Genetics, Vol. 165, 197-204, September 2003, Copyright © 2003

The Drosophila spn-D Gene Encodes a RAD51C-Like Protein That Is Required Exclusively During Meiosis

Uri Abdu1,a, Acaimo González-Reyes1,b, Amin Ghabrialc, and Trudi Schüpbacha
a Howard Hughes Medical Institute, Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544,
b Instituto de Parasitologia y Biomedicina CSIC, Granada, 18001, Spain
c Department of Biochemistry, Stanford University, Stanford, California 94305

Corresponding author: Trudi Schüpbach, Washington St., Princeton University, Princeton, NJ 08544., gschupbach{at}molbio.princeton.edu (E-mail)

Communicating editor: T. C. KAUFMAN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

In Drosophila, mutations in double-strand DNA break (DSB) repair enzymes, such as spn-B, activate a meiotic checkpoint leading to dorsal-ventral patterning defects in the egg and an abnormal appearance of the oocyte nucleus. Mutations in spn-D cause an array of ovarian phenotypes similar to spn-B. We have cloned the spn-D locus and found that it encodes a protein of 271 amino acids that shows significant homology to the human RAD51C protein. In mammals the spn-B and spn-D homologs, XRCC3 and RAD51C, play a role in genomic stability in somatic cells. To test for a similar role for spn-B and spn-D in double-strand DNA repair in mitotic cells, we analyzed the sensitivity of single and double mutants to DSBs induced by exposure to X rays and MMS. We found that neither singly mutant nor doubly mutant animals were significantly sensitized to MMS or X rays. These results suggest that spn-B and spn-D act in meiotic recombination but not in repair of DSBs in somatic cells. As there is no apparent ortholog of the meiosis-specific DMC1 gene in the Drosophila genome, and given their meiosis-specific requirement, we suggest that spn-B and spn-D may have a function comparable to DMC1.


MEIOTIC recombination and DNA repair are intimately linked in all organisms. Both processes use a common set of enzymes that catalyze the reaction known as recombinational repair of double-strand DNA breaks. This process restores the normal DNA sequence without nucleotide loss by DNA synthesis, using as template the information provided by homologous DNA sequences, usually present on a homologous chromosome (KANAAR et al. 1998 Down; PAQUES and HABER 1999 Down; JASIN, 2000 Down). The key players that perform this reaction are highly conserved, in particular, the Rad51 recombinase and its accessory proteins. In eukaryotic cells the Rad51 protein is a functional homolog of the bacterial RecA protein (BAUMANN and WEST 1998 Down). Saccharomyces cerevisiae cells contain, in addition to Rad51 itself, three Rad 51 paralogs: Rad55, Rad57, and the meiosis-specific Dmc1 (SUNG 1997 Down). Seven members of the Rad51 protein family have been identified in humans: RAD51 (SHINOHARA et al. 1993 Down), DMC1 (HABU et al. 1996 Down), XRCC2 (CARTWRIGHT et al. 1998B Down; LIU et al. 1998 Down), XRCC3 (TEBBS et al. 1995 Down; LIU et al. 1998 Down; PIERCE et al. 1999 Down), RAD51B (ALBALA et al. 1997 Down; CARTWRIGHT et al. 1998A Down), RAD51C (DOSANJH et al. 1998 Down), and RAD51D (CARTWRIGHT et al. 1998A Down; KAWABATA and SAEKI 1998 Down; PITTMAN et al. 1998 Down).

In Drosophila, mutations in one of these genes, spindle-B (spn-B), which encodes a protein that is most similar to XRCC3, were first isolated on the basis of their effects on oogenesis, where curiously, a dorsal-ventral patterning defect of the egg is the most obvious phenotype of homozygous mutant females. In addition to these patterning defects, mutations in spn-B also cause defects in the appearance of the oocyte nucleus (GONZALEZ-REYES et al. 1997 Down; GHABRIAL et al. 1998 Down). spn-B mutations do affect recombination, but this effect is hard to detect, because the patterning defects prevent most of the eggs from developing into viable progeny (GHABRIAL et al. 1998 Down). spn-B is a member of the spindle class genes, which also include spn-A, spn-C, spn-D, spn-E, and spn-F on the third chromosome (TEARLE and NUSSLEIN-VOLHARD 1987 Down) as well as okra, zucchini, and squash on the second chromosome (SCHUPBACH and WIESCHAUS 1991 Down). Similar to spn-B, okra encodes a component of the recombinational DSB repair machinery, the Drosophila Rad54 ortholog (GHABRIAL et al. 1998 Down). On the other hand, spn-E encodes an RNA-dependent ATPase (GILLESPIE and BERG 1995 Down) with no direct connection to DNA repair. While the molecular nature of other spindle class genes is still unknown, earlier studies suggested that spn-C/mus301 and spn-D might also encode proteins that act in recombinational repair of double-strand DNA breaks (BOYD et al. 1981 Down; GHABRIAL et al. 1998 Down; GHABRIAL and SCHUPBACH 1999 Down).

