- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Skibbens, R. V.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Skibbens, R. V.
Chl1p, a DNA Helicase-Like Protein in Budding Yeast, Functions in Sister-Chromatid Cohesion
Robert V. Skibbensaa Department of Biological Sciences, Lehigh University, Bethlehem, Pennsylvania 18015
Corresponding author: Robert V. Skibbens, Lehigh University, 111 Research Dr., Bethlehem, PA 18015., rvs3{at}lehigh.edu (E-mail)
Communicating editor: B. J. ANDREWS
| ABSTRACT |
|---|
From the time of DNA replication until anaphase onset, sister chromatids remain tightly paired along their length. Ctf7p/Eco1p is essential to establish sister-chromatid pairing during S-phase and associates with DNA replication components. DNA helicases precede the DNA replication fork and thus will first encounter chromatin sites destined for cohesion. In this study, I provide the first evidence that a DNA helicase is required for proper sister-chromatid cohesion. Characterizations of chl1 mutant cells reveal that CHL1 interacts genetically with both CTF7/ECO1 and CTF18/CHL12, two genes that function in sister-chromatid cohesion. Consistent with genetic interactions, Chl1p physically associates with Ctf7p/Eco1p both in vivo and in vitro. Finally, a functional assay reveals that Chl1p is critical for sister-chromatid cohesion. Within the budding yeast genome, Chl1p exhibits the highest degree of sequence similarity to human CHL1 isoforms and BACH1. Previous studies revealed that human CHLR1 exhibits DNA helicase-like activities and that BACH1 is a helicase-like protein that associates with the tumor suppressor BRCA1 to maintain genome integrity. Our findings document a novel role for Chl1p in sister-chromatid cohesion and provide new insights into the possible mechanisms through which DNA helicases may contribute to cancer progression when mutated.
PROPER transmission of the parental genome requires that chromosomes are first replicated and that the resulting sister chromatids are faithfully segregated away from each other into the newly forming daughter cells. From the time of chromosome replication until chromosome segregation, sister chromatids are paired together. This pairing, or sister-chromatid cohesion, enables the cell to identify over time the products of DNA replication as sisters. In addition, cohesion ensures that one chromatid associates with microtubules from the spindle pole opposite that of its sister chromatid. Only at anaphase onset is cohesion inactivated, allowing one chromatid to move away from its sister along the mitotic spindle apparatus (![]()
![]()
In budding yeast, several classes of cohesion factors have been identified. Structural cohesion proteins (cohesins) maintain sister-chromatid cohesion from DNA replication until anaphase onset. Structural cohesins include Smc1p, Smc3p, Mcd1p/Scc1p, Irr1p/Scc3p, and Pds5p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Presently, the establishment of cohesion is poorly understood. Certainly, loss of cohesion establishment factors such as Ctf7p/Eco1p (herein termed Ctf7p) leads to precocious sister-chromatid separation and cell death. However, Ctf7p is not required to maintain cohesion nor deposit cohesins onto DNA. Instead, budding yeast Ctf7p appears to establish cohesion in part by coupling the cohesion machinery to DNA replication by directly interacting with the replication machinery. The finding that Ctf7p is an acetyltransferase provided an important clue and suggested a model in which cohesion establishment occurs by chromatin remodeling near the DNA replication fork (![]()
![]()
![]()
Similar to CTF7, budding yeast CHL1 was also identified by virtue of decreased chromosome transmission fidelity or chromosome loss screens. Mutations in CHL1 result in increased chromosome loss, sister-chromatid nondisjunction, and a variety of phenotypes, including bisexual mating of diploids, donor locus selection defects in MATa cells, and increased mitotic recombination (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Media and cell growth and database methods:
Growth and sporulation media for yeast were described previously (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Budding yeast Ctf7p and Rad3p amino acid sequences and human BACH1 amino acid sequence were used to perform reciprocal BLAST searches (BLASTP, version 2.2.5) using default parameters (![]()
Molecular methods and epitope tagging:
