y wing enhancer in the Flipper 2 transgene and the upstream ap wing enhancer. y expression is also seen in the ap pattern in the developing wing disc of apMM-Mcp flies by in situ hybridization (data not shown). Second, while the w gene in the transposon is silenced in the eye and apMM-Mcp flies have white eyes, w is not silenced in the wing disc. Instead, w is expressed in the developing wing disc of apMM-Mcp flies in the ap pattern (Figure 1, F and G).Thus neither of the reporter genes present in the Flipper 2 P element are silenced in the wing. Instead, both w and y appear to be expressed under the control of the ap wing enhancer.

Other lines of evidence argue that the effects of Mcp on ap in the wing are due to its boundary activity and not due to silencing by the PRE. Since silencing by PREs is often pairing sensitive, if the wing phenotype of apMM-Mcp were due to silencing of ap by the Mcp PRE, the silencing might be expected to be stronger when the P element is homozygous, as opposed to hemizygous. As seen in Figure 2A, flies that are homozygous or hemizygous for apMM-Mcp have identical wing phenotypes.


Figure 2
View larger version (20K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

Transvection at the apterous locus uncovered by apMM-Mcp. (A) Similar wing defects are observed in apMM-Mcp and apMM-Mcp/Df(2R)nap1 flies, while the apterous phenotype of apMM-Mcp is strongly suppressed when crossed to apUGO35, a null mutant that deletes the ap promoter and first exon (N ≥ 536). (B) A schematic depicting the chromosomes of apMM-Mcp/Df(2R)nap1. In this genotype, the wing enhancer (open oval) is blocked by Mcp in cis. (C) A schematic depicting the chromosomes of apMM-Mcp/apUGO35. In this genotype, the trans and/or cis wing enhancers are able to partially bypass the Mcp boundary.

 
Finally, we tested whether substituting the well-characterized bxd PRE for Mcp could recapitulate the ap phenotype observed with apMM-Mcp. apMM-bxd was made by using the Cre recombinase to excise Mcp from the original Flipper 2 insert (Figure 1A, apMM-Mcp-bxd). The wings of apMM-bxd flies were completely normal (Figure 1B), suggesting that enhancer blocking by Mcp and not silencing by the Mcp PRE is responsible for the wing defect seen in apMM-Mcp flies. Like apMM flies, apMM-bxd flies are homozygous viable and a homozygous stock has been maintained for many generations. Taken together, these observations suggest that the wing defects observed in apMM-Mcp flies are due to the enhancer blocking activity of the Mcp boundary element and not due to silencing by the Mcp PRE.

Transvection at the apterous locus:

The fact that the ap phenotype of apMM-Mcp flies is due to Mcp enhancer blocking is further supported by the fact that interallelic complementation characteristic of transvection is observed when apMM-Mcp is crossed to other ap alleles. When apMM-Mcp is crossed to Df(2R)nap1, a deficiency that deletes the ap gene, the wing defects due to the Mcp insertion are unchanged (Figure 2, A and B). In contrast, when apMM-Mcp is crossed to apUGO35, a null mutation that deletes the ap transcriptional start site as well as the first exon (COHEN et al. 1992), the wing defects are strongly suppressed (Figure 2, A and C). The simplest explanation of this interallelic complementation is that the wing enhancer on the apUGO35 chromosome is able to act in trans on the apMM-Mcp chromosome, a phenomenon known as transvection (Figure 2C). It is also possible that the enhancer in cis to the Mcp boundary is able to bypass the boundary due to structural disruption of the ap locus when apMM-Mcp is crossed to apUGO35 (Figure 2C; MORRIS et al. 1998). And, while the wing defects of apMM-Mcp/apUGO35 are significantly less severe than those of apMM-Mcp homozygotes, the wings are not completely wild type. This would suggest that, in the presence of the Mcp boundary, the activation of ap in trans by the wing enhancer is less efficient than cis activation.

A piggyBac insertion containing the su(Hw) boundary element inserted in the apterous regulatory region:

A second boundary-element-containing insertion in the ap regulatory region was obtained from the Harvard–Exelixis stock collection (PARKS et al. 2004; THIBAULT et al. 2004). This piggyBac WH element, apf00451, contains the su(Hw) boundary element and is inserted ~10.1 kb upstream of the ap transcriptional start site. apf00451 has a weak, but highly penetrant, ap phenotype (Figure 3, A and C). The wing defect of apf00451 is attributable to the presence of the piggyBac insertion, as nine of nine revertants obtained by mobilizing the piggyBac transposon are homozygous viable and have wild-type wings (data not shown). The insertion site of apf00451 is near the middle of an ~6-kb fragment that is capable of driving reporter gene expression in the ap pattern in the wing disc and CNS (LUNDGREN et al. 1995). The fact that apf00451 has a weak ap phenotype suggests that this insert is able to partially block the wing enhancer (perhaps blocking elements of the enhancer that are distal to the insertion site, but not affecting the gene proximal portions of the wing enhancer).