Interestingly, the dorsal-ventral patterning defects in spn-B mutants are dependent upon the activation of a meiotic checkpoint (GHABRIAL and SCHUPBACH 1999 Down). As has been elegantly demonstrated in a variety of organisms, notably in yeast and humans, unrepaired DNA breaks can activate a set of checkpoint proteins, which halt progression through the cell cycle until the DNA is repaired. A meiotic checkpoint similar to that described in yeast exists in Drosophila and is activated in spn-B mutant egg chambers due to the compromised repair of DSBs induced during meiotic recombination. Components of the meiotic checkpoint in Drosophila include the proteins Mei-41 and Dmchk2, which are homologous to ATR/Mec1 and Rad53, respectively (GHABRIAL and SCHUPBACH 1999 Down; ABDU et al. 2002 Down). Checkpoint activation results in a significantly lower level of Gurken protein—a TGF{alpha}-like signaling molecule whose levels and localization within the oocyte play a central role in dorsal-ventral patterning (reviewed in NILSON and SCHUPBACH 1999 Down).

In this study, we show that the dorsal-ventral defects of spn-D mutants are suppressed by mutations in mei-W68 and mei-41, suggesting that, as seen for spn-B and okr, mutations in spn-D activate the meiotic checkpoint. Cloning the spindle-D (spn-D) gene revealed that this locus encodes a Rad51C-like protein. In mammals, the Rad51 paralogs XRCC3 and Rad51C have a role in somatic cells, where they contribute to genomic stability and are involved in genetic recombination processes (reviewed in GODTHELP et al. 2002 Down). The Drosophila XRCC3 homolog, Spn-B, does not show any somatic defects, raising the possibility that Spn-B is entirely dedicated to meiosis. Alternatively, it is possible that Spn-B is acting in the soma, but might be redundant with other Rad51-like proteins. The human XRCC3 physically interacts with both Rad51 and Rad51C (SCHILD et al. 2000 Down; MASSON et al. 2001 Down), suggesting that if there is redundancy for spn-B, it might be with spn-D. We found that spn-B and spn-D single mutants as well as the double mutants have little or no effect on the repair of double-strand DNA breaks in somatic cells and that the essential role of the two genes is in the process of meiotic recombination.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila strains:
spn-D was meiotically mapped to 91 cM on 3R and is uncovered by Df(3R)T1-P (GHABRIAL et al. 1998 Down). Four EMS-induced alleles of spn-D, spn-D349, spn-D150, (TEARLE and NUSSLEIN-VOLHARD 1987 Down), spn-DCX (GHABRIAL et al. 1998 Down), and spn-D225 (GONZALEZ-REYES et al. 1997 Down), were identified previously. Despite repeated outcrossing, no homozygous viable chromosome of spn-DCX was recovered. Also, no nucleotide changes were identified in sequencing the coding region of spn-DCX. In previous genetics tests spn-D150 has been shown to behave as an amorphic allele (GONZALEZ-REYES et al. 1997 Down). The spn-BBU allele and the rescue construct have been described previously (GHABRIAL et al. 1998 Down). Mutant stocks of mei-41 and mei-W68 were obtained from the Bloomington Stock Center. Green fluorescent protein (GFP)-spnD was expressed in the ovary using a nanos-Gal4-VP16 expression system (VAN DOREN et al. 1998 Down).

Molecular cloning:
Blast searches of genomic DNA from the region of 3R corresponding to the predicted location of spn-D revealed the presence of DNA sequences with homology to Rad51. At the time, no corresponding predicted genes or expressed sequence tags (ESTs) were available, so 3' and 5' rapid amplification of cDNA ends (RACE; CLONTECH, Palo Alto, CA) experiments were performed. Briefly, ovarian mRNA was purified from Ore-R females using Dynabeads (Dynal Biotech, Great Neck, NY) as previously described (TOMANCAK et al. 1998 Down). For 3' RACE the gene-specific primer TCCTTGGGTCACCTGGTTGAAC was used. For 5' RACE the gene-specific primer GTTCAACCAGGTGACCCAAG was used. The putative spn-D sequence was confirmed by sequencing a cDNA amplified from a cDNA ovarian library (STROUMBAKIS et al. 1994 Down).

Rescue construct:
A 2.2-kb XbaI/SalI fragment and a 7-kb SalI/XbaI fragment from phage 10.1 (FLEMING et al. 1990 Down) were separately subcloned in PBS. The 7-kb SalI/XbaI fragment was then digested with SalI/PstI, and a 2.8-kb fragment was purified. A triple ligation using the following fragments (the 2.2-kb XbaI/SalI, the 2.8-kb SalI/PstI, and pCasper cut with XbaI and PstI) was performed to obtain pCs-spn-D. To make the UASp-GFP::Spn-D fusion the entire GFP-coding sequence was amplified by PCR, using modified primers to create an Asp718 restriction site at the 5' end and a SacI site at the 3' end. The 1.3-kb spn-D genomic region was amplified by PCR using modified primers to create SacI (5') and XbaI (3') restriction sites. A triple ligation using the following fragments, GFP Asp718/SacI, genomic spn-D SacI/XbaI, and pUASp cut with Asp718/XbaI, was performed to obtain UASp-GFP::spn-D. P-element-mediated germ-line transformation of both constructs was carried out according to standard procedures.

Sequencing of mutant alleles:
Genomic DNA was prepared from flies of the genotype spn-D*/spn-D* according to standard procedures (SAMBROOK et al. 1989 Down). The coding region was sequenced and the sequences were compared with the wild-type genomic sequence of the parental chromosome using the MacVector (Kodak/IBI) program.