A PCR strategy was used to generate yeast cells in which Chl1-13MYCp was the sole source of Chl1p function. Briefly, a 1.7-kb sequence encoding for the C-terminal CHL1 open reading frame was obtained using XhoI and BglII and cloned into pRS306-
XbaI digested with XhoI and BamHI. To ensure improper transcription of epitope-tagged CHL1 after integration, a frameshift was generated via ClaI digestion, fill in, and religation. PCR and oligos AAGAATTCTTCGTACGCTGCAGGTCGACGG and CATAAGAAATTCGCTTATTTAGAAGTGG were then used to generate a DNA fragment containing 13 MYC epitope coding sequences (![]()
XbaI-CHL13' region were digested with EcoRI and ligated together, placing the 13 MYC epitope in frame with the CHL1C terminus. The resulting plasmid was linearized with XbaI, residing within the CHL1 open reading frame, and integrated by transformation into YPH499 (![]()
Immunofluorescence and Western blot analyses:
Flow cytometry, Western blot analysis, and indirect immunofluorescence were performed as previously described (![]()
![]()
![]()
Co-immunoprecipitations:
Co-immunoprecipitations were performed as previously described with minor modifications (![]()
GST pull-downs:
Glutathione S-transferase (GST) pull-downs were performed as previously described with the following modifications (![]()
![]()
![]()
Cohesion assays:
Defects in cohesion were assessed in two chl1 null strains independently derived. In the first case, we used a strain in which HIS3 integration within the CHL1 open reading frame generated a chl1 disruption allele (![]()
![]()
![]()
![]()
![]()
|
|
|
|
|
| RESULTS |
|---|
CHL1 genetically interacts with CTF7 and CTF18:
The role of Ctf7p in establishing cohesion between sister chromatids during S-phase is now firmly established (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
A previous study revealed that alleles of CTF7 are synthetically lethal when combined with a null mutation of CTF18 (also called CHL12, which encodes for an RF-C homolog; ![]()
![]()
![]()
![]()
Alleles of CTF7 are also synthetically lethal when combined with alleles of POL30 (encodes for proliferating cell nuclear antigen, or PCNA; ![]()
![]()
Chl1p is a nuclear protein:
Previous cell fractionation studies suggested that Chl1p is a nuclear protein (![]()
![]()
![]()
Chl1p physically associates with Ctf7p:
Often a genetic interaction reflects a physical association between two proteins. Given the conditional synthetic lethal interaction between CHL1 and CTF7 mutants, I tested for a physical association between Chl1p and Ctf7p in vivo using co-immunoprecipitation methods. Extracts from log-phase yeast cells containing Chl1-13MYCp as the sole source of Chl1p function were centrifuged and the supernatant fraction harvested. However, antibodies directed against either endogenous Ctf7p or epitope-tagged Ctf7p expressed at endogenous levels failed to detect Ctf7p, suggesting that Ctf7p occurs at extremely low levels in the cell. To circumvent this problem, a Ctf7-HAp construct that expresses Ctf7p at elevated levels was first transformed into tagged and untagged Chl1p strains. Ctf7-HAp is fully functional in that overexpressed Ctf7-HAp maintains viability of ctf7
cells at wild-type growth rates (![]()
To test whether Ctf7p co-immunoprecipitates with Chl1p, soluble Chl1-13MYCp-containing lysates were incubated with and without MYC-directed antibodies, followed by incubation with protein A Sepharose beads (MATERIALS AND METHODS). The beads were washed several times prior to eluting bound proteins. Western blot analyses reveal that Chl1p-13MYCp is immunoprecipitated in the presence of the MYC-directed antibody. I then probed Western blot membranes containing the immunoprecipitated fractions using HA-directed antibodies. The results show that Ctf7p co-immunoprecipitates with Chl1p (Fig 3). While overexposure reveals that a portion of Ctf7p also associates with beads in the absence of antibody, this quantity, if greatly reduced, compared to the amount of Ctf7p bound to Chl1p-antibody-bead complexes. As an additional control, I also tested for Ctf7p co-immunoprecipitation in the presence of MYC-directed antibodies and beads but using lysate produced from untagged and tagged Chl1p cells. Again, Ctf7p co-immunoprecipitated with Chl1p-13MYCp. Ctf7p also associated, but at reduced levels, with MYC antibody-Sepharose bead complexes (Fig 3). Thus, both the MYC antibody and MYC-tagged Chl1p were required for maximal Ctf7p co-immunoprecipitation. These findings reveal that Chl1p and Ctf7p physically associate in vivo, linking DNA helicase to cohesion establishment activities near the DNA replication fork.