Figure 3
View larger version (31K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

A su(Hw)-insulator-containing P element also blocks the apterous wing enhancer and supports transvection. (A) As with apMM-Mcp, the wing defects of homozygous apf00451 flies and apf00451/Df(2R)nap1 flies are similar, but are strongly suppressed when apf00451 is crossed to apUGO35. The ap phenotype of apf00451 is also strongly suppressed by the su(Hw)v/su(Hw)f and mod(mdg4)u1 mutants, which interfere with su(Hw) element enhancer-blocking activity (N ≥ 142). (B) apMM-Mcp is not affected by either su(Hw)v/su(Hw)f or mod(mdg4)u1 mutants. This suggests that su(Hw) and mod(mdg4) are not involved in Mcp boundary activity; neither do they affect the normal regulation of the ap gene, so the effects on apf00451 seen in A, E, and F are specific to the su(Hw) boundary (N ≥ 72). (C) A representative apf00451 (class 3) wing. (D) A representative apf00451/apUGO35 (class 1) wing. (E) A representative apf00451; su(Hw)v/su(Hw)f (class 1) wing. (F) A representative apf00451; mod(mdg4)u1 (class 1) wing. (G) A schematic depicting the chromosomes of apf00451/apUGO35. In this genotype, the trans and/or the cis wing enhancers are able to bypass the su(Hw) boundary. The ap gene is also likely activated by the unblocked, ap proximal portion of the wing enhancer (dashed arrow).

 
This suggestion is supported by analysis of the effects of mutations in two of the trans-acting factors that are required for enhancer blocking by the su(Hw) element. Both the Su(Hw) and Modifier of mdg4 [Mod(mdg4)] proteins are necessary for su(Hw) element enhancer blocking. Su(Hw) is a DNA-binding protein containing 12 zinc-finger domains, which binds to the YRTTGCATACCY repeats present in the su(Hw) element from the gypsy reterotransposon (PARKHURST et al. 1988; GEYER and CORCES 1992; PARNELL et al. 2006; RAMOS et al. 2006). Mod(mdg4) is a BTB/POZ domain-containing protein that can interact with Su(Hw), other components of the su(Hw) insulator, and itself to form insulator bodies (PARKHURST et al. 1988; GEYER and CORCES 1992; GERASIMOVA and CORCES 1998; GERASIMOVA et al. 2000; GHOSH et al. 2001). To test whether the ap wing phenotypes observed in apf00451 flies are due to the presence of the su(Hw) boundary element, apf00451 flies were crossed to mutants in su(Hw) and mod(mdg4). When apf00451 was crossed to the hypomorphic combination su(Hw)v/su(Hw)f, the wing defects were nearly completely suppressed (Figure 3, A and E). Similarly, when apf00451 was crossed into a homozygous mod(mdg4)u1 mutant background, the wing defects were also strongly suppressed (Figure 3, A and F). The wings of apf00451; mod(mdg4)u1 flies are nearly wild type, with the exception of a disrupted L2 wing vein; however, this is likely due to the mod(mdg4) mutation rather than apf00451, as the wing-vein defect is also present in +/+; mod(mdg4)u1 flies. The fact that both su(Hw)v/su(Hw)f and mod(mdg4)u1 strongly suppress the wing defect of apf00451 suggests that, like apMM-Mcp, the phenotype of apf00451 is due to disruption of the ability of the wing enhancer to activate ap by the su(Hw) boundary element.

We also tested whether su(Hw) or mod(mdg4) mutations have any effect on the boundary activity of the Mcp element in apMM-Mcp. Neither su(Hw)v/su(Hw)f nor mod(mdg4)u1 had an effect on the wing defects observed with apMM-Mcp, indicating that su(Hw) and mod(mdg4) do not affect the Mcp boundary, nor do they affect the regulation of ap in the absence of the apf00451 insert (Figure 3B). In addition, mod(mdg4)u1 was crossed to the Beadex1 (Bx1) mutation. The Bx gene is a direct transcriptional target of ap, and the Bx1 mutation has been used to screen for other genes involved in the regulation of ap (MILAN et al. 2004). mod(mdg4)u1 had no effect on the wing defects observed with Bx1, indicating that mod(mdg4) is not normally involved in the ap pathway (data not shown).

As in the Mcp-containing insert, apMM-Mcp, interallelic complementation characteristic of transvection was observed for apf00451. The phenotype of apf00451/Df(2R)nap1 is as severe as that of apf00451 homozygotes (Figure 3A). As with the Mcp insert, the wing defect of apf00451 was strongly suppressed when apf00451 was crossed to the promoter deletion, apUGO35, suggesting that this allele is also able to support transvection (Figure 3, A, D, and G).