Northern blot:
Whole RNA was extracted from wild-type (Oregon-R) ovaries using Trizol reagent (GIBCO BRL, Gaithersburg, MD). The RNA was separated on a denaturing gel, blotted onto nitrocellulose membrane, and probed with radiolabeled DNA fragments using standard molecular biology techniques. The probe used was an EST (RE19845), which covers the entire spn-D open reading frame.

Antibody staining of ovaries:
Immunolocalization of Grk was performed as described previously (QUEENAN et al. 1999 Down).

Tests of DNA repair in mitosis:
To test the requirement in mitotic double-strand break repair, spn-BBU, spn-D150 single and double mutants were exposed during larval development to the mutagen methyl methanesulfonate (MMS; Sigma, St. Louis) or to ionizing radiation. Sensitivity to MMS was measured as described previously (GHABRIAL et al. 1998 Down). To determine the X-ray sensitivity, crosses of the appropriate genotypes were made in duplicate, one to be treated with X rays and the other to serve as control. The crosses were transferred daily and 2 days after the transfer, the larvae were irradiated with an Astrophysics Research Corporation X-ray machine operated at 145 kV and 5 mA for 90 sec, which corresponds to a dose of ~1200 rad. After eclosion, the percentage of the mutant flies was determined, and the sensitivity to X rays was expressed as the fraction of the expected percentage of the mutant flies in the treated vial as compared to the progeny of untreated control vials.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

spn-D mutations are suppressed by eliminating activation of the meiotic checkpoint:
The spn-B patterning defects can be suppressed by blocking the formation of double-strand DNA breaks (DSBs) during meiosis using mutations in mei-W68 or by eliminating the checkpoint by using mutations in the checkpoint gene, mei-41 (GHABRIAL and SCHUPBACH 1999 Down). To study whether the ovarian phenotype in spn-D is also due to unrepaired double-strand DNA breaks, flies double mutant for mei-W68 and spn-D were generated (Fig 1 and Table 1). In double-mutant flies we observed suppression of dorsal-ventral patterning defects (Table 1) and a corresponding dramatic increase in the accumulation of Grk protein (Fig 1C), as compared to spn-D single mutants (Fig 1B). We also observed a significant suppression of oocyte nuclear defects (Fig 1, D–F). In wild-type egg chambers the DNA has a spherical shape and is condensed in a structure called the karyosome (Fig 1D). In contrast, in spn-D150 mutant egg chambers, the DNA is found in variety of conformations, including wild-type shape (33%), oblong shape (31%), or fragmented (36%; Fig 1E and Fig 4A). In egg chambers from the spn-D and mei-W68 double-mutant flies, the appearance of the DNA within the oocyte is fully restored to wild type (Fig 1F).



View larger version (24K):
In this window
In a new window
Download PPT slide
 
Figure 1. Grk accumulation and karyosome morphology in wild-type and mutant Drosophila egg chambers. (A–F) DNA is blue and Grk protein is red. (A) Wild-type egg chamber (Ore-R); Grk protein is localized at the dorsal anterior cortex of the oocyte. (B) spn-D349/spn-D150 mutant egg chamber; Grk protein is reduced. (C) meiW-68; spn-D349/spn-D150 double-mutant egg chamber; Grk protein is localized as in wild type. (D) Karyosome from wild-type egg chamber. (E) Karyosome from spn-D349/spn-D150 mutant egg chamber. (F) Karyosome from meiW-68; spn-D349/spn-D150 double-mutant egg chamber.



View larger version (31K):
In this window
In a new window
Download PPT slide
 
Figure 2. spn-D encodes a Rad51C-like protein. (A) spn-D gene structure. Untranslated regions are indicated as open boxes, introns are indicated as lines, and coding regions are indicated as solid boxes. Numbers represent the nucleotide length of the gene. (B) Protein structure of Spn-D as compared with RAD51C. Light shading, region of homology between the two proteins; dark shading, P-loop motif, which is an ATP/GTP-binding site. The position of each mutant allele is shown; the allele number is followed by the wild-type amino acid, the amino acid number, and the stop codon. (C) An alignment of the A-type nucleotide-binding domains of Spn-D, human RAD51C, Spn-B, and human XRCC3. Dark shading marks the P-loop motif.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 3. Phylogenetic analysis of human and Drosophila Rec-A related proteins. Hs, human; Dm, Drosophila. The alignment of the sequences and the generation of the tree were performed using the MacVector program. Numbers represent the uncorrected distance, which estimates the proportional differences between sequences.



View larger version (73K):
In this window
In a new window
Download PPT slide
 
Figure 4. Rescue of mutant karyosome and eggshell by the UASp-SpnD construct. The nanos-Gal4 line was used to drive expression of the GFP::SpnD protein in the germ line. (A and B) DNA stained with Hoechst is labeled in white. The arrows point at the karyosome. (A) Mutant karyosome from spn-D349 egg chamber. (B) Wild-type-like karyosome in a nanos-Gal4/UASp-GFP::SpnD; spn-D349 egg chamber. (C) Strongly ventralized eggshell from a spn-D349 mutant. (D) Wild-type-like eggshell from a nanos-Gal4/UASp-GFP::SpnD; spn-D349 female.


 
View this table:
In this window
In a new window

 
Table 1. Eggshell phenotypes of spn-D alone and in combination with mei-W68 and mei-41

To confirm that the patterning defects in spn-D mutants are caused by activation of the same meiotic checkpoint activated in spn-B mutants, flies double mutant for mei-41 and spn-D were generated. We found that mei-41 suppressed up to 96% of the eggshell defects found in spn-D mutants (Table 1). However, we observed that even residual Mei-41 protein activity still affected the oocyte nuclear morphology. Only a minor suppression of the oocyte nuclear defect was found in the flies double mutant for both mei-41D1 (presumably hypomorphic allele) and spn-D, whereas in the flies double mutant for both mei-41D3 (a putative null allele, SIBON et al. 1999 Down) and spn-D, most of the egg chambers had wild-type-like oocyte nuclear morphology ({chi}2 significance of P = 0.0005; Table 2).


 
View this table:
In this window
In a new window

 
Table 2. Karyosome phenotypes of double-mutant combinations of spn-D with mei-41

The spindle-D gene encodes a Rad51C-like protein:
Homology searches of the region of chromosome 3 corresponding to the location of the spn-D locus revealed the existence of genomic DNA with homology to Rad51-like genes. This spn-D candidate gene was cloned (see MATERIALS AND METHODS) and the gene structure was determined from comparison of cDNA sequences and the corresponding genomic sequence (Fig 2A). A search of the Berkeley Drosophila Genome Project (BDGP) database reveals three recently identified ESTs (GenBank nos. AY71162, BI578285, and BI580876) corresponding to the spn-D transcript that confirms the gene structure of spn-D. spn-D encodes a protein of 271 amino acids with an apparent molecular weight of 31 kD. Northern blots of wild-type (Oregon-R) ovarian mRNA were hybridized with a probe corresponding to the spn-D transcript and revealed a single band of ~1.5 kb (data not shown). Motif searches revealed that the protein belongs to the RecA family and contains the consensus P-loop motif, which is an ATP/GTP-binding site (Fig 2B). Blast searches of DNA and protein databases identified the human RAD51C protein as the most closely related to Spn-D (23% identity and 38% similarity). Phylogenetic analysis using the P-loop domain of RecA-related proteins from human and Drosophila showed that the Drosophila genome includes five Rad51-like genes, all of which are putative homologs of mammalian genes, but none of which appear to correspond to Rad51B or DMC1 (Fig 3). It is important to note that spn-D represents an additional RecA/Rad51-like protein not included in the list of four such genes identified in the analysis of release 1 of the Drosophila genome (ADAMS et al. 2000 Down).

The coding regions of three mutant spn-D alleles were sequenced and were found to contain unique single-nucleotide changes. Spn-D225 and spn-D150 have nonsense mutations that should truncate the protein after the 40th and 229th residues, respectively (Fig 2B). The spn-D349 mutation is in the splice acceptor site of the third exon. To demonstrate that these mutations in the Rad51C-like gene are responsible for the defects observed in the spn-D mutants, two rescue constructs—one containing 9.2 kb of genomic DNA and another containing a fusion GFP::SpnD protein under the control of the Gal4/UAS system—were introduced into flies by P-element-mediated transformation. Both transgenes fully rescued all the mutant phenotypes, including the dorsal-ventral patterning defect and the karyosome abnormalities (Fig 4), verifying that spn-D indeed corresponds to the Rad51C homolog of Drosophila.

Somatic requirements for spn-D and spn-B in double-strand DNA breaks:
To determine whether the spn-D gene is involved in somatic double-strand DNA repair processes, we subjected spn-D225, spn-D150, spn-D349, and spn-D150/spn-D349 larvae to X rays or to 0.08% of MMS and compared the survival rates of wild-type and mutant individuals (Fig 5 and data not shown). Since all of the spn-D alleles tested were insensitive to double-strand DNA breaks, we decided to use the spn-D150 allele—a putative genetic null (GONZALEZ-REYES et al. 1997 Down) shown to cause the most severe ovarian defects—in this and following experiments. Given the apparent enhancement of certain ovarian defects in double-mutant animals (GONZALEZ-REYES et al. 1997 Down), we also tested whether the spn-B, spn-D double mutant would show a somatic DNA repair defect that is not apparent for either single mutation (Fig 5 and GHABRIAL et al. 1998 Down). We found that the double mutant larvae, whether treated with 0.08% MMS or exposed to X rays, were viable similarly to their heterozygous control siblings (Fig 5).



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 5. MMS (A) and X-ray (B) sensitivity of spn-B, spn-D mutants. Each graph shows the ratio of percentage expected (treated) to percentage expected (control) for the different genotypes.

Given the molecular relatedness of the genes and their similar requirement in the ovary, we also tested whether an increase in the dose of spn-B can compensate for mutations in spn-D. Introduction of extra copies of spn-B into spn-D mutant flies did not rescue the eggshell and the karyosome defects of spn-D mutations (data not shown). While a single copy of this transgene can rescue the spn-B mutant phenotype, even two copies of this transgene—in addition to the two endogenous copies of spn-B—are unable to substitute for spn-D. Thus, despite the similarities of their mutant phenotypes and the molecular similarities between the two proteins, spn-B and spn-D have at least some distinct nonoverlapping functions.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The roles of Spn-D and Spn-B:
In eukaryotes, repair of DSBs can occur by at least two pathways, nonhomologous end joining (NHEJ) and homologous recombination (HR). HR contributes to the generation of genetic diversity and the faithful germ-line transmission of genetic information during meiosis (PAQUES and HABER 1999 Down) and is also utilized in somatic tissues to repair damaged DNA. The extent to which one DSB repair pathway is used in the soma, relative to the other pathway, has been found to vary widely between species (VAN DEN BOSCH et al. 2002 Down).