I next used GST-based chromatography to test independently whether Chl1p and Ctf7p would associate in vitro and in the absence of in vivo assembly reactions. The entire CTF7 open reading frame was inserted, in frame, behind GST. Western blot analysis of Escherichia coli cells expressing this construct (GST-Ctf7p) identify a plasmid-dependent band of the appropriate molecular weight (![]()
![]()
Chl1p functions in sister-chromatid cohesion:
Given the physical association of Chl1p and Ctf7p, a likely model was that Chl1p plays a key role in cohesion establishment. To test this model directly, two unique chl1 loss-of-function alleles (MATERIALS AND METHODS) were introduced into a cohesion assay strain (![]()
40 kb from the centromere of chromosome V. Expression of green fluorescent protein (GFP)-tagged Tet repressor protein (TetR-GFP) in turn allows for visualization of the centromere-proximal locus (![]()
![]()
To assay for cohesion defects, log-phase chl1 mutant and wild-type marker strains were placed in media supplemented with nocodazole to inhibit anaphase onset. After
2 hr growth at 30°, parallel cell samples were harvested and prepared to assess DNA content, cell morphology, Pds1p content, and disposition of sister-chromatid loci via GFP (see MATERIALS AND METHODS). As expected, both wild-type and chl1
cells treated with nocodazole were predominantly large budded and contained a 2C DNA content, indicative of a mitotic arrest (Fig 4). Cells that retained Pds1p staining that was coincident with DAPI staining, indicative of pre-anaphase cells, were then assessed for cohesion. When GFP-tagged loci were viewed by epifluorescent microscopy, wild-type cells were found to contain tightly paired sister chromatids such that few (12%) sisters were dissociated. In contrast, chl1
mutant cells contained a significant increase in the number of separated sisters (23%; Fig 5). This level of cohesion defect (23%) is similar to those exhibited by other nonessential cohesion factors (trf4 at 20%, ctf18 at 25%, ctf8 at 30%, and ctf18 at 35%; ![]()
![]()
![]()
strains exhibited similarly low levels (
02%) of separated sisters in G1 cells arrested using
-factor, indicating that the increase of cells harboring two GFP spots (sister loci) in mitotic chl1
mutant cells was not due to aneuploidy present early in the cell cycle. A similar role for Chl1p in sister-chromatid cohesion has been independently identified, confirming the results above (M. MAYER, I. POTS and P. HIETER, personal communication).
Budding yeast Chl1p exhibits the highest level of homology to human BACH1:
As previously described, budding yeast Chl1p exhibits significant sequence similarity to human CHL1 isoforms (![]()
![]()
![]()
![]()
![]()
|
To explore further the conservation of human BACH1 within the budding yeast genome, I performed a reciprocal computer-assisted search in which the human BACH1 sequence was used to identify yeast proteins. Consistent with the above findings, I found budding yeast Chl1p as the highest ranking yeast protein that exhibits significant sequence similarity to human BACH1 (P value of 3e-58). Following this best-fit homology of Chl1p is Rad3p, which exhibited a significant, but reduced, level of similarity (P value of 5e-43). Interestingly, the extensive sequence similarity exhibited between human BACH1 and yeast Chl1p occurs along the entire open reading frame. In contrast, an
200-amino-acid segment is absent in budding yeast Rad3p, which corresponds to human BACH1 residues 65263 (Fig 6). These missing Rad3p residues correspond to helicase domain IA and to a putative nuclear localization signal (![]()
| DISCUSSION |
|---|
Characterization of CHL1 mutant yeast strains reveals strong genetic interactions when combined with either CTF7 or CTF18 mutations. Ctf7p is an essential yeast protein that functions during S-phase to establish sister-chromatid cohesion (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In this report, I also provide direct evidence that Chl1p plays a role critical for sister-chromatid cohesion. The cohesion defect observed for chl1 mutants is similar in level to those exhibited by other nonessential factors (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Reciprocal database searches reveal that, of the entire budding yeast genome, yeast Chl1p exhibits the highest degree of sequence similarity to human BACH1. Interestingly, while the similarity between human BACH1 and human CHLR1 was noted, alignments were instead shown between BACH1 and yeast Rad3p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
I am indebted to Margaret A. Kenna and Geralyn Gilotti for their technical expertise throughout the course of this project. I thank D. Koshland and L. Cassimeris and Skibbens lab members Alex Brands and Meg Kenna and L. Antoniacci, B. Satish, and A. Bellows for their critical reading of the manuscript and for helpful suggestions. I also thank M. Mayer, I. Pot, and P. Hieter for sharing of information prior to publication and thank P. Hieter in whose lab this work was initiated. This study was supported by an award to R.V.S. from the National Science Foundation (MCB-0212323).
