DNA Methylation in Placentas of Interspecies Mouse Hybrids

Corresponding author: Reinald H. Fundele, University of Uppsala, Norbyvägen 18A, S-75236, Sweden., reinald.fundele{at}ebc.uu.se (E-mail)

Communicating editor: C. KOZAK

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Interspecific hybridization in the genus Mus results in several hybrid dysgenesis effects, such as male sterility and X-linked placental dysplasia (IHPD). The genetic or molecular basis for the placental phenotypes is at present not clear. However, an extremely complex genetic system that has been hypothesized to be caused by major epigenetic changes on the X chromosome has been shown to be active. We have investigated DNA methylation of several single genes, Atrx, Esx1, Mecp2, Pem, Psx1, Vbp1, Pou3f4, and Cdx2, and, in addition, of LINE-1 and IAP repeat sequences, in placentas and tissues of fetal day 18 mouse interspecific hybrids. Our results show some tendency toward hypomethylation in the late gestation mouse placenta. However, no differential methylation was observed in hyper- and hypoplastic hybrid placentas when compared with normal-sized littermate placentas or intraspecific Mus musculus placentas of the same developmental stage. Thus, our results strongly suggest that generalized changes in methylation patterns do not occur in trophoblast cells of such hybrids.

IN mammals, interspecific hybridization leads to characteristic and consistent developmental defects (GRAY 1971 ). The most frequent and visible defects are sterility of male hybrids and abnormal growth. These defects are obvious. It is likely that other, less obvious, hybrid dysgenesis effects occur but are not normally observed. Notably, in the three mammalian groups, equids, murids, and peromyscids, in which placental development of interspecific hybrids was analyzed to date, placentation defects were observed (ROGERS and DAWSON 1970 ; ALLEN et al. 1993 ; ZECHNER et al. 1996 ).

Initially, the findings obtained in Mus hybrids (Mus musculus, M. spretus, and M. macedonicus) suggested the presence of an X-linked locus that, in synergy with several autosomal loci, causes interspecific hybrid placental dysplasia (IHPD; ZECHNER et al. 1996 ). However, a detailed study using congenic and subcongenic mouse lines that contained varying X chromosomal regions derived from M. spretus (MSP) did not lend strong support to this model. Instead, these results indicated that multiple loci on the X chromosome could act synergistically to generate IHPD or that the genetic complexity of IHPD could be caused by epigenetic modifications of chromosomal regions on the MSP X chromosome in the presence of M. musculus (MMU)-derived chromosomes (HEMBERGER et al. 1999B ). Profound epigenetic alterations had indeed been demonstrated for interspecific hybridization in marsupials. These comprised genome-wide demethylation of one parental genome, followed by retroelement amplification and chromosome remodeling (O'NEILL et al. 1998 ). Justifiably, it was argued that such epigenetic changes could contribute to hybrid dysgenesis effects and thus promote speciation. Indeed, changes in epigenetic mechanisms of gene control are thought to be important during evolution as they may cause widespread secondary effects (O'NEILL et al. 1998 ) and also because of the rapid evolutionary changes they may induce (SOLLARS et al. 2003 ). However, further studies that investigated genome-wide DNA methylation in adult interspecific hybrids between placental mammals from four different orders provided no evidence for changes on a level seen in marsupials (ROEMER et al. 1999 ; ROBINSON et al. 2000 ). Still, this finding does not exclude the possibility that methylation changes on a smaller scale, that is, specific for gene loci, chromosomes, tissues, and/or developmental stages, are involved in hybrid dysgenesis effects, including IHPD. In this context it is noteworthy that loss-of-imprinting (LOI) has been shown to occur in hybrids between Peromyscus species and that LOI of Peg3 is causally involved in placental dysplasia in these hybrids (VRANA et al. 1998 , VRANA et al. 2000 ). It has also been shown for the maternally expressed gene H19 that biallelic expression in Peromyscus polionotus x P. maniculatus hybrids is correlated and probably caused by reduced methylation of the paternal P. maniculatus allele (VRANA et al. 1998 ). Therefore, it is easily conceivable that aberrant methylation of loci on X chromosomes could be causally involved in IHPD.

To test this hypothesis, we have carried out a methylation study using HpaII and MspI restriction digests of DNA from tissues, including the placenta, of interspecific hybrid fetuses, followed by Southern blotting and hybridization with probes specific for X-linked genes and/or genes expressed in the placenta. These genes were Atrx, Esx1, Mecp2, Pem, Psx1, Vbp1, Pou3f4, and Cdx2. Of these, Atrx (GIBBONS et al. 1995 , GIBBONS et al. 2000 ), Esx1 (LI et al. 1997 ; LI and BEHRINGER 1998 ), Mecp2 (ADLER et al. 1995 ), Pem (LIN et al. 1994 ), Psx1 (CHUN et al. 1999 ), and Vbp1 (HEMBERGER et al. 1999A ) are expressed in the placenta and located on the X chromosome in regions exhibiting strong linkage to the IHPD phenotype (Fig 1). Pou3f4 maps to the X chromosome; however, it is expressed exclusively in the ear anlage and the pancreas (DE KOK et al. 1995 ). Although Cdx2 maps to chromosome 5, it is expressed in the placenta in the tissue layer, the spongiotrophoblast, that is most severely affected in the IHPD phenotype (BECK et al. 1995 ; CHAWENGSAKSOPHAK and BECK 1996 ). In addition, methylation status of LINE-1 and IAP repeats was assessed. LINE-1 repeats exhibit increased density on the X chromosome and a putative role for them in the X inactivation process has been discussed (BAILEY et al. 2000 ). The long terminal repeats of retrovirally derived IAP elements have been demonstrated to act as promoter sequences driving placenta-specific expression of genes in proximity to the insertion site (CHANG-YEH et al. 1991 , CHANG-YEH et al. 1993 ). X chromosomal localization combined with the function in placental development of the majority of these genes should allow us to detect whether placental dysplasia in IHPD was accompanied by widespread methylation changes on the X chromosome. In addition, targeted mutation of Esx1 causes a placental phenotype that is very similar to hyperplasia in IHPD (LI and BEHRINGER 1998 ). Specifically, overgrowth of the spongiotrophoblast and increased differentiation of spongiotrophoblast into glycogen cells are common features of both IHPD and Esx1 mutant placentas. Finally, with Mecp2 and Atrx, two genes that are involved in epigenetic control of gene expression were included in the analysis. MECP2 silences transcription by binding to symmetrically methylated DNA and then recruiting both the histone deacetylase and histone H3 methylation repressive machineries (JONES et al. 1998 ; NAN et al. 1998 ; FUKS et al. 2003 ). ATRX is a member of the SWI/SNF family of chromatin-remodeling proteins and has been shown to be involved in chromatin-mediated transcriptional control (MCDOWELL et al. 1999 ; GIBBONS et al. 2000 ).

View larger version (17K): In this window In a new window Download PPT slide   Figure 1. Localization of X chromosomal genes analyzed in this study and linkage of interspecific placental hyperplasia in the MSM backcross to the whole length of the X chromosome (HEMBERGER et al. 1999B ). All of these genes, including Esx1, map to chromosomal regions that exhibit significant linkage to IHPD.

However, methylation analysis of these genes provided no indication for demethylation in dysplastic IHPD placentas. Therefore, no support is provided for the hypothesis that overall loss of methylation of X chromosomal genes contributes to the placental phenotypes observed in interspecies hybrids in the genus Mus.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Mice:
For the generation of interspecific hybrids, laboratory (MMU) F₁ hybrid mice (C57BL/6 x C3H)F₁ (B6C3) and MSP strain SMZ mice were used. SMZ mice were originally caught in Azzemour, Morocco, and bred in captivity in Montpellier. Both (B6C3 x SMZ)F₁ (MS) and (MS x B6C3)BC1 (MSM) mice were used in this study. Pregnant females were killed on day 18 (e18) of gestation. Plug day was counted as e1. From the e18 conceptuses, brain, liver, and the placenta were dissected for methylation analysis. Placentas contained the maternal decidua but the yolk sac was largely removed. The maternal decidua contributes only a small proportion of the mature e18 placenta. Remaining fetal tissue was used for genotyping.