The Rad51 protein, which is a functional homolog of the bacterial RecA protein, is central to the recombination process. All eukaryotes for which the entire genome sequence is known contain members of the RecA-like protein family. In the Drosophila melanogaster and Caenorhabditis elegans genome, orthologs of two proteins, which are specific to recombination during meiosis, Dmc1 and Mnd1, have not been found (DERNBURG et al. 1998 Down; GERTON and DERISI 2002 Down). DMC1 encodes a meiosis-specific protein that has been shown to bias template choice to interhomolog events, rather than to intersister events, during meiotic recombination (BISHOP et al. 1992 Down). It was suggested that Mnd1p operates downstream of Dmc1p binding to DNA and that Mnd1p may be a cofactor for strand invasion (GERTON and DERISI 2002 Down). The absence of DMC1 and MND1 homologs in both Drosophila and C. elegans raises the issue of whether flies and worms have evolved recombination mechanisms that differ from those of yeast, mouse, and human. In Drosophila and C. elegans the synaptonemal complex (SC) formation precedes recombination, in contrast to yeast. It has been suggested that the SC of Drosophila and C. elegans may impose structural constraints, thus directing recombinations toward interhomolog events (SEKELSKY et al. 2000 Down). An alternative mechanism that would ensure interhomolog events is the functional substitution of other Rad-51-like proteins for Dmc1. In mitotic cells, the human RAD51 protein has been considered to be the only protein to catalyze homologous pairing during the recombinational repair process (GUPTA et al. 1999 Down; MAZIN et al. 2000 Down). However, it has been shown that the human XRCC3 interacts with RAD51C and that this stable complex can catalyze homologous-pairing activity in vitro (KURUMIZAKA et al. 2001 Down). Together with previous work (GHABRIAL et al. 1998 Down), this study shows that mutations in spn-B, the Drosophila XRCC3 homolog, and spn-D, the Drosophila Rad51C, cause defects in meiotic recombination, but do not seem to affect the repair of DSBs in somatic cells. The ability of the XRCC3-RAD51C complex to mediate strand invasion together with the meiotic-specific requirement of spn-B and spn-D suggests that spn-B and spn-D together may perform a meiosis-specific role equivalent to DMC1.

The meiotic checkpoint does not globally affect egg chamber development:
Mutations in spn-D and in other DNA repair components result in the activation of a meiotic DNA damage checkpoint that affects the accumulation of Gurken protein in the oocyte cytoplasm as well as the compaction of DNA in the oocyte nucleus. These effects may be mediated by the protein Vasa (GHABRIAL and SCHUPBACH 1999 Down). Activation of the meiotic checkpoint appears to affect the accumulation/translation of more than one protein in oogenesis: in addition to Grk, the levels of Fs(1)K10 protein are known to be reduced (GHABRIAL et al. 1998 Down), and since grk and fs(1)K10 mutations do not exhibit karyosome defects, one might expect that an additional target of the checkpoint and Vasa regulation could be protein(s) involved in oocyte nuclear DNA compaction. It is even conceivable that such a protein(s) may be the more conserved target of a meiotic checkpoint.

It is curious that in Drosophila, activation of the checkpoint by mutations such as spn-D does not halt oogenesis entirely. It would seem more efficient if unrepaired DNA breaks would block the development of the entire egg chamber and not affect only a subset of proteins such as Gurken and Fs(1)K10. It has been demonstrated that in early egg chambers of spindle-class mutants development is delayed: the synaptonemal complexes, which normally resolve in region 2b of the germarium, persist into region 3 of the germarium and can still be found in stage 2 egg chambers (HUYNH and ST. JOHNSTON 2000 Down). Despite these delays in meiotic progression, the mutant egg chambers continue to develop, they reach a normal size, and are laid. This may reflect the substantial contributions of the nurse cells to oocyte development and the fact that the nurse cell cycle is independent of the cell cycle of the oocyte nucleus. Even though the nurse cells are connected to the oocyte via ring canals, a very effective system of cell cycle insulation must exist between these cells, given that the nurse cells undergo many rounds of endoreplication while the oocyte nucleus is progressing through prophase of meiosis I.

We suggest that during normal meiosis, the initial checkpoint-induced developmental delay is sufficient to allow full repair of all DNA breaks; however, under conditions in which damaged DNA cannot be fully repaired (e.g., spn class mutants), oogenesis eventually proceeds and is driven mainly by nurse cell development. In such cases, although development of the egg chamber proceeds, the downregulation of Gurken, FS(1)K10, and perhaps other oocyte-specific proteins is never relieved and the resulting eggs are morphologically abnormal. The need to independently regulate nurse and oocyte cell cycles may account for why the activation of the meiotic checkpoint does not have a more profound effect on the growth and development of the affected egg chamber. Alternatively, it is also possible that in Drosophila a salvage process is activated, similar to what has been described for yeast: in certain strains containing zip1, zip2, and dmc1 mutants, some cells complete sporulation after a delay in meiotic prophase progression (BAILIS et al. 2000 Down).