Manuscript received June 13, 2003; Accepted for publication September 12, 2003.
| LITERATURE CITED |
|---|
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.
AMANN, J., V. J. KIDD, and J. M. LAHTI, 1997 Characterization of putative human homologues of the yeast chromosome transmission fidelity gene, CHL1. J. Biol. Chem. 272:3823-3832.
ARIS, J. P. and G. BLOBEL, 1988 Identification and characterization of a yeast nucleolar protein that is similar to a rat liver nucleolar protein. J. Cell Biol. 107:17-31.
BAUER, G. A. and P. M. BURGERS, 1990 Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene. Nucleic Acids Res. 18:261-265.
BOCHAR, D. A., L. WANG, H. BENIYA, A. KINEV, and Y. XUE et al., 2000 BRCA1 is associated with human SWI/SNF-related complex: linking chromatin remodeling to breast cancer. Cell 102:257-265.[CrossRef][Medline]
BOGERD, A. M., J. A. HOFFMAN, D. C. AMBERG, G. R. FINK, and L. I. DAVIS, 1994 nup1 mutants exhibit pleiotropic defects in nuclear pore complex function. J. Cell Biol. 127:319-332.
BROSH, R. M. and V. A. BOHR, 2002 Roles of the Werner syndrome protein in pathways required for maintenance of genome stability. Exp. Gerontol. 37:491-506.[CrossRef][Medline]
CANTOR, S. B., D. W. BELL, S. GANESAN, E. M. KASS, and R. DRAPKIN et al., 2001 BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 105:149-160.[CrossRef][Medline]
CIOSK, R., M. SHIRAYAMA, A. SHEVCHENKO, T. TANAKA, and A. TOTH et al., 2000 Cohesin's binding to chromosomes depends on a separate complex consisting of Scc2 and Scc4. Mol. Cell 5:243-254.[CrossRef][Medline]
COHEN-FIX, O., J. M. PETERS, M. W. KIRSCHNER, and D. KOSHLAND, 1996 Anaphase initiation in Saccharomyces cerevisiae is controlled by the APC-dependent degradation of the anaphase inhibitor Pds1p. Genes Dev. 10:3081-3093.
DEMING, P. B., C. A. CISTULLI, H. ZHAO, P. R. GRAVES, and H. PIWNICA-WORMS et al., 2001 The human decatenation checkpoint. Proc. Natl. Acad. Sci. USA 98:12044-12049.
DOHENY, K. F., P. K. SORGER, A. A. HYMAN, S. TUGENDREICH, and F. SPENCER et al., 1993 Identification of essential components of the S. cerevisiae kinetochore. Cell 73:761-774.[CrossRef][Medline]
EDWARDS, S., C. M. LI, D. L. LEVY, J. BROWN, and P. M. SNOW et al., 2003 Saccharomyces cerevisiae DNA polymerase varepsilon and polymerase sigma interact physically and functionally, suggesting a role for polymerase varepsilon in sister chromatid cohesion. Mol. Cell. Biol. 23:2733-2748.
FURUYA, K., K. TAKAHASHI, and M. YANAGIDA, 1998 Faithful anaphase is ensured by Mis4, a sister chromatid cohesion molecule required in S phase and not destroyed in G1 phase. Genes Dev. 12:3408-3418.
GERRING, S. L., F. SPENCER, and P. HIETER, 1990 The CHL1 (CTF1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2/M. EMBO J. 9:4347-4358.[Medline]
GUACCI, V., D. KOSHLAND, and A. STRUNNIKOV, 1997 A direct link between sister chromatid cohesion and chromosome condensation revealed through the analysis of MCD1 in S. cerevisiae. Cell 91:47-57.[CrossRef][Medline]
HABER, J. E., 1974 Bisexual mating behavior in a diploid of Saccharomyces cerevisiae: evidence for genetically controlled non-random chromosome loss during vegetative growth. Genetics 78:843-858.
