Genetics, Vol. 166, 1229-1240, March 2004, Copyright © 2004

Severe Impairment of Growth and Differentiation in a Neurospora crassa Mutant Lacking All Heterotrimeric G{alpha} Proteins

Ann M. Kays1,a and Katherine A. Borkovicha
a Department of Microbiology and Molecular Genetics, University of Texas-Houston Medical School, Houston, Texas 77031

Corresponding author: Katherine A. Borkovich, University of California, 2338 Webber Hall, 900 University Ave., Riverside, CA 92521., katherine.borkovich{at}ucr.edu (E-mail)

Communicating editor: J. J. LOROS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Heterotrimeric G{alpha} proteins play a critical role in regulating growth and differentiation in filamentous fungi. No systematic analysis of functional relationships between subunits has been investigated. This study explores the relative contributions of Neurospora crassa G{alpha} subunits, gna-1, gna-2, and gna-3, in directing development by analyzing strains deleted for various combinations of these genes. Although viable, mutants lacking all G{alpha} subunits or gna-1 and gna-3 are severely restricted in apical growth, forming small colonies. These strains form little aerial hyphae during asexual development on solid medium and exhibit inappropriate sporulation in submerged cultures. Similar to all strains carrying the {Delta}gna-1 mutation, these mutants are female sterile. Defects attributed to gna-2 are observed only in conjunction with the loss of gna-1 or gna-3, suggesting a minor role for this G{alpha} in N. crassa biology. Results from analysis of adenylyl cyclase and epistatic studies with the cAMP-dependent protein kinase regulatory subunit (mcb) indicate separate functions for GNA-1 and GNA-3 in cAMP metabolism and additional cAMP-independent roles for GNA-1. These studies indicate that although G{alpha} subunits are not essential for viability in filamentous fungi, their loss results in an organism that cannot effectively forage for nutrients or undergo asexual or sexual reproduction.


CHARACTERIZATION of heterotrimeric G proteins in mammalian cells has revealed an elegant system for cells to quickly respond to an initiating signal and terminate the response in an appropriate time frame (HANSKI and GILMAN 1982 Down). Extracellular ligands are bound by seven-helix receptors that are associated with the inactive G{alpha}-GDP/Gß/G{gamma} heterotrimeric G protein in the plasma membrane. This leads to exchange of GTP for GDP on the G{alpha} subunit and dissociation of the heterotrimer into G{alpha}-GTP and Gß{gamma} units. Depending on the system, G{alpha}-GTP and/or {gamma} can regulate downstream effectors (NEVES et al. 2002 Down). Four subfamilies of G{alpha} proteins have been described (G{alpha}s, G{alpha}i, G{alpha}q, and G{alpha}12) with specific cellular functions attributed to each (for review, see NEVES et al. 2002 Down). In the case of the effector enzyme adenylyl cyclase, proteins from two different G{alpha} subfamilies, G{alpha}s and G{alpha}i, coordinate their activities to up- and downregulate, respectively, the production of cAMP. Regulation can involve direct interaction between the G{alpha} and adenylyl cyclase and/or indirect effects resulting from the action of freed Gß{gamma} dimers on the enzyme. Stimulation by G{alpha}s increases cAMP levels, leading to activation of cAMP-dependent protein kinase A (PKA; for review, see FRANCIS and CORBIN 1999 Down), while inhibition by G{alpha}i decreases intracellular cAMP levels, leading to downregulation of PKA. The coordinated antagonistic roles of G{alpha}s and G{alpha}i subfamily members on adenylyl cyclase allows the integration of differing signals to regulate the enzyme and indirectly alter PKA activity.

Neurospora crassa was the first filamentous fungus in which heterotrimeric G{alpha} protein genes were identified (TURNER and BORKOVICH 1993 Down) and analysis of the complete genome sequence demonstrates that this species contains three G{alpha} subunit genes (http://www-genome.wi.mit.edu/annotation/fungi/neurospora/). Study of gene replacement mutants has shed light on the processes regulated by each G{alpha} protein. During vegetative growth, the N. crassa G{alpha} subunit GNA-1 is necessary for normal apical extension, aerial hyphae development, and resistance to various stresses, while GNA-3 functions are specific to aerial hyphae development and conidiation (asexual sporulation); the conidiation defects of {Delta}gna-3 are suppressed by cAMP (IVEY et al. 1996 Down; YANG and BORKOVICH 1999 Down; KAYS et al. 2000 Down). During the sexual cycle, GNA-1 is necessary for female fertility, while GNA-3 mediates sexual spore (ascospore) maturation (IVEY et al. 1996 Down; KAYS et al. 2000 Down). Loss of gna-2 has no apparent effect on N. crassa growth and development; however, study of {Delta}gna-1 {Delta}gna-2 double mutants suggests a compensatory role for GNA-2 in several GNA-1-regulated processes (BAASIRI et al. 1997 Down).

Multiple G{alpha} subunits have now been described for many filamentous fungal species and, like mammalian G{alpha} subfamilies, regulation of cellular functions has been attributed to specific G{alpha} proteins. Similar to N. crassa, the rice pathogen Magnaporthe grisea has three G{alpha} subunits, magA, magB, and magC (LIU and DEAN 1997 Down). Female fertility is mediated by magB, while the other two G{alpha} subunits are necessary for sporulation (LIU and DEAN 1997 Down). Only magB is required for cAMP-dependent infectious growth during plant colonization (LIU and DEAN 1997 Down). Four G{alpha} protein genes have been identified in the corn smut pathogen Ustilago maydis but phenotypes have been observed only upon loss of one of these, gpa3 (REGENFELDER et al. 1997 Down). Mating is disrupted in gpa3 mutants; since mating is required for pathogenicity, these strains are also avirulent. Two G{alpha} genes, cpg-1 and cpg-2, have been described in the causative agent of chestnut blight Cryphonectria parasitica (GAO and NUSS 1996 Down). Deletion of cpg-1 has a pleiotropic effect, resulting in avirulence, reduced conidiation, and female sterility. In contrast, the greatest defect of {Delta}cpg-2 mutants is enhanced perithecial formation.