*  FOOTNOTES

Sequence data from this article have been deposited with the GenBank data libraries under accession no. AY257540. Back
1 These authors contributed equally to this work. Back


*  ACKNOWLEDGMENTS

We thank Gail Barcelo for her technical assistance in sequencing the spn-D mutants. A.G.-R. is grateful to Daniel St. Johnston for his support during the early stages of this work. Nick Brown, Bob Fleming, Steve Wasserman, Ruth McCaffrey, and the Bloomington Stock Center generously provided fly strains and reagents. This work was supported by the PHS Grant PO1CA41086 and by the Howard Hughes Medical Institute. A.G.-R. acknowledges the financial support of the Spanish Ministerio de Ciencia y Tecnologia (grant nos. PM99-0107 and BMC2001-4822-E), the Junta de Andalucia (CVI 724), and the EMBO Young Investigator Programme.

Manuscript received March 20, 2003; Accepted for publication May 23, 2003.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ABDU, U., M. BRODSKY, and T. SCHÜPBACH, 2002  Activation of a meiotic checkpoint during Drosophila oogenesis regulates the translation of gurken through Chk2/Mnk. Curr. Biol. 12(19):1645-1651.[Medline]

ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000  The genome sequence of Drosophila melanogaster.. Science 287(5461):2185-2195.[Abstract/Free Full Text]

ALBALA, J. S., M. P. THELEN, C. PRANGE, W. FAN, and M. CHRISTENSEN et al., 1997  Identification of a novel human RAD51 homolog, RAD51B.. Genomics 46:476-479.[Medline]

BAILIS, J. M., A. V. SMITH, and G. S. ROEDER, 2000  Bypass of a meiotic checkpoint by overproduction of meiotic chromosomal proteins. Mol. Cell. Biol. 20(13):4838-4848.[Abstract/Free Full Text]

BAUMANN, P. and S. C. WEST, 1998  Role of the human RAD51 protein in homologous recombination and double-stranded-break repair. Trends Biochem. Sci. 23:247-251.[Medline]

BISHOP, D. K., D. PARK, L. XU, and N. KLECKNER, 1992  DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69:439-456.[Medline]

BOYD, J. B., M. D. GOLINO, K. E. SHAW, C. J. OSGOOD, and M. M. GREEN, 1981  Third-chromosome mutagen-sensitive mutants of Drosophila melanogaster.. Genetics 97:607-623.[Abstract/Free Full Text]

CARTWRIGHT, R., A. M. DUNE, P. J. SIMPSON, C. E. TAMBINI, and J. THACKER, 1998a  Isolation of novel human and mouse genes of the recA/Rad51 recombination-repair gene familiy. Nucleic Acids Res. 26:1179-1184.[Abstract/Free Full Text]

CARTWRIGHT, R., C. E. TAMBINI, P. J. SIMPSON, and J. THACKER, 1998b  The XRCC2 DNA repair gene from human and mouse encodes a novel member of the recA/RAD51 family. Nucleic Acids Res. 26:3084-3089.[Abstract/Free Full Text]

DERNBURG, A. F., K. MCDONALD, G. MOULDER, R. BARSTEAD, and M. DRESSER et al., 1998  Meiotic recombination in C. elegans initiates by a conserved mechanism and is dispensable for homologous chromosome synapsis. Cell 94:387-398.[Medline]

DOSANJH, M. K., D. W. COLLINS, W. FAN, G. G. LENNON, and J. S. ALBALA et al., 1998  Isolation and characterization of RAD51C, a new member of the RAD51 family of related genes. Nucleic Acids Res. 26:1179-1184.

FLEMING, R. J., T. N. SCOTTGALE, R. J. DIEDERICH, and S. ARTAVANIS-TSAKONAS, 1990  The gene Serrate encodes a putative EGF-like transmembrane protein essential for proper ectodermal development in Drosophila melanogaster. Genes Dev. 4:2188-2201.[Abstract/Free Full Text]

GERTON, J. L. and J. L. DERISI, 2002  Mnd1p: an evolutionarily conserved protein required for meiotic recombination. Proc. Natl. Acad. Sci. USA 99:6895-6900.[Abstract/Free Full Text]

GHABRIAL, A. and T. SCHÜPBACH, 1999  Activation of a meiotic checkpoint regulates translation of Gurken during Drosophila oogenesis. Nat. Cell Biol. 1(6):354-357.[Medline]

GHABRIAL, A., R. P. RAY, and T. SCHÜPBACH, 1998  okra and spindle-B encode components of the RAD52 DNA repair pathway and affect meiosis and patterning in Drosophila oogenesis. Genes Dev. 12(17):2711-2723.[Abstract/Free Full Text]

GILLESPIE, D. E. and C. A. BERG, 1995  Homeless is required for RNA localization in Drosophila oogenesis and encodes a new member of the DE-H family of RNA-dependent ATPases. Genes Dev. 9:2495-2508.[Abstract/Free Full Text]

GODTHELP, B. C., W. W. WIEGANT, A. VAN DUIJN-GOEDHART, O. D. SCHÄRER, and P. P. W. VAN BUUL et al., 2002  Mammalian Rad51C contributes to DNA cross-link resistance, sister chromatid cohesion and genomic stability. Nucleic Acids Res. 30(10):2172-2182.[Abstract/Free Full Text]

GONZÁLEZ-REYES, A., H. ELLIOTT, and D. ST. JOHNSTON, 1997  Oocyte determination and the origin of polarity in Drosophila: the role of the spindle genes. Development 124:4927-4937.[Abstract]

GUPTA, R. C., E. FOLTA-STOGNIEW, S. O'MALLEY, M. TAKAHASHI, and C. M. RADDIN, 1999  Rapid exchange A:T base pairs is essential for recognition of DNA homology by human Rad51 recombination protein. Mol. Cell 5:705-714.