HANNA, J. S., E. S. KROLL, V. LUNDBLAD, and F. A. SPENCER, 2001 Saccharomyces cerevisiae CTF18 and CTF4 are required for sister chromatid cohesion. Mol. Cell. Biol. 21:3144-3158.
HARTMAN, T., K. STEAD, D. KOSHLAND, and V. GUACCI, 2000 Pds5p is an essential chromosomal protein required for both sister chromatid cohesion and condensation in Saccharomyces cerevisiae. J. Cell Biol. 151:613-626.
HIROTA, Y. and J. M. LAHTI, 2000 Characterization of the enzymatic activity of hChlR1, a novel human DNA helicase. Nucleic Acids Res. 28:917-924.
HOLLOWAY, S., 2000 CHL1 is a nuclear protein with an essential ATP binding site that exhibits a size-dependent effect on chromosome segregation. Nucleic Acids Res. 28:3056-3064.
ITO, H., Y. FUKUDA, K. MURATA, and A. KIMURA, 1983 Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168.
IVANOV, D., Y. T. KWAK, J. GUO, and R. B. GAYNOR, 2000 Domains in the SPT5 protein that modulate its transcriptional regulatory properties. Mol. Cell. Biol. 20:2970-2983.
IVANOV, D., A. SCHLEIFFER, F. EISENHABER, K. MECHTLER, and C. H. HAERING et al., 2002 Eco1 is a novel acetyltransferase that can acetylate proteins involved in cohesion. Curr. Biol. 12:323-328.[CrossRef][Medline]
KELMAN, Z., 1997 PCNA: structure, functions and interactions. Oncogene 14:629-640.[CrossRef][Medline]
KENNA, M. A. and R. V. SKIBBENS, 2003 Mechanical link between cohesion establishment and DNA replication: Ctf7p/Eco1p, a cohesion establishment factor, associates with three different replication factor C complexes. Mol. Cell. Biol. 23:2999-3007.
KERR, P. and A. ASHWORTH, 2001 New complexities for BRCA1 and BRCA2. Curr. Biol. 11:R668-R676.[CrossRef][Medline]
KOSHLAND, D. E. and V. GUACCI, 2000 Sister chromatid cohesion: the beginning of a long and beautiful relationship. Curr. Opin. Cell Biol. 12:297-301.[CrossRef][Medline]
KOUPRINA, N., E. KROLL, A. KIRILLOV, V. BANNIKOV, and V. ZAKHARYEV et al., 1994 CHL12, a gene essential for the fidelity of chromosome transmission in the yeast Saccharomyces cerevisiae. Genetics 138:1067-1079.[Abstract]
KRAUSE, S. A., M. L. LOUPART, S. VASS, S. SCHOENFELDER, and S. HARRISON et al., 2001 Loss of cell cycle checkpoint control in Drosophila Rfc4 mutants. Mol. Cell. Biol. 21:5156-5168.
KURLANDZKA, A., J. RYTKA, R. GROMADKA, and M. MURAWSKI, 1995 A new essential gene located on Saccharomyces cerevisiae chromosome IX. Yeast 11:885-890.[CrossRef][Medline]
LAMB, J. R., W. A. MICHAUD, R. S. SIKORSKI, and P. A. HIETER, 1994 Cdc16p, Cdc23p and Cdc27p form a complex for mitosis. EMBO J. 13:4321-4328.[Medline]
LI, R. and A. W. MURRAY, 1991 Feedback control of mitosis in budding yeast. Cell 66:519-531.[CrossRef][Medline]
LIRAS, P., J. MCCUSKER, S. MACIOLI, and J. E. HABER, 1978 Characterization of a mutation in yeast causing nonrandom chromosome loss during mitosis. Genetics 88:651-671.