Study of fungal G{alpha} subunits has revealed functions for some of these proteins in cAMP metabolism. In many such cases, mutation of the G{alpha} gene has been linked to altered adenylyl cyclase activity and impairment of cAMP-dependent growth and development. Adenylyl cyclase (product of the cr-1 gene; KORE-EDA et al. 1991) activity can be reliably measured in submerged cultures of N. crassa; under these conditions, GNA-1 is required for GTP-dependent activity and GNA-3 regulates the levels of adenylyl cyclase protein, CR-1 (IVEY et al. 1999 Down; KAYS et al. 2000 Down). The levels of cAMP are greatly reduced in both submerged and plate cultures of {Delta}gna-3 mutants. Many defects of {Delta}gna-3 strains are reversed by cAMP supplementation, consistent with regulation of CR-1 amount by GNA-3 in all tissues (KAYS et al. 2000 Down). Although cAMP levels are reduced in plate cultures of {Delta}gna-1 mutants, amounts are normal in submerged cultures. The apparent contradiction between adenylyl cyclase activity and steady-state cAMP levels in submerged cultures of {Delta}gna-1 strains may result from a compensatory mechanism involving reduced cAMP phosphodiesterase activity (IVEY et al. 1999 Down). In M. grisea, {Delta}magB and {Delta}mac1 (adenylyl cyclase) mutants share several phenotypes, suggesting that adenylyl cyclase is downstream of MAGB in this species (CHOI and DEAN 1997 Down). Supplementation with cAMP suppresses {Delta}gpa3 defects in U. maydis (KRUGER et al. 1998 Down) and intracellular cAMP levels are elevated and reduced in C. parasitica {Delta}cpg-1 and {Delta}cpg-2 mutants, respectively (GAO and NUSS 1996 Down; KRUGER et al. 1998 Down).

Reverse genetics has been an effective method for ascertaining the specific role of individual G{alpha} genes in regulating growth and development in filamentous fungi. However, there are no published reports of the effects due to mutating all G{alpha} genes in a filamentous fungal species. Analysis of strains lacking multiple G{alpha} subunit genes would reveal instances of synergistic activities and functional redundancy between subunits. To understand the coordination of the three N. crassa G{alpha} subunits in regulating growth and development, mutants lacking multiple G{alpha} genes were constructed. Morphological defects were investigated and adenylyl cyclase activity was measured. Epistatic analysis between the regulatory subunit of cAMP-dependent protein kinase (mcb; BRUNO et al. 1996 Down) and the gna-1 and gna-3 genes was performed. Our studies indicate that, despite the presence of three G{alpha} proteins, the concerted activities of GNA-1 and GNA-3 dictate the majority of growth and development through the regulation of cAMP-dependent and -independent pathways.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and media:
All N. crassa strains used in this study are described in Table 1. For vegetative growth, strains were cultured on Vogel's minimal medium (VM), while synthetic culturing medium (SCM) was used to induce the sexual cycle (DAVIS and DESERRES 1970 Down). Media were supplemented with 1 mM cAMP (Sigma, St. Louis) or 2% w/v Bacto-peptone (Difco Laboratories, Detroit), as indicated. Inositol (100 µg/ml) and histidine (100 µg/ml) were used as supplements for auxotrophic strains. Plasmids were maintained in Escherichia coli strain DH5{alpha} (HANAHAN 1983 Down).


 
View this table:
In this window
In a new window

 
Table 1. N. crassa strains used in this study

For all crosses, ascospores were plated on sorbose-containing medium (DAVIS and DESERRES 1970 Down) supplemented with 200 µg/ml hygromycin B (Calbiochem, San Diego) followed by incubation at 30°, unless otherwise specified. The {Delta}gna-1 {Delta}gna-2 mutants were generated by crossing strain {Delta}gna-1::hph+; mata (3B10; IVEY et al. 1999 Down) to {Delta}gna-2::pyrG+; matA (a29-1; BAASIRI et al. 1997 Down). The presence of the {Delta}gna-1 and {Delta}gna-2 mutations was verified in several progeny using Southern analysis (BAASIRI et al. 1997 Down; IVEY et al. 1999 Down) and one strain (B3, mata) was used in subsequent experiments. The {Delta}gna-1 {Delta}gna-2 {Delta}gna-3, {Delta}gna-1 {Delta}gna-3, and {Delta}gna-2 {Delta}gna-3 mutants were isolated from a sexual cross between the parental strains {Delta}gna-3::hph+; matA (31c2; KAYS et al. 2000 Down) and {Delta}gna-1::hph+; {Delta}gna-2::pyrG+; mata (B3; BAASIRI et al. 1997 Down). Ninety progeny were genotyped using Southern analysis for the gna-1, gna-2, and gna-3 genes (IVEY et al. 1996 Down; BAASIRI et al. 1997 Down; KAYS et al. 2000 Down). Six {Delta}gna-1 {Delta}gna-2 {Delta}gna-3, two {Delta}gna-1 {Delta}gna-3, and two {Delta}gna-2 {Delta}gna-3 strains were isolated, and strains of the same genotype were determined to share the same phenotype (data not shown).

The {Delta}gna-1 mcb inl and {Delta}gna-3 mcb inl mutants were isolated from crosses between the parental strains {Delta}gna-1::hph+; matA (1B4; IVEY et al. 1999 Down) or {Delta}gna-3::hph+; matA (31c2; KAYS et al. 2000 Down) and mcb inl; mata (obtained from R. L. Metzenberg, Stanford University, Stanford, CA). Control {Delta}gna-1 inl and {Delta}gna-3 inl strains were isolated from crosses between the {Delta}gna-1::hph+; mata (3B10; IVEY et al. 1999 Down) or {Delta}gna-3::hph+; mata mutant (43c2; KAYS et al. 2000 Down) to the inl; matA mutant strain FGSC #497. Ascospores were plated on sorbose-containing medium supplemented with 100 µg/ml inositol and incubated at room temperature (DAVIS and DESERRES 1970 Down). To test for the mcb mutation, progeny were scored for inositol auxotrophy, as mcb and inl are linked (PERKINS et al. 1982 Down). The {Delta}gna-3::hph+ and {Delta}gna-1::hph+ mutations were first scored by resistance of progeny to hygromycin B and genotypes were subsequently verified using Southern analysis (IVEY et al. 1996 Down; KAYS et al. 2000 Down).