DNA isolation and Southern blot hybridization:
DNA was isolated according to standard phenol-chloroform extraction procedures. Phase-Lock-Gel tubes (Eppendorf, Madison, WI) were used to minimize loss of DNA. Isolated DNAs were restriction-digested with BamHI, EcoRI, or HindIII and, subsequently, with either MspI or HpaII. For electrophoretic separation and Southern hybridization, again standard techniques were applied. Briefly, digested DNAs were electrophoresed through 1.5% agarose gels and transferred to Hybond-N membranes. Probes (see below) were radioactively labeled with [-³²P]dCTP and hybridized to the membranes at 65° overnight followed by washes under stringent conditions.

Probes:
cDNA probes for Mecp2 (IMAGp998F081640, 523 bp), Pem (IMAGp998L233263, 620 bp), and Psx1 (IMAGp998D214447, 505 bp) were obtained from the German Resource Centre, Berlin (RZPD). cDNA probes for Atrx (1200 bp), Pou3f4 (1500 bp), and Cdx2 (3500 bp) were kindly provided by D. Picketts, Ottawa, F. Cremers, Nijmegen, The Netherlands, and V. Subramanian, Bath, United Kingdom, respectively; the cDNA probe for Esx1 (1000 bp) was provided by R. Behringer, Houston; the probe for POU3F4 was from F. Cremers, Nijmegen; and the Vbp1 (374 bp) was made in our lab (HEMBERGER et al. 1999A ). All probes were murine with the exception of the POU3F4 probe, which was human derived. Probes were amplified by PCR using M13 primers; for Atrx specific primers were used: 5'-3' CACCATCTTCTTGCCATCTCTGTAG and 3'-5' GATGTATTCTTGCCCACTGCATG. The probes used for analysis of LINE-1 and IAP (kind gift from B. Mueller, Heidelberg, Germany) methylation were described before (TEUBNER and SCHULZ 1994 ; FEHRMANN et al. 1997 ).

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Global methylation in placenta and fetal tissues:
A previous analysis had demonstrated absence of global demethylation in tissues of hybrids from several eutherian orders (ROEMER et al. 1999 ). However, this negative finding did not exclude the possibility that such global demethylation occurs in fetal stages and specifically in the placenta, which exhibits hybrid dysgenesis effects. To investigate this possibility, DNA was isolated from interspecific MS and MSM tissues and analyzed. This analysis showed no difference in methylation levels between fetal and adult tissues, between placenta and fetal brain and liver, and between hyperplastic MSM, hypoplastic MS and normal placentas either from the MSM BC or from B6C3 x B6C3 matings (Fig 2).

View larger version (71K): In this window In a new window Download PPT slide   Figure 2. DNA methylation in tissues of adult and fetal interspecific hybrids. Left lane, MspI; right lane, HpaII. Lanes 1–3 show DNAs isolated from liver, brain, and placenta of one e18 MS conceptus. Placental weight was 79.2 mg. Lanes 4–7 show DNAs isolated from brain of adult mice. Lane 4, MMU; lane 5, SM; lane 6, MSP; lane 7, MS. No significant differences can be detected in DNA methylation between adult and fetal samples and between placenta and other fetal tissues.