Deletion of the apterous wing enhancer—testing the transvection hypothesis:

To provide further evidence that transvection occurs at the ap locus, the region containing the ap wing enhancer was deleted by FLP-mediated recombination between FRT sites in apMM-Mcp and the insert PBac{RB}e01573 (GOLIC and GOLIC 1996a; PARKS et al. 2004; THIBAULT et al. 2004). The resulting deletion, apDG-Mcp, deletes an ~26.8-kb region spanning the ap wing enhancer. apDG-Mcp is homozygous viable, indicating that it does not disrupt the function of the neighboring gene, l(2)09851, which is ~500 bp from the deletion breakpoint. As expected for an ap wing-enhancer deletion, apDG-Mcp homozygotes completely lack wings (Figure 4, A and C). Likewise, apDG-Mcp/Df(2R)nap1 flies fail to form wings (Figure 4A). However, robust interallelic complementation is seen between apDG-Mcp and apUGO35 (Figure 4, A and E). While neither apDG-Mcp nor apUGO35 homozygotes have any observable wing tissue, the majority of apDG-Mcp/apUGO35 flies have either class 3 (crumpled or blistered) or class 4 (strap) wings. To test whether the Mcp element in apDG-Mcp attenuates enhancer action in trans, we generated an ap wing-enhancer deletion derivative that lacks the Mcp element, apDG, using Cre recombinase. The transvection effect is much more striking when the Mcp element is excised from the enhancer deletion. apDG/apUGO35 flies have almost completely wild-type wings (Figure 4, B and F). The fact that transvection is stronger in apDG/apUGO35 flies compared with apDG-Mcp/apUGO35 flies indicates that Mcp is able to block the enhancer on the apUGO35 chromosome in trans. It is interesting to note that enhancer action in trans in the apDG/apUGO35 combination is sufficient for nearly wild-type levels of expression (Figure 4G).


Figure 4
View larger version (32K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

Deletion of the apterous wing enhancer. (A) Both the Mcp-containing enhancer deletion apDG-Mcp and apUGO35 are completely defective in forming wings either as homozygotes or over Df(2R)nap1. However, the wing defects of these mutants are significantly suppressed in apDG-Mcp/apUGO35 trans-heterozygotes (N ≥ 196). (B) As with apDG-Mcp, both homozygous apDG and apDG/Df(2R)nap1 flies fail to form any wing material. When the enhancer deletion apDG is crossed to apUGO35, >90% of the wings are completely wild type (N ≥ 158). (C) A homozygous apDG-Mcp fly. (D) A homozygous apDG fly. (E) A representative apDG-Mcp/apUGO35 (class 3) wing. (F) A representative apDG/apUGO35 (class 1) wing. (G) A model for the transvection observed in apDG/apUGO35 flies.

 

The role of the promoter in ap transvection:

We also tested whether transvection was observed for several additional ap mutations that, unlike apUGO35, are likely to have an intact ap promoter. Two spontaneous ap mutants, ap4 and ap56f, the P-element insertion aprk568, and the piggyBac WH insertion apf08090 were tested for transvection in combination with the Mcp boundary insertion (apMM-Mcp), the enhancer deletion (apDG), and the enhancer deletion linked to the Mcp boundary (apDG-Mcp). While no molecular information is available for ap4 and ap56f, it is likely that these mutants disrupt the ap-coding region, and not the regulatory elements, as they fail to complement apUGO35 (data not shown). apf08090 is an insertion in the second large intron of ap, just upstream of the ap-RB transcriptional start site (D. melanogaster Genome Release 5.1 coordinates 1597428). On the basis of complementation data and the fact that apf08090 is not suppressed by mutations in su(Hw) or mod(mdg4) (data not shown), the ap mutant phenotype observed with this allele is likely to be due to a disruption of the ap open reading frame (ORF), rather than enhancer blocking by the su(Hw) insulator present in the WH piggyBac transposon.

ap4, ap56f, aprk568, and apf08090 all suppress the apMM-Mcp wing phenotype (Figure 5A). However, the suppression observed with these other four ap alleles is weaker than that seen when apMM-Mcp is crossed to apUGO35, suggesting that the ap wing enhancer can be tethered by an intact promoter in cis. On the other hand, since some transvection is still observed in these four mutants that likely do not disrupt the ap promoter, the cis tethering of enhancers at ap must be weaker than that observed at the endogenous y locus, where an intact promoter in cis largely suppresses transvection (MORRIS et al. 1999b; LEE and WU 2006). aprk568 is an insertion of a P element 23 bp 5' of the annotated ap transcription start site, suggesting that this insert may compromise, but not completely abolish, promoter function. Consistent with this observation, aprk568 supports transvection at a level intermediate to apUGO35 and the other ap alleles tested. Like ap4 and ap56f, aprk568 fails to complement apUGO35 (data not shown).