Northern and Western analysis:
A plasmid directing overexpression of the GNA-3 protein in E. coli for use in the generation of an antibody was constructed as follows. A gna-3 cDNA clone (4-1) isolated from an N. crassa mycelial cDNA lambda library (M1 library; NELSON et al. 1997 Down) was used as a template for PCR. Primers were constructed to engineer an NdeI site at the 5' end and a BamHI site at the 3' end: the forward primer was GGCATATGGGCGCATGCATG (GNA3-N) and the reverse primer was GGGGATCCGTTCGCTGTTGC (GNA3-C). The ~1-kb PCR product was first cloned into pBluescriptIIKS+ (Stratagene, La Jolla, CA) and then into the overexpression vector pET11a (Novagen, Madison, WI) to generate plasmid pAK12. The E. coli strain HMS174 plysS (Novagen; STUDIER et al. 1990 Down) was transformed with pAK12. GNA-3 expression was induced using 1 mM isopropyl thiogalactoside, inclusion bodies containing insoluble GNA-3 were isolated, and GNA-3 protein was further purified using preparative SDS-PAGE essentially as previously described for GNA-1 (IVEY et al. 1996 Down). GNA-3 protein was used as an antigen for production of a specific antiserum in rabbits (Cocalico Biologicals, Reamstown, PA).

For Western analysis, submerged VM cultures were inoculated using 3 x 106 conidia/ml and incubated for 16 hr in the dark at 30° with shaking at 200 rpm. Plasma membranes were isolated from at least two independent cultures for each strain as previously described (IVEY et al. 1996 Down). Protein was quantitated using the Bradford reagent (Bio-Rad, Hercules, CA). Samples containing 30 µg of protein were resolved by SDS-PAGE and either Coomassie stained (as a check for equal protein loading; KAYS et al. 2000 Down) or transferred to polyvinylidene fluoride or nitrocellulose membranes (for Western analysis; IVEY et al. 1996 Down). In all cases, the Coomassie-staining results showed that samples contained equivalent amounts of total protein (data not shown). For Western analysis, the membranes were treated with primary antibodies for GNA-1, GNA-2, and GNB-1 at a dilution of 1:5000, while GNA-3 antisera was used at a dilution of 1:500 (IVEY et al. 1996 Down; BAASIRI et al. 1997 Down; YANG et al. 2002 Down). The secondary antibody was a goat anti-rabbit IgG horseradish peroxidase conjugate used at 1:10,000 dilution (Bio-Rad). Enhanced chemiluminescence (Amersham-Pharmacia Biotech, Little Chalfont, UK) was used for detection (KAYS et al. 2000 Down).

For Northern analysis, cultures were inoculated using 5 x 105 conidia/ml into VM liquid medium plus or minus peptone and grown for 16 hr in the dark at 30° with shaking at 200 rpm (KAYS et al. 2000 Down). RNA extraction, Northern analysis, and preparation of con-10 and rRNA probes were as previously described (KAYS et al. 2000 Down).

Phenotypic analysis:
The centers of VM plates were inoculated using 1 µl of a conidial suspension, followed by incubation for 2 or 3 days under the indicated conditions. The sexual cycle was analyzed by culturing strains on SCM plates at room temperature in constant light for 6 days. Protoperithecia were fertilized with conidial suspensions from either 74A or 74a and resulting perithecia were photographed 6 days later. SCM and submerged cultures were viewed and photographed as previously described (IVEY et al. 1996 Down; KAYS et al. 2000 Down).

Measurement of adenylyl cyclase activity:
To assess adenylyl cyclase activity, cultures were inoculated with 3 x 106 conidia/ml and incubated at 30° for 16 hr at 200 rpm. Total membrane fractions were isolated and protein concentration was determined using the Bradford reagent (Bio-Rad), as previously described (KAYS et al. 2000 Down). Each reaction contained 200 µg protein and assays were conducted as previously described using Mg2+ATP or Mn2+ATP as the substrate (KAYS et al. 2000 Down). The relative specific activity (RSA) was calculated by dividing the Mg2+ATP activity (plus or minus GppNHp; Sigma) by the Mn2+ATP activity and multiplying by 100.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Construction of mutants lacking multiple G{alpha} subunits:
Previous studies of strains lacking a single G{alpha} gene demonstrated roles for GNA-1 and GNA-3 in growth, differentiation, and adenylyl cyclase regulation (IVEY et al. 1996 Down; KAYS et al. 2000 Down). Analysis of a {Delta}gna-1 {Delta}gna-2 double mutant ({Delta}1{Delta}2) suggested that GNA-1 and GNA-2 possess some overlapping functions in N. crassa (BAASIRI et al. 1997 Down). To further analyze possible coordinated and independent functions of these proteins, strains deleted for multiple G{alpha} subunits were constructed: a {Delta}gna-1 {Delta}gna-2 {Delta}gna-3 triple mutant ({Delta}1{Delta}2{Delta}3); a double mutant lacking two G{alpha} proteins previously shown to positively influence adenylyl cyclase activity, GNA-1 and GNA-3 ({Delta}1{Delta}3); and a strain deleted for gna-2 and gna-3 ({Delta}2{Delta}3) to elucidate possible relationships between these two G{alpha} subunits. The three mutants were isolated from the progeny of a sexual cross between the parental strains {Delta}gna-3 and {Delta}gna-1 {Delta}gna-2. Genotypes were determined using Southern analysis (IVEY et al. 1996 Down; BAASIRI et al. 1997 Down; KAYS et al. 2000 Down). Phenotypes of the resulting mutants were compared to individual G{alpha} mutants ({Delta}1, {Delta}2, or {Delta}3), {Delta}1{Delta}2, cr-1, and wild-type strains in subsequent experiments.

Deletion of the Gß subunit leads to post-transcriptional reduction in the levels of G{alpha} proteins in N. crassa and C. parasitica (KASAHARA et al. 2000 Down; YANG et al. 2002 Down), while mutation of individual G{alpha} genes does not greatly influence G protein subunit levels in N. crassa (IVEY et al. 1996 Down, IVEY et al. 1999 Down; BAASIRI et al. 1997 Down; KAYS et al. 2000 Down). To determine whether loss of multiple G{alpha} genes affects the levels of the remaining G proteins, Western analysis was performed for all G{alpha} and Gß proteins in N. crassa. GNA-1, GNA-2, and GNB-1 antisera have been previously characterized (IVEY et al. 1996 Down; BAASIRI et al. 1997 Down; YANG et al. 2002 Down). An antibody directed against GNA-3 was prepared using a protein antigen heterologously expressed in E. coli (see MATERIALS AND METHODS). No specific bands were observed when the preimmune serum was used in Western analysis (data not shown). A species corresponding to the GNA-3 protein was detected in samples containing the purified antigen or extracts from wild type, but not in {Delta}3 mutant preparations using the immune serum (Fig 1A). The antiserum recognized GNA-3, although nonspecific interactions with other proteins were also observed (Fig 1A).



View larger version (61K):
In this window
In a new window
Download PPT slide
 
Figure 1. Analysis of G protein levels. (A) GNA-3 antiserum testing. The ability of immune serum to recognize GNA-3 was determined by Western analysis using 30 µg of plasma membrane protein from wild-type (WT, 74A) and {Delta}gna-3 (31c2) strains or GNA-3 inclusion bodies, as indicated. (B) Western analysis of G proteins. Samples containing 30 µg of plasma membrane protein were subjected to Western analysis using GNA-1, GNA-2, GNA-3, or GNB-1 antisera, as indicated. The strains are wild type (WT, 74A), {Delta}gna-1 ({Delta}1, 3B10), {Delta}gna-2 ({Delta}2, 21c), {Delta}gna-3 ({Delta}3, 31c2), {Delta}gna-2; {Delta}gna-3 ({Delta}2{Delta}3, 2.3g), {Delta}gna-1; {Delta}gna-3 ({Delta}1{Delta}3, g1.3), {Delta}gna-1; {Delta}gna-2; {Delta}gna-3 ({Delta}1{Delta}2{Delta}3, noa), and cr-1.

As expected, no specific bands corresponding to GNA-1, GNA-2, or GNB-1 were detected in strains lacking the genes encoding these proteins (Fig 1B). GNA-1 and GNA-3 amounts were not affected in all strains carrying the wild-type gna-1 or gna-3 allele, respectively (Fig 1B). In contrast, GNA-2 levels in {Delta}1{Delta}3 mutants were decreased relative to wild type. Interestingly, GNB-1 amount was significantly reduced in the {Delta}1{Delta}2{Delta}3 mutant. Reduced GNB-1 expression is not observed in G{alpha} single mutants (IVEY et al. 1999 Down; KAYS et al. 2000 Down), suggesting that loss of multiple G{alpha} proteins negatively affects the levels of the Gß subunit in N. crassa.

Deletion of gna-1 and gna-3 severely incapacitates vegetative growth:
Vegetative growth in N. crassa is accomplished by the polar extension of basal hyphae that branch and fuse to form the body of the organism, the mycelium (for review, SPRINGER 1993 Down). In response to nutrient limitation and/or desiccation, aerial hyphae differentiate from the mycelium and give rise to conidiophores. Conidiophores terminally differentiate at the tips to yield multinucleated asexual spores, termed conidia. Deletion of gna-1 results in a 50% decrease in the apical extension rate of basal hyphae, and a further 20% reduction is observed in {Delta}1{Delta}2 mutants, although no obvious defects are observed upon loss of gna-2 alone (IVEY et al. 1996 Down; BAASIRI et al. 1997 Down; Fig 2A; data not shown). Growth rates of {Delta}3 strains are reduced only 20% relative to wild type (KAYS et al. 2000 Down; Fig 2A; data not shown). The {Delta}2{Delta}3 mutant consistently produced a smaller mycelial mat and initiated conidiation earlier than {Delta}3, producing a denser, more orange mycelium compared to the hyphal, lighter-pigmented perimeter (Fig 2A; data not shown). Thus, similar to the effect of deleting gna-2 in {Delta}1 strains (BAASIRI et al. 1997 Down), loss of gna-2 in a {Delta}3 background intensified {Delta}3 defects.



View larger version (89K):
In this window
In a new window
Download PPT slide
 
Figure 2. Colony growth and morphology on solid medium. (A) Growth on VM plates. Strains were cultured on VM plates under lights at room temperature for 2 days. Strains used are indicated in Fig 1B. (B) Insensitivity to exogenous cAMP. {Delta}gna-1; {Delta}gna-3 strain g1.3 was cultured on VM plates ±1 mM cAMP for 3 days at room temperature in constant light.

The {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 strains were identical in appearance and exhibited the greatest growth and developmental defects of all strains analyzed. Both mutants are severely restricted in apical extension, reaching a colony diameter of only 0.9 ± 0.1 cm after 3 days (Fig 2A; data not shown). These minute colonies generate very little aerial hyphae, and the aerial hyphae that are formed exhibit premature conidia production (Fig 2A; data not shown). The morphology of the {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 mutants is identical to that of the previously characterized {Delta}gna-1 cr-1 ({Delta}1cr-1) strains (IVEY et al. 2002 Down). Although the exact nature of the cr-1 mutation is not known, the cr-1 mutant lacks detectable levels of cAMP and adenylyl cyclase activity and does not produce the full-length CR-1 protein (TERENZI et al. 1976 Down; KAYS et al. 2000 Down). Compared to {Delta}1{Delta}2{Delta}3, {Delta}1{Delta}3, and {Delta}1cr-1 mutants, cr-1 strains yield a larger mycelial mat (Fig 2A). The faster growth rate of cr-1 mutants (which contain no cAMP) relative to these other strains provides evidence for a cAMP-independent component in regulation of apical extension by G{alpha} proteins.

Many vegetative defects of cr-1 and {Delta}3 single mutants can be suppressed by exogenous cAMP (TERENZI et al. 1976 Down; KAYS et al. 2000 Down). The response of cr-1 strains to cAMP is abolished upon loss of gna-1 (IVEY et al. 2002 Down). To determine whether GNA-1 has a general role in the response to cAMP treatment, plate cultures of the {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 mutants were assessed for suppression of morphological defects by cAMP. The {Delta}1{Delta}3 and {Delta}1{Delta}2{Delta}3 mutant strains did not respond to cAMP supplementation (Fig 2B; data not shown). Therefore, similar to results with cr-1, loss of gna-1 in the {Delta}3 background blocked the response to exogenous cAMP.

GNA-1 and GNA-3 play different roles during the sexual cycle:
In response to nitrogen starvation, N. crassa initiates the sexual cycle by forming multicellular female reproductive structures, or protoperithecia (for review, see RAJU 1992 Down). Fertilization is accomplished by chemotropic growth of a specialized hypha (trichogyne) from the protoperithecium toward a conidium or other vegetative cell (the male) of opposite mating type. Sexual spores (ascospores) develop within the fertilized protoperithecium (perithecium) and, when mature, are forcefully ejected through a beak at the tip of the perithecium.

Mutation of individual G{alpha} genes does not greatly affect male fertility in N. crassa (IVEY et al. 1996 Down; BAASIRI et al. 1997 Down; KAYS et al. 2000 Down). GNA-1 and, in a minor capacity, GNA-2 (IVEY et al. 1996 Down; BAASIRI et al. 1997 Down) are hypothesized to function in the response of protoperithecia to pheromone (KAYS et al. 2000 Down), as {Delta}1 mutants produce aberrant perithecia that only rarely contain ascospores, and loss of gna-2 further exacerbates this defect (IVEY et al. 1996 Down). {Delta}3 mutants are impaired only during homozygous crosses, with production of some submerged perithecia and few viable ascospores (KAYS et al. 2000 Down).

A role for GNA-2 in female fertility was uncovered only by analysis of mating in {Delta}1{Delta}2 double mutants. To discern new or redundant roles for the three G{alpha} subunits in sexual fertility, we assessed the ability of {Delta}1{Delta}3, {Delta}2{Delta}3, and {Delta}1{Delta}2{Delta}3 mutant strains to function as males or females during crosses with a wild-type strain. Single G{alpha} mutants and wild type were included as controls. In accordance with previous results, all strains were fertile when used as males during the sexual cycle (data not shown). Differentiation of protoperithecia was observed in all strains, although the numbers were reduced in {Delta}1{Delta}3 and {Delta}1{Delta}2{Delta}3 mutants (data not shown).

Perithecial formation was affected by the loss of gna-1 or gna-3. Examination of fertilized cultures demonstrated that all strains that carry the {Delta}1 mutation are female sterile and produce aberrant perithecia (Fig 3). The numbers and appearance of these aberrant perithecia were reduced in {Delta}1{Delta}3 and {Delta}1{Delta}2{Delta}3 strains when compared to {Delta}1 single mutants (Fig 3), and, similar to {Delta}1 and {Delta}1{Delta}2 strains (BAASIRI et al. 1997 Down), no ascospores were produced (data not shown). As previously observed for {Delta}3 mutants in homozygous crosses (KAYS et al. 2000 Down), a number of normal-appearing perithecia in {Delta}2{Delta}3 strains, as well as some of the aberrant perithecia from {Delta}1{Delta}3 and {Delta}1{Delta}2{Delta}3 mutants, are embedded in the agar (Fig 3; data not shown). Thus, mutation of gna-1 or gna-2 in addition to gna-3 leads to production of submerged perithecia after fertilization with a wild-type male; such a phenotype is observed only for {Delta}3 single mutants during homozygous crosses with a {Delta}3 male. The prevalence of submerged perithecia in all crosses involving a female parent lacking gna-3 and at least one other G{alpha} gene further supports a role for GNA-3 in perithecial orientation, a function that is critical for the efficient ejection of ascospores. The loss of gna-1 or gna-3 disrupts mating at different points in the sexual cycle. GNA-1 is required for early events during cell type recognition between male and female cells, while GNA-3 functions later in development, facilitating orientation of perithecia and efficient ascospore production. Therefore, similar to other filamentous fungi, different G{alpha} proteins regulate distinct aspects of the sexual cycle in N. crassa.



View larger version (89K):
In this window
In a new window
Download PPT slide
 
Figure 3. Female fertility. Protoperithecia of the indicated strains were fertilized with the opposite mating-type wild-type strain (74A or 74a) and photographed 6 days later. Open arrows indicate aberrant (in strains carrying the {Delta}gna-1 mutation) perithecia and solid arrows indicate normal (all other strains) perithecia. The strains are wild type (WT, 74A), {Delta}gna-1 (3B10), {Delta}gna-2 (21c), {Delta}gna-3 (43c2), {Delta}gna-2; {Delta}gna-3 (2.3g), {Delta}gna-1; {Delta}gna-3 (g1.3), and {Delta}gna-1; {Delta}gna-2; {Delta}gna-3 (noa).

Submerged culture conidiation of {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 strains is only partially suppressed by peptone:
N. crassa maintains hyphal development during growth in submerged cultures unless subjected to a stress, such as heat shock, or carbon or nitrogen limitation (CORTAT and TURIAN 1974 Down; GUIGNARD et al. 1974 Down; THAT and TURIAN 1978 Down; PLESOFSKY-VIG et al. 1983 Down; MADI et al. 1997 Down). Mutation of gna-3, cr-1, or the putative glucose sensor rco-3 results in submerged conidiation; {Delta}gna-1 mutants also differentiate conidiophores, but only when inoculated at high cell density (MADI et al. 1997 Down; KAYS et al. 2000 Down; IVEY et al. 2002 Down). To decipher the roles for G{alpha} subunits and cAMP levels in regulation of submerged conidiation, {Delta}1{Delta}2{Delta}3, {Delta}1{Delta}3, {Delta}2{Delta}3, single G{alpha} mutant, and cr-1 strains were observed for submerged culture conidiation.

Wild-type, {Delta}1, and {Delta}2 strains did not produce conidiophores or conidia in submerged cultures, maintaining undifferentiated hyphal growth (Fig 4A). As previously observed, more conidiophores are visible in {Delta}3 than in cr-1 strains. Deletion of gna-2 in a {Delta}3 genetic background results in increased submerged culture conidiation (Fig 4A). The highest amounts of conidiophores and free conidia were observed in {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 strains (Fig 4A), consistent with gna-1 and gna-3 lending the greatest contributions to inhibition of submerged culture conidiation. The observation that {Delta}1{Delta}2{Delta}3, {Delta}1{Delta}3, and {Delta}3 strains conidiate to a greater extent than the cr-1 mutant suggests that although GNA-1 and GNA-3 both regulate cAMP metabolism, their contributions to conidiation are not strictly cAMP dependent.




View larger version (168K):
In this window
In a new window
Download PPT slide
 
Figure 4. Submerged culture conidiation. Strains are as in Fig 1B, and genotypes are indicated on the figure. Cultures were inoculated using 5 x 105 cells/ml and incubated for 16 hr in liquid VM (A) or liquid VM supplemented with 2% w/v peptone (C) at 30° with shaking before being photographed. For B and D, transcript levels of con-10 were analyzed in 15-µg samples of total RNA isolated from VM (B) or VM plus peptone (D) cultures by Northern analysis using con-10 as a probe. An rRNA gene probe is used as a loading control.

Conidiation in submerged cultures is correlated with inappropriate expression of the conidiation-specific gene con-10 (MADI et al. 1997 Down; KAYS et al. 2000 Down). Therefore, submerged cultures of strains carrying G{alpha} mutations were characterized for con-10 levels. The morphological observations correlated with con-10 transcript amount, in that the highest levels of con-10 mRNA were observed in {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 strains (Fig 4B). con-10 mRNA was also more abundant in {Delta}2{Delta}3 as compared to {Delta}3 mutants, and the lowest levels of con-10 were observed in cr-1 strains. Consistent with microscopic analysis, no con-10 message was detected in wild-type, {Delta}1, or {Delta}2 cultures.

Supplementation of cultures with the rich nutrient peptone has been previously shown to suppress submerged culture conidiation in rco-3, cr-1, and gna-3 mutants (MADI et al. 1997 Down; KAYS et al. 2000 Down). Addition of peptone caused hyphal swelling in wild-type, {Delta}1, and {Delta}2 strains, as previously observed (Fig 5A). Peptone completely suppressed conidiation, produced swollen hyphae, and abolished transcription of con-10 in cr-1, {Delta}3, and {Delta}2{Delta}3 strains (Fig 4C and Fig D). Conidiation was significantly reduced in {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 mutants; however, conidiophores and con-10 mRNA were still readily detected (Fig 4C and Fig D). Thus, con-10 mRNA levels are consistent with the observed phenotypes. The incomplete suppression of conidiation in {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 mutants suggests that a full response to peptone requires GNA-1 or GNA-3. Alternatively, peptone may act through an independent mechanism that cannot reverse the severe conidiation defect in these strains.



View larger version (105K):
In this window
In a new window
Download PPT slide
 
Figure 5. Analysis of epistasis with mcb. Colony morphology on inositol-supplemented VM plates was analyzed for inl, {Delta}gna-1; inl (ig1A10), {Delta}gna-3; inl (ig3B1), mcb inl, {Delta}gna-1; mcb inl (mc1B4), and {Delta}gna-3; mcb inl (mc3-2) strains. Strains were cultured for 2 days at 37° in darkness before being photographed.

GNA-1 and GNA-3 differentially affect adenylyl cyclase:
Adenylyl cyclase, which converts ATP to cAMP and pyrophosphate, can utilize two different substrates, Mg2+ATP and Mn2+ATP (GILMAN 1987 Down). To utilize Mg2+ATP as a substrate, the enzyme requires the presence of a GTP-binding protein (ROSS et al. 1978 Down; ROSS and GILMAN 1980 Down; GILMAN 1987 Down). In contrast, assays using Mn2+ATP as a substrate allow measurement of the amount of total active adenylyl cyclase present, as the enzyme is able to utilize this substrate in the absence of a G protein.

GNA-1 and GNA-3 have been shown to independently regulate adenylyl cyclase activity in submerged cultures of N. crassa (IVEY et al. 1999 Down; KAYS et al. 2000 Down). An 85–89% reduction in basal and GTP-stimulated Mg2+ATP adenylyl cyclase activity is displayed in {Delta}1 strains, while Mn2+ATP activity is reduced only ~40% (IVEY et al. 1999 Down). In contrast, deletion of gna-3 results in an ~70% reduction of both Mg2+ATP and Mn2+ATP activities due to decreased levels of adenylyl cyclase protein; the remaining enzyme is regulated normally by GTP (KAYS et al. 2000 Down).

To determine the contributions of multiple G{alpha} proteins to the regulation of adenylyl cyclase, activity was measured in submerged cultures from {Delta}1{Delta}2{Delta}3, {Delta}1{Delta}3, and {Delta}2{Delta}3 strains. Relative to wild type, deletion of gna-2 in the {Delta}3 genetic background resulted in a 30.1 and 57.3% decrease in Mg2+ATP activity under basal and GTP-stimulated conditions, respectively, and a 42% decrease in fold stimulation (Table 2). Mn2+ATP activity of {Delta}2{Delta}3 mutants was reduced only 32.3%, compared to the 69.0% previously observed for {Delta}3 strains (KAYS et al. 2000 Down). The increased amount of Mn2+ATP activity in {Delta}2{Delta}3 relative to {Delta}3 strains suggests that loss of gna-2 partially compensates for the reduced Mn2+ATP activity in {Delta}3 mutants. The basal RSA of the {Delta}2{Delta}3 strain was similar to wild type, but the GTP-stimulated RSA was reduced 38.1%. The decreased basal RSA of {Delta}2{Delta}3 strains resulted from lower levels of adenylyl cyclase, as indicated by the 32.3% reduction in Mn2+ATP activity relative to wild type. The reduction in GTP-stimulated RSA was not previously observed in {Delta}3 single mutants (KAYS et al. 2000 Down), suggesting that loss of gna-2 is responsible for this defect. Thus, analysis of strains lacking gna-2 and gna-3 has provided evidence that GNA-2 does play a role in adenylyl cyclase regulation in N. crassa.


 
View this table:
In this window
In a new window

 
Table 2. Adenylyl cyclase activity

Consistent with phenotypic observations, adenylyl cyclase activity in the {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 strains was similar (Table 2). Both mutants were reduced 64.6% in Mn2+ATP activity relative to wild type. This is comparable to the decrease in Mn2+ATP activity observed in {Delta}3 strains (69.0%; KAYS et al. 2000 Down). A 55 and 98% decrease in basal and GTP-stimulated Mg2+ATP activity, respectively, was observed in {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 strains. Little or no GTP-dependent stimulation of adenylyl cyclase and a decreased GTP-stimulated RSA is detected in cells deleted for both gna-1 and gna-3. This is consistent with previous results obtained for {Delta}1 single mutants (IVEY et al. 1999 Down). Thus, the effects of mutating gna-1 and gna-3 are additive with respect to adenylyl cyclase activity and protein amount. Loss of gna-2 does not appreciably affect adenylyl cyclase activity or amount in a {Delta}1{Delta}3 background.

Epistatic relationships between mcb, gna-1, and gna-3:
cAMP regulates signaling by binding to the regulatory subunit of PKA, which then dissociates from the catalytic subunit, facilitating activation of its kinase activity (BEAVO 1995 Down). The N. crassa regulatory subunit of PKA is encoded by the mcb gene (BRUNO et al. 1996 Down). The corresponding temperature-sensitive mutant exhibits defective hyphal growth polarity at the restrictive temperature, leading to cell lysis and the inability to form a colony (BRUNO et al. 1996 Down). The mcb mutation is recessive to wild type and the cr-1 mutation is epistatic to mcb (BRUNO et al. 1996 Down). These observations suggest that the mcb lesion results in a reduced amount of MCB protein, leading to hyperactivation of the PKA catalytic subunit and cell lysis at 37° in a cell containing adequate cAMP. Loss of adenylyl cyclase reverses the effect of the mcb mutation, as the residual MCB regulatory subunit cannot dissociate from the catalytic subunit in the absence of cAMP.

Steady-state cAMP levels are reduced in plate cultures of {Delta}1 and {Delta}3 mutants and in submerged cultures of {Delta}3 strains, and GNA-1 and GNA-3 positively modulate adenylyl cyclase activity in submerged cultures (IVEY et al. 1999 Down; KAYS et al. 2000 Down). This knowledge, coupled with the observation that cr-1 is epistatic to mcb (BRUNO et al. 1996 Down), suggested that gna-1 and/or gna-3 may be epistatic to mcb. To determine epistatic relationships between mcb, gna-1, and gna-3, {Delta}gna-1; mcb ({Delta}1mcb) and {Delta}gna-3; mcb ({Delta}3mcb) strains were constructed using sexual crosses (see MATERIALS AND METHODS).

Vegetative growth of {Delta}1mcb and {Delta}3mcb strains was compared to the parental and control strains at the restrictive (37°) temperature. In accordance with previous results (BRUNO et al. 1996 Down), the mcb mutant does not form a colony at the restrictive temperature of 37° (Fig 5). Wild-type, {Delta}1, and {Delta}3 strains are able to form a colony under these conditions (Fig 5). The morphology of {Delta}1mcb strains is similar to that of wild type, suggesting that the mcb and {Delta}1 mutations suppress one another (Fig 5). In contrast, the morphology and colony diameter of {Delta}3mcb strains is identical to mcb, supporting mcb as epistatic to gna-3 (Fig 5). Taken together, these data indicate that gna-1 and gna-3 have different relationships with the regulatory subunit of PKA, although both genes positively influence cAMP metabolism in N. crassa.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

This is the first report investigating the consequences of deleting all heterotrimeric G{alpha} genes in a filamentous fungal species. Mutants of all three G{alpha} proteins are viable, but these strains, similar to {Delta}1{Delta}3, exhibit severely restricted apical growth, dense premature conidiation, extensive submerged culture conidiation, and female sterility. GNA-2 appears to play a largely compensatory role, in that effects due to loss of this G{alpha} are observed only upon simultaneous mutation of either gna-1 or gna-3. This compensation is limited to double mutants, in that there is no visible phenotypic difference between {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 strains. However, the similarity between {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 mutants may reflect the observation that GNA-2 protein levels are greatly reduced in {Delta}1{Delta}3 strains. GNB-1 protein levels are also diminished in {Delta}1{Delta}2{Delta}3 compared to {Delta}1{Delta}3 and wild-type strains. Since GNB-1 has previously been shown to regulate the levels of G{alpha} proteins, a complementary mechanism may negatively affect GNB-1 levels in the complete absence of tethering G{alpha} proteins (YANG et al. 2002 Down).

A model for the action of G proteins in N. crassa that summarizes our experimental findings is shown in Fig 6. The results further support the hypothesis that N. crassa G{alpha} subunits differentially regulate the sexual cycle, in a cAMP-independent manner (IVEY et al. 1996 Down; KAYS et al. 2000 Down). Studies of mating in N. crassa have shown that diffusible pheromone factors are exchanged between cells of opposite mating type (BISTIS 1981 Down, BISTIS 1983 Down). The two pheromone genes, similar to Saccharomyces cerevisiae {alpha}- and a-factor (for review, see DOHLMAN and THORNER 2001 Down), have recently been identified and their mating-type-specific expression patterns have been determined (BOBROWICZ et al. 2002 Down; KIM et al. 2002 Down). Mutational analysis of the N. crassa a-factor-like pheromone gene (mfa-1) has demonstrated its requirement for male, but not female fertility (KIM et al. 2002 Down). In contrast, N. crassa strains lacking the NRC-1 MAPK kinase kinase (MAPKKK), similar to MAPKKKs required for mating in other ascomycetes (for review, see LENGELER et al. 2000 Down), are male fertile, but female sterile (KOTHE and FREE 1998 Down). This last result, in combination with the female sterility of {Delta}gna-1 mutants, suggests that transduction of the initiating pheromone signal to the MAPK cascade by GNA-1 is essential for female fertility, but dispensable in males. In a model that explains these results, males do not require a pheromone response pathway and need only to secrete the appropriate pheromone to direct chemotropic growth of the opposite mating-type female trichogyne. Conversely, an intact pheromone response pathway, but not pheromone production, is necessary for females to track the pheromone signal emitted by the male cell. This contrasts with mating in the yeasts S. cerevisiae and Schizsaccharomyces pombe, where any two cells of opposite mating type can mate in the proper nutritional environment (LENGELER et al. 2000 Down). N. crassa has evolved beyond mating type, apparently imposing distinct requirements for pheromone production and possession of an intact pheromone response pathway on males and females during mating.



View larger version (81K):
In this window
In a new window
Download PPT slide
 
Figure 6. A model for G{alpha} signaling in N. crassa. GNA-1 (and, in a minor capacity, GNA-2) regulates female fertility, possibly through modulation of a pheromone response MAPK cascade including the NRC-1 MAPKKK. GNA-1 and NRC-1 also regulate conidiation, possibly as components of the same pathway. GNA-3 (and GNA-2) modulates perithecial orientation and ascospore viability via a cAMP-independent mechanism. GNA-1 may act as a direct regulator of adenylyl cyclase activity, while GNA-3 affects this enzyme indirectly through modulation of adenylyl cyclase protein levels. cAMP influences apical extension, conidiation, and stress resistance. GNA-2 plays a minor role in regulation of adenylyl cyclase activity in a {Delta}gna-3 background. The functions of the Gß (GNB-1)-G{gamma} dimer are difficult to define, as loss of gnb-1 leads to lower levels of G{alpha} subunits under various conditions. However, by analogy to other fungal systems, Gß{gamma} may regulate MAPK signaling pathways, such as that containing NRC-1.