Methylation of specific genes and LINE-1 and IAP repeats in placenta and fetal tissues:
Altogether 14 placentas from MS and MSM matings with weights ranging between 56.3 and 297 mg were assessed. In all cases, brains and livers from the same conceptuses were used for methylation analysis. Of the single-copy genes that were assessed, Cdx2 and Esx1 exhibited no differential restriction pattern after HpaII/MspI digestion and were therefore not analyzed further. The other genes exhibited methylated sites detectable by HpaII/MspI digestion and could be used for further analysis. Atrx, Mecp2, Vbp1, and Pou3f4 showed comparable HpaII/MspI restriction patterns in all samples analyzed, that is, fetal liver and brain, placenta, and liver from adult MS, SM, SMZ, and B6C3 mice. Thus, these genes exhibited no tissue-specific methylation as shown for Mecp2 in Fig 3A and, specifically, no hypomethylation in the placenta compared to the other tissues. In contrast to this, the HpaII/MspI restriction patterns of Pem (Fig 3B) and Psx1 (Fig 3C) showed that these two genes were hypomethylated in placenta compared to fetal brain and liver and adult liver (not shown). However, hypomethylation was detected in all placental samples analyzed and no quantitative differences could be detected between normal and hyperplastic placentas in the MSM BC, and MS and B6C3 x B6C3 matings. The observed methylation patterns of X-linked genes that were assessed is summarized in Table 1. A methylation pattern similar to that of Pem and Psx1 was observed for the repetitive LINE-1 and IAP elements: these showed increased sensitivity to HpaII digestion in placenta compared with the other fetal and adult tissues; however, no difference could be observed between normal and dysplastic placentas (Fig 4A and Fig B).

View larger version (58K): In this window In a new window Download PPT slide   Figure 3. Methylation analysis of specific genes in tissues from MSM, MS, and intraspecific MMU x MMU matings. Left lane, MspI; right lane, HpaII. (A) Southern blots of HindIII/MspI- and HindIII/HpaII-digested DNA hybridized with Mecp2 probe. Left to right: e18 MSM conceptus with hyperplastic placenta of 297 mg; e18 MSM conceptus with hypoplastic placenta of 56.6 mg; e18 MS conceptus with placenta of 83.0 mg. Methylation patterns are similar for all fetal tissues and the different placental weight classes; the lower band at 0.6 kb (arrowhead) appeared in some HpaII digests of placenta and liver but not of brain DNA. A is a composite of two blots. (B) Southern blots of EcoRI/MspI- and EcoRI/HpaII-digested DNA hybridized with Pem probe. Left to right: e18 MSM conceptus with placental weight of 95.6 mg; e18 control conceptus from intraspecific MMU x MMU mating. Demethylation of Pem sequence in placenta compared to both liver and brain is clearly visible in both the MSM and the control conceptus placenta; however, liver exhibits intermediate methylation in relation to brain and placenta. No difference can be seen between the methylation in the e18 MMU placenta and the e18 MSM placenta. B is a composite of two blots. (C) Southern blots of EcoRI/MspI- and EcoRI/HpaII-digested DNA hybridized with Psx1 probe. Left to right: e18 MS conceptus with placental weight of 93.1 mg; e18 MSM conceptus with hyperplastic placenta of 297 mg; e18 control conceptus from intraspecific MMU x MMU. Placenta exhibits clear-cut demethylation compared with liver and brain independent of genotype. The additional band at 0.6 kb indicated by the arrowhead is due to a restriction variant in MSP. C is a composite of three blots. plac, placenta.