Figure 5
View larger version (25K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

Transvection observed with other ap alleles. Several other ap alleles were tested for transvection effects: (A) As with apUGO35, ap56f, aprk568, apf08090, and ap4, all exhibited transvection when crossed to the boundary insertion apMM-Mcp. These alleles fail to complement one another and Df(2R)nap1 or Df(2R)nap2 (data not shown). This suggests that, as with apUGO35, all these additional alleles affect the ap-coding region/promoter, and not the ap regulatory elements. Also, the transvection effect with apUGO35 is the strongest of all the alleles. This is likely because apUGO35 deletes the ap promoter, which releases the wing enhancer to act only in trans (N ≥ 406). (B) ap56f, aprk568, apf08090, and ap4 also exhibit transvection when crossed to the Mcp-containing enhancer deletion apDG-Mcp. The transvection seen with these four alleles is weaker than that observed in apUGO35/apDG-Mcp flies (N ≥ 268). (C) ap56f, aprk568, apf08090, and ap4 also exhibit transvection when crossed to the enhancer deletion apDG. The transvection seen with these four alleles is weaker than that observed in apUGO35/apDG flies (N ≥ 312).

 
We also tested combinations between apDG and the putative ap-coding region mutations that are expected to retain the promoter. As shown in Figure 5C, transvection is also observed when apDG is combined with these putative point mutations; however, the wing phenotype is not as completely suppressed as it is in the apDG/apUGO35 combination. Although the suppression seen when apDG is combined with these putative ORF mutations is not as strong as when it is combined with the promoter deletion apUGO35, the transvection effects with these alleles are considerably stronger than those observed when these alleles are combined with the enhancer deletion that retains the Mcp element, apDG-Mcp (Figure 5B). This again indicates that the Mcp element can partially interfere with trans-regulatory interactions.

Effect of zeste mutants on transvection at apterous:

Previous studies have implicated the Zeste protein in transvection at some, but not all loci. Transvection effects at white, yellow, Ubx, dpp, and eya are all sensitive to zeste (z) mutants (LEWIS 1954; GELBART and WU 1982; GEYER et al. 1990; LEISERSON et al. 1994; DUNCAN 2002). However, other instances of transvection that are insensitive to mutations in z, such as those observed at Scr, Abd-B, and vg (HOPMANN et al. 1995; SOUTHWORTH and KENNISON 2002; COULTHARD et al. 2005), have been identified. These observations, coupled with the fact that z null mutants are viable and do not have notably disrupted chromosome pairing (GOLDBERG et al. 1989; PIRROTTA 1999), suggest that parallel or redundant mechanisms must exist for maintaining somatic chromosome pairing.

Two alleles of zeste, z1 and za, were tested to see if they influenced transvection at the ap locus. The z1 allele is a gain-of-function mutation that leads to hyperaggregation of the Zeste protein and thus generally increases the strength of a transvection effect (PIRROTTA et al. 1987; CHEN et al. 1992; CHEN and PIRROTTA 1993a,b). za is a hypomorphic mutation, which generally disrupts transvection (GOLDBERG et al. 1989). The z1 mutant had little or no effect on transvection in apUGO35/apDG flies, while the za mutation caused only a slight disruption of transvection in this genotype (Figure 6A). However, stronger effects were seen when the zeste mutants were crossed to a pair of ap alleles in which transvection is less robust. In ap56f/apDG flies, suppression of the wing phenotype was observed in the hyperaggregating z1 mutant background, while little or no effect was seen with za (Figure 6B). This finding is similar to what was previously observed for transvection at the dpp locus, where effects of zeste mutations were observed only in a sensitized background in which pairing had been partially disrupted by chromosomal rearrangements (GELBART and WU 1982).


Figure 6
View larger version (19K):
In this window
In a new window
Download PPT slide
 
FIGURE 6.—

Effects of zeste mutants on apterous transvection. (A) The gain-of function, hyperaggregating z1 allele has little or no effect on apUGO35/apDG transvection, while the hypomorphic mutation, za, causes only a very modest decrease in the strength of apUGO35/apDG transvection (N ≥ 320). (B) z1 suppresses the wing phenotype of ap56f/apDG. za has little or no effect on the wings of ap56f/apDG flies (N ≥ 114).

 

Loss of enhancer blocking in apMM-Mcp/apf00451 trans-heterozygotes:

As with other instances of transvection, the alleles described in this study can be divided into several classes: those that disrupt the ap wing enhancer (apDG), those that disrupt the ap promoter/coding region (apUGO35), those that disrupt enhancer–promoter communication (apMM-Mcp, apf00451), and those that disrupt both the enhancer and the promoter/coding region [Df(2R)nap1, Df(2R)nap2]. As expected, the two deficiencies that lack the ap enhancer and coding region fail to complement any of the other ap mutants. In contrast, complementation is expected and is observed when mutants that disrupt the enhancer are combined with mutants that disrupt the promoter/coding region or when mutations that disrupt enhancer/promoter communication (boundary insertions) are combined with either an enhancer or a promoter/coding region mutation. Complementation/transvection is not expected to occur between alleles in the same class. Contrary to this expectation, when the Mcp (apMM-Mcp) and su(Hw) (apf00451) insertions are combined, the flies had wings that were completely wild type, indicating that the two boundaries fail to block when trans-heterozygous (Figure 7, A–C).