N. crassa {Delta}1 and {Delta}3 mutants inappropriately conidiate in submerged culture, and the defect of {Delta}1{Delta}3 mutants cannot be completely corrected by peptone supplementation. Conidiation occurs only at high cell density in {Delta}1 strains, suggesting that GNA-1 may function in monitoring the cell density and/or nutritional status of the cell (IVEY et al. 2002 Down). The observation that conidiophores are detected in cr-1 strains (but to a much lower extent than in gna-3 mutants; KAYS et al. 2000 Down) is consistent with inhibition of submerged conidiation by PKA. Work with the nrc-1 mutant suggests that this MAPKKK represses submerged culture conidiation, in addition to regulating female fertility (KOTHE and FREE 1998 Down). Therefore, maintenance of hyphal growth in submerged cultures may be coordinated by PKA and a MAPK cascade containing NRC-1.

Supplementation of plate cultures with cAMP corrects many phenotypes of {Delta}3 and cr-1 strains (TERENZI et al. 1976 Down; KAYS et al. 2000 Down). Deletion of gna-1 in the cr-1 or {Delta}3 backgrounds inhibits the response to exogenous cAMP (IVEY et al. 2002 Down); this study). Analysis of cAMP levels in the medium of submerged cultures demonstrated that the amount increases over time, reaching 12.6 nM after 30 hr of incubation (IVEY et al. 1999 Down). Taken together, these studies suggest that N. crassa secretes cAMP and that GNA-1 is necessary for the response to extracellular cAMP.

The phenotypes of {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}2 strains are identical to those of the {Delta}1cr-1 mutant, which has been shown to contain no adenylyl cyclase activity and, presumably, no PKA activity (IVEY et al. 2002 Down). Analysis of the PKA regulatory subunit mutation, mcb, suggests that this lesion results in lower levels of regulatory subunit protein (BRUNO et al. 1996 Down). Introduction of the mcb mutation into the {Delta}3 background resulted in the mcb phenotype, consistent with a model in which MCB operates downstream of GNA-3 during cAMP signaling. This result also suggests that cAMP levels in {Delta}3 strains are not low enough to compensate for the presumed reduction in MCB protein amount resulting from the mcb mutation. The morphology of {Delta}1mcb mutants was similar to wild type at 37°. This observation can be explained by at least two scenarios. GNA-1 may regulate a cAMP-independent pathway paralleling that involving MCB, perhaps containing NRC-1. Alternatively, GNA-1 may generate a cAMP pulse at a defined time during growth and development on solid medium. Levels of cAMP would drop to zero at this point in {Delta}1 strains, and, similar to observations with the cr-1 mutation, this would override the effects of mcb.

No GTP-dependent stimulation of adenylyl cyclase activity can be detected in {Delta}1{Delta}2{Delta}3 and {Delta}1{Delta}3 mutants, similar to results obtained for {Delta}1 single mutants (IVEY et al. 1999 Down). The {Delta}3, {Delta}1{Delta}3, and {Delta}1{Delta}2{Delta}3 mutants have a comparable decrease in active adenylyl cyclase enzyme, indicating that the major function of GNA-3 in cAMP metabolism is regulation of adenylyl cyclase protein levels. There is no evidence that the sole Gß protein, GNB-1, directly regulates adenylyl cyclase in N. crassa (IVEY et al. 1999 Down; YANG et al. 2002 Down). In fact, the observed defects in adenylyl cyclase regulation and cAMP amount in {Delta}gnb-1 mutants likely result from reduced levels of G{alpha} proteins (YANG et al. 2002 Down).

The additive effect of mutating multiple G{alpha} proteins on growth, development, and adenylyl cyclase activity in N. crassa can be contrasted to results from S. cerevisiae and S. pombe (KUBLER et al. 1997 Down; WELTON and HOFFMAN 2000 Down). In S. cerevisiae, loss of the gna-3-related G{alpha} gpa2 and the ras2 gene results in an increased filamentation defect compared to the single mutants alone and reduced intracellular cAMP levels (as detected by iodine staining of intracellular glycogen; KUBLER et al. 1997 Down). In S. pombe, Gpa2 (similar to N. crassa GNA-3) and Git5 (a Gß protein) are necessary for activation of adenylyl cyclase; however, Git5 is not thought to function in direct stimulation of the enzyme and, instead, appears to facilitate coupling of Gpa2 to the receptor (WELTON and HOFFMAN 2000 Down). There is currently no evidence that the second G{alpha} protein gene in yeasts (S. cerevisiae GPA1 and S. pombe gpa1) influences intracellular cAMP levels or adenylyl cyclase activity (MIYAJIMA et al. 1987 Down; OBARA et al. 1991 Down).

The work here demonstrates that the simultaneous loss of GNA-1 and GNA-3 has profound consequences for N. crassa biology. These two proteins control many aspects of growth and differentiation using relatively independent mechanisms. Results from analysis of adenylyl cyclase activity and epistasis with mcb support the hypothesis that G{alpha} proteins regulate growth and development through cAMP-dependent and -independent pathways. Although cAMP has been shown to facilitate growth and development in other filamentous fungi, only one heterotrimeric G{alpha} protein has been demonstrated to modulate cAMP levels in these systems (for review, see LENGELER et al. 2000 Down). Analysis of mutants lacking two or more G{alpha} genes in these related species will reveal whether regulation of adenylyl cyclase by multiple G{alpha} subunits is a general paradigm in filamentous fungi.


*  FOOTNOTES

1 Present address: Whitehead Institute for Biomedical Research, Cambridge, MA 02142. Back


*  ACKNOWLEDGMENTS

We thank Christopher Crew for assistance with Southern and phenotypic analysis of mcb strains. We acknowledge Michael Plamann, Deborah Bell-Pedersen, and Daniel Ebbole for communicating results prior to publication, and Dale Hereld, Carmen Dessauer, George Weinstock, Stevan Marcus, Kevin Morano, Jennifer Bieszke, Svetlana Krystofova, Douglas Ivey, and Qi Yang for many helpful discussions. This work was supported by Public Health Service grant GM-48626 from the National Institutes of Health (to K.A.B.).

Manuscript received June 13, 2003; Accepted for publication September 28, 2003.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BAASIRI, R. A., X. LU, P. S. ROWLEY, G. E. TURNER, and K. A. B