View larger version (88K): In this window In a new window Download PPT slide   Figure 4. (A) Methylation analysis of IAP repeats in MSM BC1 tissues. BamHI/HpaII (left lane) and BamHI/MspI (right lane) digests are shown for placenta, liver, and brain from six e18 conceptuses. DNA isolated from the different tissues of each conceptus was applied in the same order on each gel. Placental weights of each conceptus were: lane 1, 268 mg; lane 2, 204 mg; lane 3, 59.5 mg; lane 4, 109 mg; lane 5, 117 mg; and lane 6, 278 mg. Conceptuses 1–3 and 4–6, respectively, were littermates. Lane I shows liver DNA of the female MS F1 hybrid from which conceptuses 1–3 had been isolated. Lanes II and III show F9 cell control. Placental DNA shows some demethylation compared with liver and brain DNA. However, no difference in degree of demethylation between normal-sized (4 and 5), hyperplastic (1, 2, and 6), and hypoplastic (3) placentas can be seen. (B) Methylation of LINE-1 repeats in MSM BC1 tissues. Exactly the same blots as in A are shown in the same order. Demethylation of LINE-1 repeats in placentas is more pronounced than that of IAP repeats; however, again no differences between the different placental size classes are apparent. Please note that HpaII/MspI lanes are inverted in Fig 4 compared to Fig 2 and Fig 3.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Several analyses of DNA methylation in specific tissues and stages of mouse development have shown that embryonic and extraembryonic lineages are differentially methylated and that extraembryonic DNA exhibits overall hypomethylation (CHAPMAN et al. 1984 ; RAZIN et al. 1984 ; ROSSANT et al. 1986 ; MONK et al. 1987 , MONK et al. 1991 ). As in the present study, HpaII/MspI restriction was used in these investigations to assess methylation of repetitive elements and specific genes. Therefore, our findings that both repetitive elements and some specific genes tend to be hypomethylated in e18 mouse placenta are not surprising and fit well into accepted knowledge. The only discrepancy between our and the previous results is that the majority of specific genes assessed by us, that is, Atrx, Mecp2, Vbp1, and Pou3f4, exhibited no differential methylation between placenta and fetal liver and brain. This is in contrast to the studies by RAZIN et al. 1984 and ROSSANT et al. 1986 . Razin and colleagues analyzed three specific genes, dihydrofolate reductase, the major histocompatibility gene H-2K^b, and the ß-major globin gene. All of these genes exhibited hypomethylation in extraembryonic tissues. Rossant et al. analyzed -fetoprotein, albumin, and the major urinary protein gene family and showed hypomethylation for these genes in extraembryonic tissues. In addition, hypomethylation of actin and metallothionein is mentioned but not shown. As these authors also used cDNA probes, with the exception of the -fetoprotein probe that was a 4.5-kb genomic probe, technical problems associated with the use of cDNA probes in our study cannot be responsible. A possible explanation is that the extraembryonic tissues analyzed in the previous studies were isolated at early stages of development. Thus, in the study by ROSSANT et al. 1986 , e7.5 (corresponds to our e8) extraembryonic tissues, including ectoplacental cone, a derivative of the trophectoderm, were analyzed. This stage is prior to the development of a placenta proper. Although in the study by RAZIN et al. 1984 e9–e10 placenta were assessed, this is well before the e18 stage that we have studied. The dramatic changes in morphology and gene expression (HEMBERGER et al. 2001 ) observed between early and late placental stages make it possible that these are accompanied by changes in DNA methylation.

In contrast to the previous results cited above, in a more recent study in which the restriction landmark genomic scanning (RLGS) technique was applied, CpG islands in placenta and trophoblast were not found to be hypomethylated in comparison to other tissues such as kidney or brain (SHIOTA et al. 2002 ). Thus, it is also possible that the overall hypomethylation of trophoblast DNA described in the previous reports was in part due to analysis of repetitive elements and to gene sampling bias.

In any case, the main aim of this study was to determine whether placental dysplasia, a specific hybrid dysgenesis effect in the genus Mus that cosegregates with the X chromosome, is caused by deregulated DNA methylation, specifically in placental tissues and X-linked loci. This possibility had been suggested by findings that in the marsupial group Macropodidae interspecific hybridization results in genome-wide demethylation associated with retrotransposon amplification and chromosome remodeling (O'NEILL et al. 1998 ). However, the present study indicates that systemic DNA demethylation is not a feature of IHPD. Combined with previous results by us (ROEMER et al. 1999 ) and others (ROBINSON et al. 2000 ), the present results thus show conclusively that normal methylation patterns are conserved in interspecific hybridization between placental mammals.