Figure 7
View larger version (23K):
In this window
In a new window
Download PPT slide
 
FIGURE 7.—

Loss of enhancer blocking in flies trans-heterozygous for su(Hw)/Mcp boundary inserts. (A) apMM-Mcp/apf00451 flies have almost completely wild-type wings, suggesting that the enhancer-blocking activities of the Mcp and su(Hw) boundaries are compromised in these flies (N ≥ 362). (B) A representative (class 1) wing from an apMM-Mcp/apf00451 fly. (C) A diagram depicting the apMM-Mcp/apf00451 chromosomes.

 
It seemed possible that this effect might be similar to the phenomenon of insulator bypass, which is observed when two tandem copies of the su(Hw) insulator are placed in between an enhancer and a promoter in a transgenic enhancer-blocking assay (CAI and SHEN 2001; MURAVYOVA et al. 2001). In this case, the two su(Hw) insulators are thought to pair with one another in cis. This cancels out their enhancer-blocking activity, allowing the upstream enhancer to activate the downstream promoter. Supporting this idea that insulator bypass is responsible for the loss of enhancer blocking in apMM-Mcp/apf00451 trans-heterozygotes, insulator bypass has recently been observed when Mcp is substituted for one of the two su(Hw) elements in the transgenic assay (MELNIKOVA et al. 2004).

If the loss of boundary activity in apMM-Mcp/apf00451 flies is caused by insulator bypass due to pairing in trans of the Mcp and su(Hw) elements on the two chromosomes, one would also expect to observe bypass when the su(Hw) insert, apf00451, is in trans to the enhancer deletion that retains an intact Mcp element, apDG-Mcp. However, this is not the case. Instead, the wing phenotype of apDG-Mcp/apf00451 trans-heterozygotes is equivalent to that of homozygous apf00451 or apf00451/Df(2R)nap1 flies (Figure 8, A and C). While this finding argues against a trans Mcp/su(Hw) insulator bypass mechanism in apMM-Mcp/apf00451 flies, it could be argued that the failure to observe suppression of the ap wing phenotype in apDG-Mcp/apf00451 trans-heterozygotes is due to the deletion of the enhancer in the apDG-Mcp chromosome. To exclude this possibility, we tested whether transvection is observed in flies that are trans-heterozygous for the su(Hw) insert, apf00451, and the enhancer deletion lacking the Mcp element, apDG. As can be seen in Figure 8, B and D, trans activation is observed in apf00451/apDG flies. Taken together, these results suggest that the loss of enhancer-blocking apMM-Mcp/apf00451 flies is unlikely to be due to a mechanism involving the pairing of Mcp and su(Hw) in trans and insulator bypass.


Figure 8
View larger version (16K):
In this window
In a new window
Download PPT slide
 
FIGURE 8.—

Enhancer bypass of the Mcp and su(Hw) bounaries in trans. (A) When the ap boundary inserts (apMM-Mcp and apf00451) are crossed to apDG-Mcp, the blocking of the wing enhancer observed is comparable to the homozygous boundary insert (N ≥ 220). (B) The ap wing enhancer is able to partially bypass both the Mcp (apMM-Mcp) and the su(Hw) (apf00451) boundaries in trans when the boundary inserts are crossed to the ap wing-enhancer deletion (N ≥ 362). (C) The ap wing enhancer remains blocked when ap boundary insertions, such as apf00451, are crossed to apDG-Mcp (a deletion of the ap wing enhancer that still contains the Mcp boundary). Presumably, the unblocked, ap proximal portions of the wing enhancer are still able to activate ap (dashed arrow). (D) A model for the partial bypass of the su(Hw) boundary element of apf00451 in trans by the cis-linked ap wing enhancer. (E) A model for the partial bypass of the Mcp boundary element of apMM-Mcp in trans by the cis-linked ap wing enhancer.

 
apMM-Mcp was also crossed to apDG-Mcp. As was the case with apDG-Mcp/apf00451, the wing defects of the apMM-Mcp/apDG-Mcp were as severe as the homozygous boundary inserts, indicating that the one remaining wing enhancer remained blocked (Figure 8A). In contrast, when the Mcp insert, apMM-Mcp, is crossed to the same enhancer deletion lacking the Mcp element, apDG, transvection was observed (Figure 8B). This demonstrates that, in the absence of a trans boundary, the wing enhancer in cis to Mcp can partially bypass the Mcp boundary to activate the ap gene in trans (Figure 8E).