HABU, T., T. TAKI, A. WEST, Y. NISHIMUNE, and T. MORITA, 1996  The mouse and human homologs of DMCI, the yeast meiosis-specific homologous recombination gene, have a common unique form of exon-skipped transcript in meiosis. Nucleic Acids Res. 24:470-477.[Abstract/Free Full Text]

HUYNH, J. R. and D. ST. JOHNSTON, 2000  The role of BicD, Orb and the microtubules in the restriction of meiosis to the Drosophila oocyte. Development 127:2785-2794.[Abstract]

JASIN, M., 2000  Chromosome breaks and genomic instability. Cancer Invest. 18:78-86.[Medline]

KANAAR, R., J. H. HOEIJMAKERS, and D. C VAN GENT, 1998  Molecular mechanisms of DNA double strand break repair. Trends Cell Biol. 8(12):483-489.[Medline]

KAWABATA, M. and K. SAEKI, 1998  Sequence analysis and expression of a novel mouse homolog of Escherichia coli recA gene. Biochim. Biophys. Acta 1398:353-358.[Medline]

KURUMIZAKA, H., S. IKAWA, M. NAKADA, K. EDA, and W. KAGAWA et al., 2001  Homologous-pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc. Natl. Acad. Sci. USA 98:5538-5543.[Abstract/Free Full Text]

LIU, N., J. E. LAMERDIN, R. S. TEBBS, D. SCHILD, and J. D. TUCKER et al., 1998  XRCC2 and XRCC, new human Rad51-family members, promote chromosome stability and protect against DNA cross-links and other damage. Mol. Cell 1:783-793.[Medline]

MASSON, J.-Y., A. Z. STASIAK, A. STASIAK, F. E. BENSON, and S. C. WEST, 2001  Complex formation by the human RAD51C and XRCC3 recombination repair proteins. Proc. Natl. Acad. Sci. USA 98:8440-8446.[Abstract/Free Full Text]

MAZIN, A.V., E. ZAITSEVA, P. SUNG, and S. C. KOWALCZYKOWSKI, 2000  Tailed duplex DNA is the preferred substrate for Rad51 protein-mediated homologous pairing. EMBO J. 19:1148-1156.[Medline]

NILSON, L. A. and T. SCHÜPBACH, 1999  EGF receptor signaling in Drosophila oogenesis. Curr. Top. Dev. Biol. 44:203-243.[Medline]

QUES, F. and J. E. HABER, 1999  Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.. Microbiol. Mol. Biol. Rev. 63:349-404.[Abstract/Free Full Text]

PIERCE, A. J., R. D. JOHNSON, L. H. THOMPSON, and M. JASIN, 1999  XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev. 13:2633-2638.[Abstract/Free Full Text]

PITTMAN, D. L., L. R. WEINBERG, and J. C. SCHIMENTI, 1998  Identification, characterization, and genetic mapping of Rad51D, a new mouse and human Rad51/Reca-related gene. Genomics 49:103-111.[Medline]

QUEENAN, A. M., G. BARCELO, C. VAN BUSKIRK, and T. SCHÜPBACH, 1999  The transmembrane region of Gurken is not required for biological activity, but is necessary for transport to the oocyte membrane in Drosophila.. Mech. Dev. 89:35-42.[Medline]

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHILD, D., Y. C. LIO, D. W. COLLINS, T. TSOMONDO, and D. J. CHEN, 2000  Evidence for simultaneous protein interactions between human Rad51 paralogs. J. Biol. Chem. 275:16443-16449.[Abstract/Free Full Text]

SCHÜPBACH, T. and E. WIESCHAUS, 1991  Female sterile mutations on the second chromosome of Drosophila melanogaster. II. Mutations blocking oogenesis or altering egg morphology. Genetics 129:1119-1136.[Abstract]

SEKELSKY, J. J., M. H. BRODSKY, and K. C. BURTIS, 2000  DNA repair in Drosophila: insights from the Drosophila genome sequence. J. Cell Biol. 150(2):F31-F36.

SHINOHARA, A. H., H. OGAWA, Y. MATSUDA, N. USHIO, and K. IKEO et al., 1993  Cloning of human, mouse and fission yeast genes homologous to RAD51 and RecA. Nat. Genet. 4:239-243.[Medline]

SIBON, O. C., A. LAURENCON, R. HAWLEY, and W. E. THEURKAUF, 1999  The Drosophila ATM homologue Mei-41 has an essential checkpoint function at the midblastula transition. Curr. Biol. 6:302-312.

STROUMBAKIS, N. D., Z. LI, and P. P. TOLIAS, 1994  RNA- and single-stranded DNA binding (SSB) proteins expressed during Drosophila melanogaster oogenesis: a homologue of bacterial and eukaryotic mitochondrial SSBs. Gene 143:171-177.[Medline]

SUNG, P., 1997  Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by RAD51 recombinase. Genes Dev. 11:1111-1121.[Abstract/Free Full Text]

TEARLE, R. and C. NÜSSLEIN-VOLHARD, 1987  Tübingen mutants stocklist. Dros. Inf. Serv. 66:209-226.

TEBBS, R. S., Y. ZHAO, J. D. TUCKER, J. B. SCHEERER, and M. J. SICILIANO et al., 1995  Correction of chromosomal instability and sensitivity to diverse mutagens by a cloned cDNA of the XRCC3 DNA repair gene. Proc. Natl. Acad. Sci. USA 92:6354-6358.[Abstract/Free Full Text]

TOMANCAK, P., A. GUICHET, P. ZAVORSKY, and A. EPHRUSSI, 1998  Oocyte polarity depends on regulation of gurken by vasa.. Development 125:1723-1732.[Abstract]

VAN DEN BOSCH, M., P. H. LOHMAN, and A. PASTINK, 2002  DNA double-strand break repair by homologous recombination. Biol. Chem. 383(6):873-892.[Medline]

VAN DOREN, M., A. L. WILLIAMSON, and R. LEHMANN, 1998  Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr. Biol. 8:243-246.[Medline]




This article has been cited by other articles:


Home page
GeneticsHome page
T. L. Turner, M. T. Levine, M. L. Eckert, and D. J. Begun
Genomic Analysis of Adaptive Differentiation in Drosophila melanogaster
Genetics, May 1, 2008; 179(1): 455 - 473.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. S. Wei and Y. S. Rong
A Genetic Screen For DNA Double-Strand Break Repair Mutations in Drosophila
Genetics, September 1, 2007; 177(1): 63 - 77.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. M. Lake, K. Teeter, S. L. Page, R. Nielsen, and R. S. Hawley
A Genetic Analysis of the Drosophila mcm5 Gene Defines a Domain Specifically Required for Meiotic Recombination
Genetics, August 1, 2007; 176(4): 2151 - 2163.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
U. Abdu, M. Klovstad, V. Butin-Israeli, A. Bakhrat, and T. Schupbach
An essential role for Drosophila hus1 in somatic and meiotic DNA damage responses
J. Cell Sci., March 15, 2007; 120(6): 1042 - 1049.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Kuznetsov, M. Pellegrini, K. Shuda, O. Fernandez-Capetillo, Y. Liu, B. K. Martin, S. Burkett, E. Southon, D. Pati, L. Tessarollo, et al.
RAD51C deficiency in mice results in early prophase I arrest in males and sister chromatid separation at metaphase II in females
J. Cell Biol., February 26, 2007; 176(5): 581 - 592.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. McCaffrey, D. St Johnston, and A. Gonzalez-Reyes
Drosophila mus301/spindle-C Encodes a Helicase With an Essential Role in Double-Strand DNA Break Repair and Meiotic Progression
Genetics, November 1, 2006; 174(3): 1273 - 1285.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Lin, H. Kong, M. Nei, and H. Ma
Origins and evolution of the recA/RAD51 gene family: Evidence for ancient gene duplication and endosymbiotic gene transfer
PNAS, July 5, 2006; 103(27): 10328 - 10333.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
U. Abdu, D. Bar, and T. Schupbach
spn-F encodes a novel protein that affects oocyte patterning and bristle morphology in Drosophila
Development, April 15, 2006; 133(8): 1477 - 1484.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
W.E. THEURKAUF, C. KLATTENHOFF, D.P. BRATU, N. McGINNIS-SCHULTZ, B.S. KOPPETSCH, and H.A. COOK
rasiRNAs, DNA Damage, and Embryonic Axis Specification
Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 171 - 180.
[Abstract] [PDF]


Home page
Nucleic Acids ResHome page
C. Proudfoot and R. McCulloch
Distinct roles for two RAD51-related genes in Trypanosoma brucei antigenic variation
Nucleic Acids Res., December 2, 2005; 33(21): 6906 - 6919.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. Abe, K. Osakabe, S. Nakayama, M. Endo, A. Tagiri, S. Todoriki, H. Ichikawa, and S. Toki
Arabidopsis RAD51C Gene Is Important for Homologous Recombination in Meiosis and Mitosis
Plant Physiology, October 1, 2005; 139(2): 896 - 908.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
W. Li, X. Yang, Z. Lin, L. Timofejeva, R. Xiao, C. A. Makaroff, and H. Ma
The AtRAD51C Gene Is Required for Normal Meiotic Chromosome Synapsis and Double-Stranded Break Repair in Arabidopsis
Plant Physiology, June 1, 2005; 138(2): 965 - 976.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Di Giacomo, M. Barchi, F. Baudat, W. Edelmann, S. Keeney, and M. Jasin
Distinct DNA-damage-dependent and -independent responses drive the loss of oocytes in recombination-defective mouse mutants
PNAS, January 18, 2005; 102(3): 737 - 742.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Laurencon, C. M. Orme, H. K. Peters, C. L. Boulton, E. K. Vladar, S. A. Langley, E. P. Bakis, D. T. Harris, N. J. Harris, S. M. Wayson, et al.
A Large-Scale Screen for Mutagen-Sensitive Loci in Drosophila
Genetics, May 1, 2004; 167(1): 217 - 231.
[Abstract] [Full Text] [PDF]