However, our present results do not exclude the possibility that few and specific genes exhibit abnormal methylation. This is in fact suggested by analyses of placentas of cloned mice. Intriguingly, cloned mice exhibit a placentomegaly phenotype that is strikingly similar to the hyperplastic IHPD phenotype (TANAKA et al. 2001 ). Thus, cloned placentas exhibit an enlarged and disorganized spongiotrophoblast with exaggerated glycogen cell differentiation (TANAKA et al. 2001 ), just like IHPD placentas (ZECHNER et al. 1996 ). Placentomegaly was also observed in cloned animals from other species (DE SOUSA et al. 2001 ; HEYMAN et al. 2002 ). Recent DNA methylation studies of cloned placentas using the RLGS technique have shown that only very few loci are aberrantly methylated in placentas of cloned mice (OHGANE et al. 2001 ; SHIOTA and YANAGIMACHI 2002 ). Interestingly, it seems that these loci vary between clones (OHGANE et al. 2001 ; SHIOTA and YANAGIMACHI 2002 ). It will be interesting to apply the RLGS approach to IHPD placentas, which can be produced more readily than cloned placentas, to determine whether there are core loci that exhibit abnormal methylation more frequently than others. If such loci are detected, it would be feasible to determine whether these are also detected in cloned placentas and whether abnormal expression levels of these loci are associated with abnormal methylation.

	FOOTNOTES

¹ Present address: Charité, Department for Medical Immunology, Humboldt University, 10117 Berlin, Germany.
² Present address: Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, AB T2N 4N1, Canada.

	ACKNOWLEDGMENTS

We are grateful to Kunio Shiota and Andras Páldi for carefully reading the manuscript and for their valuable comments. This work was supported by the Max-Planck Society.

Manuscript received October 14, 2002; Accepted for publication April 2, 2003.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ADLER, D. A., N. A. QUADERI, S. D. BROWN, V. M. CHAPMAN, and J. MOORE et al., 1995  The X-linked methylated DNA binding protein, Mecp2, is subject to X inactivation in the mouse. Mamm. Genome 6:491-492.[Medline]

ALLEN, W. R., J. A. SKIDMORE, and D. F. ANTCZAK, 1993  Effects of fetal genotype and uterine environment on placental development in equids. J. Reprod. Fertil. 97:55-60.

BAILEY, J. A., L. CARREL, A. CHAKRAVARTI, and E. EICHLER, 2000  Molecular evidence for a relationship between LINE-1 elements and X chromosome inactivation: the Lyon repeat hypothesis. Proc. Natl. Acad. Sci. USA 97:6634-6639.[Abstract/Free Full Text]

BECK, F., T. ERLER, A. RUSSELL, and R. JAMES, 1995  Expression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes. Dev. Dyn. 204:217-229.

CHANG-YEH, A., D. E. MOLD, and R. C. HUANG, 1991  Identification of a novel murine IAP-promoted placenta-expressed gene. Nucleic Acids Res. 19:3667-3672.[Abstract/Free Full Text]

CHANG-YEH, A., D. E. MOLD, M. H. BRILLIANT, and R. C. HUANG, 1993  The mouse intracisternal A particle-promoted placental gene retrotransposition is mouse-strain-specific. Proc. Natl. Acad. Sci. USA 90:292-296.[Abstract/Free Full Text]

CHAPMAN, V., L. FORRESTER, J. SANFORD, N. HASTIE, and J. ROSSANT, 1984  Cell lineage-specific undermethylation of mouse repetitive DNA. Nature 307:284-286.[Medline]

CHAWENGSAKSOPHAK, K. and F. BECK, 1996  Chromosomal localization of cdx2, a murine homologue of the Drosophila gene caudal, to mouse chromosome 5. Genomics 34:270-271.[Medline]

CHUN, J. Y., Y. J. HAN, and K. Y. AHN, 1999  Psx homeobox gene is X-linked and specifically expressed in trophoblast cells of mouse placenta. Dev. Dyn. 216:257-266.[Medline]

DE KOK, Y. J., S. M. VAN DER MAAREL, M. BITNER-GLINDZICZ, I. HUBER, and A. P. MONACO et al., 1995  Association between X-linked mixed deafness and mutations in the POU domain gene POU3F4.. Science 267:685-688.[Abstract/Free Full Text]

DE SOUSA, P. A., T. KING, L. HARKNESS, L. E. YOUNG, and S. K. WALKER et al., 2001  Evaluation of gestational deficiencies in cloned sheep fetuses and placentae. Biol. Reprod. 65:23-30.[Abstract/Free Full Text]

FEHRMANN, F., R. WELKER, and H. G. KRAUSSLICH, 1997  Intracisternal A-type particles express their proteinase in a separate reading frame by translational frameshifting, similar to D-type retroviruses. Virology 235:352-359.[Medline]

FUKS, F., P. J. HURD, D. WOLF, X. NAN, and A. P. BIRD et al., 2003  The methyl-CpG-binding protein MeCP2 links DNA methylation to histone methylation. J. Biol. Chem. 278:4035-4040.[Abstract/Free Full Text]

GIBBONS, R. J., D. J. PICKETTS, L. VILLARD, and D. R. HIGGS, 1995  Mutations in a putative global transcriptional regulator cause X-linked mental retardation with a-thalassemia (ATR-X syndrome). Cell 80:837-845.[Medline]

GIBBONS, R. J., T. L. MCDOWELL, S. RAMAN, D. M. O'ROURKE, and D. GARRICK et al., 2000  Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation. Nat. Genet. 24:368-371.[Medline]

GRAY, A. P., 1971 Mammalian Hybrids. Commonwealth Agricultural Bureau, Edinburgh.

HEMBERGER, M., H. HIMMELBAUER, H. P. NEUMANN, K. H. PLATE, and G. SCHWARZKOPF et al., 1999a  Expression of the von Hippel-Lindau-binding protein-1 (Vbp1) in fetal and adult mouse tissues. Hum. Mol. Genet. 8:229-236.[Abstract/Free Full Text]

HEMBERGER, M. C., R. S. PEARSALL, U. ZECHNER, A. ORTH, and S. OTTO et al., 1999b  Genetic dissection of X-linked interspecific hybrid placental dysplasia in congenic mouse strains. Genetics 153:383-390.[Abstract/Free Full Text]

HEMBERGER, M., J. C. CROSS, H. H. ROPERS, H. LEHRACH, and R. FUNDELE et al., 2001  UniGene cDNA array-based monitoring of transcriptome changes during mouse placental development. Proc. Natl. Acad. Sci. USA 98:13126-13131.[Abstract/Free Full Text]

HEYMAN, Y., P. CHAVATTE-PALMER, D. LEBOURHIS, S. CAMOUS, and X. VIGNON et al., 2002  Frequency and occurrence of late-gestation losses from cattle cloned embryos. Biol. Reprod. 66:6-13.[Abstract/Free Full Text]

JONES, P. L., G. J. VEENSTRA, P. A. WADE, D. VERMAAK, and S. U. KASS et al., 1998  Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat. Genet. 19:187-191.[Medline]

LI, Y. and R. R. BEHRINGER, 1998  Esx1 is an X-chromosome-imprinted regulator of placental development and fetal growth. Nat. Genet. 20:309-311.[Medline]

LI, Y., P. LEMAIRE, and R. R. BEHRINGER, 1997  Esx1, a novel X chromosome-linked homeobox gene expressed in mouse extraembryonic tissues and male germ cells. Dev. Biol. 188:85-95.[Medline]

LIN, T. P., P. A. LABOSKY, L. B. GRABEL, C. A. KOZAK, and J. L. PITMAN et al., 1994  The Pem homeobox gene is X-linked and exclusively expressed in extraembryonic tissues during early murine development. Dev. Biol. 166:170-179.[Medline]

MCDOWELL, T. L., R. J. GIBBONS, H. SUTHERLAND, D. M. O'ROURKE, and W. A. BICKMORE et al., 1999  Localization of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and the short arms of acrocentric chromosomes. Proc. Natl. Acad. Sci. USA 96:13983-13988.[Abstract/Free Full Text]

MONK, M., M. BOUBELIK, and S. LEHNERT, 1987  Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development 99:371-382.[Abstract]

MONK, M., R. L. ADAMS, and A. RINALDI, 1991  Decrease in DNA methylase activity during preimplantation development in the mouse. Development 112:189-192.[Abstract]

NAN, X., H. H. NG, C. A. JOHNSON, C. D. LAHERTY, and B. M. TURNER et al., 1998  Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393:386-389.[Medline]

OHGANE, J., T. WAKAYAMA, Y. KOGO, S. SENDA, and N. HATTORI et al., 2001  DNA methylation variation in cloned mice. Genesis 30:45-50.[Medline]

O'NEILL, R. J. W., M. J. O'NEILL, and J. A. M. GRAVES, 1998  Undermethylation associated with retroelement activation and chromosome remodelling in an interspecific mammalian hybrid. Nature 393:68-72.[Medline]

RAZIN, A., C. WEBB, M. SZYF, J. YISRAELI, and A. ROSENTHAL et al., 1984  Variations in DNA methylation during mouse cell differentiation in vivo and in vitro. Proc. Natl. Acad. Sci. USA 81:2275-2279.[Abstract/Free Full Text]

ROBINSON, T. J., O. WITTEKINDT, J. J. PASANTES, W. S. MODI, and W. SCHEMPP et al., 2000  Stable methylation patterns in interspecific antelope hybrids and the characterization and localization of a satellite fraction in the Alcelaphini and Hippotragini. Chromosome Res. 8:635-643.[Medline]

ROEMER, I., F. GRÜTZNER, H. WINKING, T. HAAF, and A. ORTH et al., 1999  Genome methylation in interspecific eutherian hybrids. Nature 401:131-132.[Medline]

ROGERS, J. F. and W. D. DAWSON, 1970  Foetal and placental size in a Peromyscus species cross. J. Reprod. Fertil. 21:255-262.[Abstract/Free Full Text]

ROSSANT, J., J. P. SANFORD, V. M. CHAPMAN, and G. K. ANDREWS, 1986  Undermethylation of structural gene sequences in extraembryonic lineages of the mouse. Dev. Biol. 117:567-573.[Medline]

SHIOTA, K. and R. YANAGIMACHI, 2002  Epigenetics by DNA methylation for development of normal and cloned animals. Differentiation 69:162-166.[Medline]

SHIOTA, K., Y. KOGO, J. OHGANE, T. IMAMURA, and A. URANO et al., 2002  Epigenetic marks by DNA methylation specific to stem, germ and somatic cells in mice. Genes Cells 7:961-969.[Abstract]

SOLLARS, V., X. LU, L. XIAO, X. WANG, and M. D. GARFINKEL et al., 2003  Evidence for an epigenetic mechanism by which Hsp90 acts as a capacitor for morphological evolution. Nat. Genet. 33:70-74.[Medline]

TANAKA, S., M. ODA, Y. TOYOSHIMA, T. WAKAYAMA, and M. TANAKA et al., 2001  Placentomegaly in cloned mouse concepti caused by expansion of the spongiotrophoblast layer. Biol. Reprod. 65:1813-1821.[Abstract/Free Full Text]

TEUBNER, B. and W. A. SCHULZ, 1994  Exemption of satellite DNA from demethylation in immortalized differentiated derivatives of F9 mouse embryonal carcinoma cells. Exp. Cell Res. 210:192-200.[Medline]

VRANA, P. B., X. J. GUAN, R. S. INGRAM, and S. M. TILGHMAN, 1998  Genomic imprinting is disrupted in interspecific Peromyscus hybrids. Nat. Genet. 20:362-365.[Medline]

VRANA, P. B., J. A. FOSSELLA, P. MATTESON, T. DEL RIO, and M. J. O'NEILL et al., 2000  Genetic and epigenetic incompatibilities underlie hybrid dysgenesis in Peromyscus. Nat. Genet. 25:120-124.[Medline]

ZECHNER, U., M. REULE, A. ORTH, F. BONHOMME, and B. STRACK et al., 1996  An X-chromosome linked locus contributes to abnormal placental development in mouse interspecific hybrids. Nat. Genet. 12:398-403.[Medline]

This article has been cited by other articles:

				R. Ain, L. N Canham, and M. J Soares Dexamethasone-induced intrauterine growth restriction impacts the placental prolactin family, insulin-like growth factor-II and the Akt signaling pathway J. Endocrinol., May 1, 2005; 185(2): 253 - 263. [Abstract] [Full Text] [PDF]