This suggested an alternative model for explaining why the apMM-Mcp/apf00451 trans-heterozygotes have wild-type wings (Figure 9A). Mcp can block an enhancer in cis when hemizygous (Figure 2, A and B), in cis and in trans when homozygous (Figure 2, A and B; Figure 8A), and in trans when over an ap promoter deletion (Figure 4, A and E; compare apDG-Mcp/apUGO35 and apDG/apUGO35). However, Mcp largely fails to block an enhancer that is in cis to the boundary from acting in trans (Figure 8, B, D, and E; Figure 9A). Thus, the fact that apMM-Mcp/apf00451 flies have wild-type wings can be explained by the additive effects of activation of ap by proximal enhancer elements on the apf00451 chromosome and trans activation of ap by the enhancer on the apMM-Mcp chromosome (Figure 9A). As with the other instances of ap transvection involving a boundary element (Figure 2C; Figure 3G), it remains formally impossible to distinguish between enhancer action in trans and disruption of boundary activity [possibly due to some sort of structural or conformational perturbation of the boundary caused by homolog pairing (MORRIS et al. 1998)], leading to activation of ap by the wing enhancer in cis.


Figure 9
View larger version (19K):
In this window
In a new window
Download PPT slide
 
FIGURE 9.—

Possible models for enhancer bypass of the Mcp and su(Hw) boundaries in trans. (A) A model depicting trans activation of the ap gene on the apf00451 chromosome by the ap wing enhancer on the apMM-Mcp chromosome (see Figure 8, B and D). The additive effects of this trans activation (solid arrow) and the activation of ap by the unblocked, ap proximal portions of the ap wing enhancer on the apf00451 chromosome (dashed arrow) could account for the wild-type wings observed in apMM-Mcp/apf00451 trans-heterozygotes. (B) A model depicting how homology-driven chromosome pairing between the structurally dissimilar alleles apMM-Mcp and apf00451 could cause looping out and inactivation of the boundary elements, presumably due to conformational stress. (C) A model depicting pairing between the boundaries present in the apMM-Mcp and apf00451 inserts and two hypothetical boundaries on either side of the ap regulatory region. Such pairing would function to demarcate two distinct chromosomal domains, each of which would exhibit enhancer blocking when homozygous or hemizygous, but could lead to interallelic complementation when trans-heterozygous.

 
As with apMM-Mcp/apDG, apf00451/apDG flies also exhibited a partial bypass of the su(Hw) boundary in trans (Figure 8B). And, while both the Mcp and su(Hw) boundary elements can be bypassed by a cis-linked enhancer in trans, the trans enhancer bypass does not occur when there is a second (paired) boundary on the other homolog (i.e., in apMM-Mcp and apf00451 homozyogtes; Figures 2A and 3A). The fact that apMM-Mcp/apf00451 does not exhibit enhancer blocking must mean that Mcp and su(Hw) are incapable of pairing with one another, that pairing between Mcp and su(Hw) is rendered impossible by local structural constraints, or that the insertions of Mcp and su(Hw) demarcate different chromosomal domains (see DISCUSSION; Figure 9, B and C).


DISCUSSION
A number of recent studies have underscored the importance of intra- and interchromsomal interactions in regulating gene expression in diverse organisms from yeast to humans (MÜLLER et al. 1999; WU and MORRIS 1999; CARTER et al. 2002; DEKKER et al. 2002; TOLHUIS et al. 2002; BANTIGNIES et al. 2003; MURRELL et al. 2004; OSBORNE et al. 2004; RONSHAUGEN and LEVINE 2004; SPILIANAKIS and FLAVELL 2004; SPILIANAKIS et al. 2005; CLEARD et al. 2006; LING et al. 2006; VAZQUEZ et al. 2006). Drosophila is a particularly good system for studying trans interactions, as the majority of the genome remains paired not only during meiosis, but also in somatic cells (STEVENS 1908; METZ 1916). To date, a number of pairing-dependent genetic effects have been found in Drosophila. These trans effects fall into two classes. First, there are homology-dependent trans interactions [such as transvection, bwD, and trans silencing by heterochromatin (HENIKOFF and DREESEN 1989; WU and MORRIS 1999; DUNCAN 2002)], which rely on pairing between homologous chromosomes and are disrupted by inversions or translocations that abolish homolog pairing in the region. Second, there are sequence-specific trans interactions, in which relatively short sequences can mediate pairing between distant loci [for example, Mcp and su(Hw) can confer long-distance pairing to PREs (SIGRIST and PIRROTTA 1997; MÜLLER et al. 1999; VAZQUEZ et al. 2006)].

Transvection at the apterous locus:

Here we present evidence for transvection at the Drosophila apterous locus. While interallelic complementation at ap has been previously reported (SHTORCH et al. 1995), the ap alleles were not molecularly characterized. Consequently, it was not clear whether the complementation between these alleles involved trans-regulatory interactions or occurred at the level of the mutant ap gene products. We have observed trans-regulatory interactions with several different classes of ap mutations.

The first type is the transvection seen in trans combinations between mutations that disrupt enhancers and mutations that disrupt the promoter. At the ap locus, this is illustrated by the apDG/apUGO35 combination (Figure 4, B, F, and G). Interestingly, the transvection observed between apDG and apUGO35 is sufficient to express ap at or near wild-type levels, as >90% of the wings are completely wild type. ap mutants are recessive, so there is likely a range of ap activity that is sufficient to produce wild-type wings (on the basis of the haplo-sufficiency of ap and the fact that the ap2xE allele generated in parallel to apDG, which has a duplication of the wing enhancer, has wild-type wings, this range is likely to extend from at least 0.5 to 2 times normal levels).

It is unknown to what extent Dipterans have learned to exploit this interesting feature of their genomes for normal gene regulation. For example, it is unlikely that trans regulation occurs at the endogenous y locus in wild-type flies, as the enhancers appear to be strongly tethered in cis by the promoter. Instead, trans regulation is observed only at y when the enhancers are freed by deletion of the cis promoter (MORRIS et al. 1999a,b, 2004; LEE and WU 2006). ap is clearly different from y in this respect as we also observe relatively strong trans regulation when the enhancer deletion, apDG, is combined with presumed ap-coding region mutations that are likely to retain an intact promoter (Figure 5C). Since the suppression of these coding region mutants by apDG is not as strong as that observed with the promoter deletion apUGO35, cis interactions between the upstream wing enhancer and the promoter of the mutant gene must compete with the apDG promoter in trans.

The second type of trans-regulatory interaction observed at ap is the transvection effects observed with boundary elements. We identified two different boundary insertions in the ap regulatory region. apMM-Mcp is an insertion of the Mcp-containing Flipper 2 transposon 403 bp upstream of the ap transcriptional start site between the wing enhancer and the ap promoter (Figure 1A). Although the Mcp element in this transgene contains both a boundary element and a PRE, our results indicate that the wing defects seen in homozygous or hemizygous apMM-Mcp flies are due to the enhancer-blocking activity of the boundary and not due to silencing by the Mcp PRE (Figure 1, B, F, and G; Figure 2, A and B). In the absence of an Mcp boundary insertion that lacks the PRE, the possibility remains that the Mcp PRE contributes to the ap wing phenotype. However, if this is the case, it is likely that the role of the PRE is a modulatory one, as the bxd PRE alone is not sufficient to cause wing defects (Figure 1B). apf00451 is a su(Hw)-containing piggyBac element and is also inserted between ap enhancer elements and the ap promoter (Figure 3).

One version of this boundary-element-induced transvection is that seen in the interallelic complementation between the boundary insertions and the ap promoter deletion, apUGO35. This trans-regulatory interaction is observed with both the Mcp and su(Hw) elements. The Mcp insert, apMM-Mcp, has a strong ap wing phenotype, but when it is combined with the promoter deletion, apUGO35, the wing defects are partially suppressed (Figure 2, A and C). The fact that full suppression is not observed in this combination, while it is observed when the enhancer deletion is combined with the promoter deletion, indicates that the Mcp element must be capable of partially blocking trans interactions between the apUGO35 wing enhancers and the apMM-Mcp promoter. This suggestion is substantiated by a comparison of the wing phenotypes in combinations between apUG035 and the enhancer deletion with (apDG-Mcp) and without (apDG) the Mcp element. While nearly full suppression is observed in the latter case, the suppression of the wing defects in apDG-Mcp/apUGO35 flies is comparatively modest (Figure 4, A, B, E, and F). This difference can be attributed to the ability of the Mcp element to block the ap enhancers in trans from activating the ap promoter in cis to the boundary. On the other hand, a comparison of the wing phenotype of the apDG-Mcp/apUGO35 trans combination (Figure 4A) with flies that are either hemizygous or homozygous for the Mcp insertion, apMM-Mcp (Figure 2A), reveals that the enhancer-blocking activity of this boundary element is stronger when the enhancer and promoter are in cis than when they are in a trans configuration.

The other version of boundary-element-induced transvection that we observed is the trans combination between the boundary insertions and the ap wing-enhancer deletion, apDG. This combination was tested for the Mcp and su(Hw) inserts and in both cases the wing phenotype of the enhancer deletion was suppressed (Figure 8, B, D, and E). Since the extent of suppression in both cases is considerably less than seen when the enhancer deletion apDG is combined with the promoter deletion apUGO35, it would appear that the boundary in cis to the enhancer is able to partially block its interactions with the ap promoter in trans. As noted above, the converse is also true: boundary elements in trans to the enhancer are able to partially block interactions with the ap promoter in cis.

Since these results demonstrate that the Mcp and su(Hw) boundaries can act not only in cis but also in trans, one might predict either that no interallelic complementation would be observed when two different boundary inserts are combined or that the phenotype would actually become even stronger because of the ability of boundaries to inhibit regulatory interactions in trans. Surprisingly, however, neither of these expectations holds. Instead, flies trans-heterozygous for the Mcp insert apMM-Mcp, and the su(Hw) insert apf00451 have completely wild-type wings (Figure 7, A–C). One mechanism that could account for this unexpected result is insulator bypass. Studies on the su(Hw) insulator have shown that enhancer-blocking activity is neutralized when there are two copies of this element in tandem between the enhancer and the promoter (CAI and SHEN 2001; MURAVYOVA et al. 2001). While bypass is thought to involve su(Hw)-pairing interactions, other insulators, including Mcp, can be substituted for one of the two su(Hw) elements (MELNIKOVA et al. 2004). A strong prediction of the insulator bypass model is that interallelic complementation should also be observed when the su(Hw) element in apf00451 is in trans to the enhancer deletion that retains an intact Mcp element, apDG-Mcp. However, this is not the case as the wing phenotype of apDG-Mcp/apf00451 trans-heterozygotes is the same as that of apf00451 alone (Figure 8, A and C). This result indicates that the Mcp element is able to prevent trans activation of the ap promoter in cis by the wing enhancers on the apf00451 chromosome. The ability to block enhancers on the trans chromosome from contacting the promoter in cis to a boundary element was also observed when apMM-Mcp is combined with the Mcp-containing enhancer deletion apDG-Mcp (Figure 8A).

Thus, the interallelic complementation observed in apMM-Mcp/apf00451 flies is not likely to be an instance of insulator bypass. Instead, it seems that the additive effects of the unblocked, ap proximal portion of the apf00451 enhancer and trans activation by the enhancer on the apMM-Mcp chromosome (similar to that observed in Figure 8, B, D, and E) can account for the wild-type wings of apMM-Mcp/apf00451 flies (Figure 9A).

Enhancer blocking by boundary elements and transvection:

Including the studies reported here on boundary insertions in the ap locus, there are now several examples in which the blocking activity of a boundary element can be partially bypassed by interactions between enhancers on one chromosome and the target gene/promoter on the other chromosome (PEIFER and BENDER 1986; GEYER et al. 1990; MORRIS et al. 1998, 1999a; GOLOVNIN et al. 2003). These findings raise the question of why boundary elements are more permissive for regulatory interactions in trans than they are for interactions in cis.

Answering this question depends upon how enhancers communicate with promoters and how boundaries block this communication. Two general models have been proposed to explain how enhancers interact with their target promoters (WEST and FRASER 2005). In the first model, the enhancer (or an activator molecule recruited by the enhancer) processively tracks along the chromosome (perhaps modifying the intervening chromatin) until it encounters the promoter. In this model, boundary elements function as roadblocks (or "promoter decoys"), stopping the tracking activator and/or the spread of active chromatin (WEST et al. 2002). As this model requires the enhancer to act in cis, it is difficult to reconcile it with the phenomenon of transvection, which depends upon regulatory interactions occurring in trans. In addition, if transvection is explained in this model by postulating that the tracking activator skips from one paired chromosome to the other, then it is hard to understand how a boundary element would ever be able to prevent an enhancer from activating a promoter since an activator molecule that can skip freely in trans should also be able to skip over a boundary in cis.

The second model, which is strongly supported by recent studies, hypothesizes that the sliding of the chromatin fiber against itself within a higher-order chromatin domain brings the enhancer and promoter into contact while looping out the intervening DNA (CARTER et al. 2002; TOLHUIS et al. 2002; SPILIANAKIS and FLAVELL 2004; PETRASCHECK et al. 2005; SPILIANAKIS et al. 2005; LOMVARDAS et al. 2006). This is more easily reconciled with transvection since the enhancer could interact with a promoter in trans by a similar sliding-looping mechanism as long as the chromatin fibers of the two chromosomes are paired. Indeed, chromosomal rearrangements that disrupt pairing also tend to disrupt transvection (LEWIS 1954; GELBART 1982; LEISERSON et al. 1994; WU and MORRIS 1999; DUNCAN 2002; COULTHARD et al. 2005). In this model, boundary elements prevent enhancer–promoter contact by isolating the enhancer and the promoter from each other in topologically independent looped domains. It is thought that boundaries generate topologically independent looped domains through pairing interactions with the neighboring boundaries (or by interacting with some fixed structure such as the nuclear matrix) (reviewed in WEST et al. 2002). This mechanism is supported by studies on su(Hw), scs/scs', and several boundaries from the Drosophila BX-C (SIGRIST and PIRROTTA 1997; MÜLLER et al. 1999; GERASIMOVA et al. 2000; CAI and SHEN 2001; MURAVYOVA et al. 2001; BANTIGNIES et al. 2003; BLANTON et al. 2003; BYRD and CORCES 2003; GRUZDEVA et al. 2005; VAZQUEZ et al. 2006). For example, pairing