LONGTINE, M. S., A. MCKENZIE, III, D. J. DEMARINI, N. G. SHAH, and A. WACH et al., 1998 Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14:953-961.[CrossRef][Medline]
MAYER, M. L., S. P. GYGI, R. AEBERSOLD, and P. HIETER, 2001 Identification of RFC (Ctf18p, Ctf8p, Dcc1p): an alternate RFC complex required for sister chromatid cohesion in S. cerevisiae. Mol. Cell 7:959-970.[CrossRef][Medline]
MICHAELIS, C., R. CIOSK, and K. NASMYTH, 1997 Cohesins: chromosomal proteins that prevent premature separation of sister chromatids. Cell 91:35-45.[CrossRef][Medline]
NASMYTH, K., J. M. PETERS, and F. UHLMANN, 2000 Splitting the chromosome: cutting the ties that bind sister chromatids. Science 288:1379-1385.
PANIZZA, S., T. TANAKA, A. HOCHWAGEN, F. EISENHABER, and K. NASMYTH, 2000 Pds5 cooperates with cohesin in maintaining sister chromatid cohesion. Curr. Biol. 10:1557-1564.[CrossRef][Medline]
ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SCHIESTL, R. H. and R. D. GIETZ, 1989 High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16:339-346.[CrossRef][Medline]
SCULLY, R., J. CHEN, R. L. OCHS, K. KEEGAN, and M. HOEKSTRA et al., 1997 Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell 90:425-435.[CrossRef][Medline]
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27.
SKIBBENS, R. V., 2000 Holding your own: establishing sister chromatid cohesion. Genome Res. 10:1664-1671.
SKIBBENS, R. V., L. B. CORSON, D. KOSHLAND, and P. HIETER, 1999 Ctf7p is essential for sister chromatid cohesion and links mitotic chromosome structure to the DNA replication machinery. Genes Dev. 13:307-319.
SPENCER, F., S. L. GERRING, C. CONNELLY, and P. HIETER, 1990 Mitotic chromosome transmission fidelity mutants in Saccharomyces cerevisiae. Genetics 124:237-249.[Abstract]
STRUNNIKOV, A. V., V. L. LARIONOV, and D. KOSHLAND, 1993 SMC1: an essential yeast gene encoding a putative head-rod-tail protein is required for nuclear division and defines a new ubiquitous protein family. J. Cell Biol. 123:1635-1648.
THOMPSON, L. H. and D. SCHILD, 2002 Recombinational DNA repair and human disease. Mutat. Res. 509:49-78.[Medline]
TOTH, A., R. CIOSK, F. UHLMANN, M. GALOVA, and A. SCHLEIFFER et al., 1999 Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA replication. Genes Dev. 13:320-333.
VENKITARAMAN, A. R., 2002 Cancer susceptibility and the functions of BRCA1 and BRCA2. Cell 108:171-182.[CrossRef][Medline]
WANG, Z., I. B. CASTANO, A. DE LAS PENAS, C. ADAMS, and M. F. CHRISTMAN, 2000 Pol kappa: a DNA polymerase required for sister chromatid cohesion. Science 289:774-779.
WEILER, K. S., L. SZETO, and J. R. BROACH, 1995 Mutations affecting donor preference during mating type interconversion in Saccharomyces cerevisiae.. Genetics 139:1495-1510.[Abstract]
This article has been cited by other articles:
![]() |
J.-M. Peters, A. Tedeschi, and J. Schmitz The cohesin complex and its roles in chromosome biology Genes & Dev., November 15, 2008; 22(22): 3089 - 3114. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Farina, J.-H. Shin, D.-H. Kim, V. P. Bermudez, Z. Kelman, Y.-S. Seo, and J. Hurwitz Studies with the Human Cohesin Establishment Factor, ChlR1: ASSOCIATION OF ChlR1 WITH Ctf18-RFC AND Fen1 J. Biol. Chem., July 25, 2008; 283(30): 20925 - 20936. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, K. Shin-ya, and R. M. Brosh Jr. FANCJ Helicase Defective in Fanconia Anemia and Breast Cancer Unwinds G-Quadruplex DNA To Defend Genomic Stability Mol. Cell. Biol., June 15, 2008; 28(12): 4116 - 4128. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Ansbach, C. Noguchi, I. W. Klansek, M. Heidlebaugh, T. M. Nakamura, and E. Noguchi RFCCtf18 and the Swi1-Swi3 Complex Function in Separate and Redundant Pathways Required for the Stabilization of Replication Forks to Facilitate Sister Chromatid Cohesion in Schizosaccharomyces pombe Mol. Biol. Cell, February 1, 2008; 19(2): 595 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |










