- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Betrán, E.
- Articles by Long, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Betrán, E.
- Articles by Long, M.
Dntf-2r, a Young Drosophila Retroposed Gene With Specific Male Expression Under Positive Darwinian Selection
Esther Betrána and Manyuan Longaa Department of Ecology and Evolution, University of Chicago, Chicago, Illinois 60637
Corresponding author: Manyuan Long, University of Chicago, 1101 E. 57th St., Chicago, IL 60637., mlong{at}midway.uchicago.edu (E-mail)
Communicating editor: M. A. F. NOOR
| ABSTRACT |
|---|
A direct approach to investigating new gene origination is to examine recently evolved genes. We report a new gene in the Drosophila melanogaster subgroup, Drosophila nuclear transport factor-2-related (Dntf-2r). Its sequence features and phylogenetic distribution indicate that Dntf-2r is a retroposed functional gene and originated in the common ancestor of D. melanogaster, D. simulans, D. sechellia, and D. mauritiana, within the past 312 million years (MY). Dntf-2r evolved more rapidly than the parental gene, under positive Darwinian selection as revealed by the McDonald-Kreitman test and other evolutionary analyses. Comparative expression analysis shows that Dntf-2r is male specific whereas the parental gene, Dntf-2, is widely expressed in D. melanogaster. In agreement with its new expression pattern, the Dntf-2r putative promoter sequence is similar to the late testis promoter of ß2-tubulin. We discuss the possibility that the action of positive selection in Dntf-2r is related to its putative male-specific functions.
IT has been more than 3 decades since gene duplication was suggested to be a major source of evolutionary novelties (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Previous work (![]()
![]()
![]()
![]()
![]()
|
| MATERIALS AND METHODS |
|---|
Phylogenetic distribution of Dntf-2r:
The phylogenetic distribution of Dntf-2r was determined by FISH to polytene chromosomes, Southern analysis, and polymerase chain reactions on the species of the melanogaster subgroup: D. melanogaster, D. simulans, D. sechellia, D. mauritiana, D. yakuba, D. teissieri, D. erecta, and D. orena. A probe of
300 bp comprising the coding region of Dntf-2r was hybridized to polytene chromosomes of D. melanogaster, D. simulans, D. yakuba, and D. erecta following the ![]()
![]()
DNA samples and sequencing:
Single male fly genomic DNA was obtained using a Puregene kit. Dntf-2r and Dntf-2 were amplified by PCR from this genomic DNA. D. melanogaster samples come from a worldwide distribution: OK17, HG84, and Z(s)56 from Africa; yep3, yep18, yep25, Cof3, BLI5, cal4, y10, and y2 from Australia; 253.4, 253.27, 253.30, and 253.38 from Taiwan; Closs3, Closs10, Closs16, Closs19, and Seattle from the United States; Rio from Brazil; and Rinanga, Bdx, Besançon, Prunay, and Capri from France. Other stocks used were D. simulans from Florida (provided by J. Coyne), D. sechellia (provided by J. Coyne), D. mauritiana (163.1, ![]()
![]()
Sequence analysis:
Sequences were aligned by means of Clustal W (![]()
Synonymous and nonsynonynous substitutions per site (KS and KA) were computed following ![]()
![]()
![]()
), for different base frequencies at different codon positions, and for the genetic code structure (![]()
![]()
= 0; ![]()
![]()
![]()
2 distribution with as many degrees of freedom as the difference in number of variable parameters of the nested models (![]()
= KA/ KS) together with the estimate of
can be used to calculate KA and KS per branch and construct nonsynonynous and synonymous trees.
|
, the average number of nucleotide differences per site between two random sequences (![]()
W, Watterson's estimate of
from the number of segregating sites (![]()
= 4Neµ for autosomal loci and
= 3Neµ for X-linked loci, where Ne is the effective population size and µ is the neutral mutation rate. The difference between
and
W (Tajima's D) reveals nonequilibrium conditions in the history of the sample. Tajima's D (![]()
![]()
![]()
![]()
![]()
![]()
Under neutrality, intraspecific variation is correlated with interspecific divergence (![]()
![]()
![]()
![]()
![]()
Expression analysis:
Tissues were homogenized and total RNA was prepared, as described by the QIAGEN protocol, from
200 males and females, 15 virgin females, 15 gonadectomized males, 100 testes plus accessory glands, and 100 testes of D. melanogaster. Gonadectomized males (males from which we removed testes and accessory glands), testes plus accessory glands, and testes were obtained by dissecting mature males in saline solution. After dissection, tissues were preserved in RNA-later solution (Ambion, Austin, TX) at -20° after soaking them at 4° overnight until they were processed. mRNA was prepared from the total RNA of
200 males and females following the QIAGEN protocol.
The full-length sequence of the D. melanogaster Dntf-2r transcript from testis was obtained by 5' and 3' rapid amplification of cDNA ends (RACE) experiments. Single-strand cDNA was synthesized from mRNA using Superscript (GIBCO-BRL, Gaithersburg, MD). Oligo(dT) was used to prime the synthesis of the 3' end of the cDNA. Oligo(dT) and the specific primers 5' TTGTCCAGCAGTACTACGCC 3' and 5' TCGTCCTTGGAAGACTAAAA 3' were used to PCR amplify the 3' end. The nested PCR product was subcloned and sequenced. Primer 5' AGCCACGAAGAGGGATCCTC 3' was used to synthesize the 5' end of the Dntf-2r cDNA. This cDNA was tailed with dCTP by using terminal transferase (GIBCO-BRL 5' race system). Oligo(dG) adaptors and the nested primers 5' TTGGGCTTCAGCAAAAAGAT 3' and 5' GGGGATCGTCATCGCATTT 3' were used to PCR amplify the 5' end of the cDNA (GIBCO-BRL 5' race system).
RT-PCR was conducted on total RNA from virgin females, gonadectomized males, testes plus accessory glands, and testes for Dntf-2r and Dntf-2. Analysis of expression of intronless genes (such as Dntf-2r) is challenging because genomic contamination can produce a band of the same size as that expected from the cDNA. Therefore, we digested possible contaminating DNA from the total RNA (DNase I amplification grade; GIBCO-BRL) and ran controls including DNA-digested total RNA without retrotranscriptase. Single-strand complementary DNA (cDNA) was synthesized using Superscript and oligo(dT) (GIBCO-BRL). RT-PCR was carried out using specific primers 5' TTGTCCAGCAGTACTACGCC 3'/5' AGCCACGAAGAGGGATCCTC 3' for Dntf-2r and 5' TTGTGCAGCAGTACTATGCG 3'/5' GGCCACAAAGAAGGTGCCTG 3' for Dntf-2.
| RESULTS |
|---|
Structure of Dntf-2r:
The complete D. melanogaster Dntf-2r transcript is given in Fig 1. The transcript consists of the retroposed regions and recruits seven additional nucleotides from its 5' flanking region and four nucleotides from its 3' flanking region. Unlike jingwei (![]()
Phylogenetic distribution of Dntf-2r:
We dated the appearance of Dntf-2r by establishing which species have the duplication, using several complementary techniques. Fig 3A shows polytene in situ hybridization in D. melanogaster, D. simulans, D. yakuba, and D. erecta. Positive hybridization of Dntf-2r probe in band 2L36F is shown in D. melanogaster and D. simulans. Two additional signals (not shown) were observed in the D. melanogaster and D. simulans genome corresponding to Dntf-2 (X chromosome) and a lighter secondary signal (3R). Only two hybridization signals were observed in D. yakuba and D. erecta, in the X and 3R. Both signals are shown in D. erecta in addition to the lack of hybridization in 36F (2R in this species due to a pericentric inversion; see ![]()
|
Southern blot analysis (Fig 3B) shows extra strong bands in D. melanogaster, D. simulans, D. mauritiana, and D. sechellia corresponding to Dntf-2r. Fig 3C and Fig D, shows PCR with primers in the flanking and coding regions, respectively. A short product (lacking the Dntf-2r insertion) was obtained for D. yakuba, D. teissieri, and D. erecta (Fig 3C). The products from D. yakuba, D. teissieri, and D. erecta were sequenced. The sequence confirmed that this short fragment corresponds to the flanking region of Dntf-2r (Fig 4). In addition, primers in the coding region were unable to amplify Dntf-2r in D. yakuba, D. teissieri, and D. erecta (Fig 3D).
|
These data established that the distribution of Dntf-2r is limited to the four species in the D. melanogaster clade: D. melanogaster, D. simulans, D. sechellia, and D. mauritiana. Therefore, the Dntf-2r gene is between 3 and 12 million years old (i.e., the time length from the common ancestor of all D. melanogaster subgroup species to the four-species clade; see ![]()
Sequence analysis:
Sequence variants in the coding region for Dntf-2 and Dntf-2r in related species are shown in Table 1, and Table 2 shows variants for the noncoding region of Dntf-2 in D. melanogaster.
|
|
Divergence analyses were carried out using the consensus sequence for D. melanogaster and two alleles (haplotypes 1 and 2) for D. mauritiana (Table 2). Log-likelihood values and maximum-likelihood estimates of the KA/KS ratio for each branch of the tree for Dntf-2r and Dntf-2 sequences (Fig 2A) under several models are given in Table 3. A free-ratio model (B) was first applied to the data (![]()
ln L) = 25.94; P = 0.0038). Thus, we conclude that
(KA/KS) differs among different branches of the tree. However, model B does not differ significantly from model C, the six-ratio model (X2(5) = 0.12; P > 0.05). So, the six-ratio model is the simplest model that still contains all the information from the free model. Fig 2B shows the estimated numbers of synonymous and replacement substitutions per branch under model C. Now that we know that there are differences in KA/KS ratios along the tree, we want to answer two questions. Is DNTF-2R evolving faster than DNTF-2? If so, is positive Darwinian selection acting in any of the Dntf-2r lineages? We compared different models to answer these questions.
|
Model A vs. C [X2(5) = 25.82; P = 0.0001], A vs. D [X2(1) = 11.6; P = 0.0007], and A vs. F [X2(2) = 19.56; P = 0.00006] tests reveal that DNTF-2 evolved much more slowly than DNTF-2R (KA/KS = 0.0499 vs. KA/KS = 0.5405 on average, respectively). Model C does not differ from model F [X2(3) = 6.26; P > 0.05], showing that KA/KS for Dntf-2 is on average very small:
0.0502. Thus, Dntf-2 evolved under strong purifying selection, suggesting high functional constraint. The significantly accelerated evolution of DNTF-2R (A vs. D and A vs. F) can be the result of two different phenomena: relaxation of selection or positive Darwinian selection for novel function after the duplication. Relaxation of selection would occur if the protein product translated from Dntf-2r is under less constraint than the protein from Dntf-2. However, if amino acid substitutions in a lineage occur faster than the neutral rate, KA/KS ratios will exceed 1, revealing the action of positive selection.
Relaxation of selective constraints and positive selection in Dntf-2r can be investigated by considering additional models. Model F is significantly more likely than both model D [X2(1) = 7.96; P = 0.0048] and model E [X2(2) = 12.48; P = 0.00195], and model G is more likely than model E [X2(1) = 10.92; P = 0.00095], revealing that KA/KS ratios are significantly <1 in some Dntf-2r lineages (12-1, 12-2, 9-10, 9-5, and 8-9). Thus, we see clear effects of purifying selection in these branches (KA/KS
0.33), indicating functional constraint for this gene. However, KA/KS ratios could be larger than or equal to one in segments 11-12, 11-3, 10-11, and 10-4 because model F is not a significant improvement over model G [X2(1) = 1.56; P > 0.05]which does not support the action of positive selection. Significance of the other likelihood-ratio tests remains after correcting for multiple comparisons (Bonferroni correction, P < 0.005; ![]()
We have shown that the KA/KS ratio that maximizes the likelihood is
0.33 in some Dntf-2r lineages and
1.0000 in others. However, these values do not discriminate between the alternatives of relaxation of selection or positive selection on Dntf-2r. This is because the boundary KA/KS > 1 sets a high threshold for testing positive selection (![]()
![]()
Polymorphism data (Table 1 and Table 2) were analyzed next. Levels of variation at synonymous and nonsynonymous sites and sites in noncoding regions were calculated (Table 4). The Dntf-2 sequence is variable only in noncoding regions, confirming the action of strong purifying selection on its coding region. Tajima's D for Dntf-2 was 0.7416 (P > 0.10); i.e., the frequency spectrum shows no deviation from neutrality.
|
We detected variation in the coding region for Dntf-2r in D. melanogaster (Table 1 and Table 4). Tajima's D for Dntf-2r was -0.45276 (P > 0.10) and Fay and Wu's H was -1.8338 (P = 0.0752; assuming the value of back mutation of 0.10 and recombination rate estimated for the data, 0.0344 per base, and using Dntf-2 of D. melanogaster as ancestral sequence). Although the frequency spectrum of Dntf-2r variation in the coding region shows no deviation from neutrality, the negative Fay and Wu's H is at a marginal level of significance, suggesting that the three derived sites (117, 239, and 303) are at high frequency. Thus, these derived alleles may have been driven by the effects of positive Darwinian selection. While these tests can detect selection, they have power to detect it only for a short time (
0.5N generations in the favorable case of no recombination; ![]()
![]()
0.05 MY if we consider 106 as the population size and 10 generations per year for Drosophila.
The McDonald-Kreitman test (![]()
![]()
|
Dntf-2r expression and promoter analysis:
RT-PCR results for Dntf-2r and Dntf-2 in different tissues of D. melanogaster are shown in Fig 5. We differentially amplified the two genes with specific primers. We observed that while Dntf-2 is expressed in all tissues studied, Dntf-2r is expressed only in testes.
|
The ß2-tubulin gene has a late testis-specific promoter (![]()
![]()
Examination of the flanking region of the insertion site in D. teissieri, D. yakuba, and D. erecta (outgroups lacking the insertion; Fig 4) reveals similarity to the 5' putative promoter sequence of Dntf-2r in D. melanogaster. The GGATATT putative quantitative element is present in these outgroup sequences as well as three nucleotides TAG of the putative Dntf-2r upstream element (see Fig 4). This would favor the hypothesis that Dntf-2r developed a new promoter with late testis expression after retroposition by acquiring only a few modifications to the preexisting 5' sequence.
| DISCUSSION |
|---|
We investigated evolution of a recently originated gene and its parental copy in D. melanogaster, Dntf-2r (CG10174) and Dntf-2 (CG1740). Sequence comparison revealed that the new gene was generated in a retroposition event. Recent work on the parental copy Dntf-2 in D. melanogaster revealed that this gene, playing a role in the nuclear transport of proteins with nuclear localization signals, is essential for the antimicrobial immune response (![]()
0.05 between D. melanogaster and D. yakuba.
On the other hand, there was no information on the function of Dntf-2r. Our sequence analyses of divergence and polymorphism for this gene, as well as our expression evidence, indicate that this gene may produce a functional protein. First, we observed that polymorphism is higher for synonymous than for replacement sites:
R/
S = 0.11 (Table 4), revealing the action of purifying selection. Second, KA/KS ratios for substitutions in Dntf-2r are on average significantly lower than unity (
0.5), which is not consistent with the hypothesis that the gene is a pseudogene in many of the species. The KA/KS ratio of
0.5 for Dntf-2r is higher than that for Dntf-2. However, the McDonald-Kreitman test revealed a significant excess of amino acid substitutions, suggesting that the accelerated protein sequence evolution is likely a consequence of the action of positive Darwinian selection. Consistent with this interpretation, the Fay-Wu test, with an H statistic of marginal significance, gives a strong hint of an excess of high-frequency variants that would be coupled with the fixation of beneficial mutations. Thus, both purifying selection and adaptive evolution detected in these analyses argue that Dntf-2r encodes a protein, possibly with an evolving novel function. Dntf-2r provides new evidence for the role of positive Darwinian selection in the origin of new genes.
Whether or not a retroposed sequence recruits a new promoter is a critical step to its future fate. If a retroposed sequence integrates in a genomic region devoid of expression potential, it would be doomed to evolve into a pseudogene (![]()
![]()
An accelerated rate of evolution has been widely observed in some reproduction-related genes, probably due to competition among sperm from different males, female choice, and/or intersexual genomic conflict (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
It is known that, in Drosophila, X inactivation occurs early in spermatogenesis (![]()
![]()
40 MYA (![]()
![]()
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with EMBL/GenBank Data Libraries under accession nos.
AY15076365,
AY150768,
AY15077073,
AY15077578,
AY15078087,
AY15078990,
AY15079293,
AY15079697, and
AY301039,
AY301040,
AY301041,
AY301042,
AY301043,
AY301044,
AY301045,
AY301046,
AY301047,
AY301048,
AY301049,
AY301050,
AY301051,
AY301052,
AY301053,
AY301054,
AY301055,
AY301056,
AY301057,
AY301058,
AY301059,
AY301060,
AY301061. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank J. Coyne, P. Gibert, F. Lemeunier, and M.-L. Wu for providing Drosophila strains used in this work; Janice Spofford for critically reading the manuscript; and members of the Long lab, especially Kevin Thornton, for valuable discussions. We also thank two anonymous reviewers for their comments and corrections that improved the manuscript. This work was supported by grants from National Science Foundation (Career Award) and Packard Fellowship in Science and Engineering to M.L.
Manuscript received September 20, 2002; Accepted for publication March 4, 2003.
| LITERATURE CITED |
|---|
AGUADÉ, M., 1999 Positive selection drives the evolution of the Acp29AB accessory gland protein in Drosophila. Genetics 152:543-551.
Analysis of the genome sequence of the flowering plant Arabidopsis thaliana.. (2000) Nature 408:796-815.[Medline]
ASHBURNER, M., 1989 Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BALL, C. A. and J. M. CHERRY, 2001 Genome comparisons highlight similarity and diversity within the eukaryotic kingdoms. Curr. Opin. Chem. Biol. 5:86-89.[Medline]
BEGUN, D., 1997 Origin and evolution of a new gene descended from alcohol dehydrogenase in Drosophila. Genetics 145:375-382.[Abstract]
BETRÁN, E. and M. LONG, 2002 Expansion of genome coding regions by acquisition of new genes. Genetica 115(1):65-80.[Medline]
BETRÁN, E., K. THORNTON, and M. LONG, 2002 Retroposed new genes out of the X in Drosophila.. Genome Res. 12:1854-1859.
BHATTACHARYA, A. and R. STEWARD, 2002 The Drosophila homolog of NTF-2, the nuclear transport factor-2, is essential for immune response. EMBO Rep. 3(4):378-383.[Medline]
BLANC, G., A. BARAKAT, R. GUYOT, R. COOKE, and M. DELSENY, 2000 Extensive duplication and reshuffling in the Arabidopsis genome. Plant Cell 12:1093-1101.
EBERHARD, W. G., 1985 Sexual Selection and Animal Genitalia. Harvard University Press, Cambridge, MA.
FAY, J. C. and C.-I WU, 2000 Hitchhiking under positive Darwinian selection. Genetics 155:1405-1413.
GOLDMAN, N. and Z. YANG, 1994 A codon-based model of nucleotide substitution for protein-coding DNA sequences. Mol. Biol. Evol. 11:725-736.[Abstract]
GU, Z., A. CAVALCANTI, F-C. CHEN, P. BOUMAN, and W.-H. LI, 2002 Extent of gene duplication in the genomes of Drosophila, nematode, and yeast. Mol. Biol. Evol. 19:256-262.
JEFFS, P. and M. ASHBURNER, 1991 Processed pseudogenes in Drosophila.. Proc. R. Soc. Lond. Ser. B 244:151-159.[Medline]
KIMURA, M., 1983 The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge, UK.
KREITMAN, M. and H. AKASHI, 1995 Molecular evidence for natural selection. Annu. Rev. Ecol. Syst. 26:403-422.
LACHAISE, D., M.-L. CARIOU, J. R. DAVID, F. LEMEUNIER, and L. TSACAS et al., 1988 Historical biogeography of the Drosophila melanogaster species subgroup. Evol. Biol. 22:159-225.
LEMEUNIER, F. and M. ASHBURNER, 1976 Relationships in the melanogaster species subgroup of the genus Drosophila (Sophophora). II. Phylogenetic relationships between six species based upon polytene banding sequences. Proc. R. Soc. Lond. Ser. B 193:257-294.
LI, W. H., 1997 Molecular Evolution. Sinauer Associates, Sunderland, MA.
LI, W. H., Z. GU, H. WANG, and A. NEKRUTENKO, 2001 Evolutionary analyses of the human genome. Nature 409:847-849.[Medline]
LIFSCHYTZ, E. and D. L. LINDSLEY, 1972 The role of X-chromosome inactivation during spermatogenesis. Proc. Natl. Acad. Sci. USA 69:182-186.
LLOPART, A., J. M. COMERON, F. BRUNET, D. LACHAISE, and M. LONG, 2002 Intron presence/absence polymorphism in Drosophila driven by positive Darwinian selection. Proc. Natl. Acad. Sci. USA 99(12):8121-8126.
LONG, M., 2001 Evolution of novel genes. Curr. Opin. Genet. Dev. 11(6):673-680.[Medline]
LONG, M. and C. H. LANGLEY, 1993 Natural selection and the origin of jingwei, a chimeric processed functional gene in Drosophila. Science 260:91-95.
LONG, M., W. WANG, and J. ZHANG, 1999 Origin of new genes and source for N-terminal domain of the chimerical gene, jingwei, in Drosophila.. Gene 238:135-141.[Medline]
MCDONALD, J. H. and M. KREITMAN, 1991 Adaptative protein evolution at the Adh locus in Drosophila.. Nature 351:652-654.[Medline]
METZ, E. C. and S. R. PALUMBI, 1996 Positive selection and sequence rearrangements generate extensive polymorphism in the gamete recognition protein binding. Mol. Biol. Evol. 13:397-406.[Abstract]
MICHIELS, F., A. GASCH, B. KALTSCHMIDT, and R. RENKAWITZ-POHL, 1989 A 14 bp promoter element directs the testis specificity of the Drosophila beta 2 tubulin gene. EMBO J. 8:1559-1565.[Medline]
NIELSEN, R., 2001 Statistical tests of selective neutrality in the age of genomics. Heredity 86:641-647.[Medline]
NURMINSKY, D. I., M. V. NURMINSKAYA, D. DE AGUIAR, and D. L. HARTL, 1998 Selective sweep of a newly evolved sperm-specific gene in Drosophila. Nature 396:572-575.[Medline]
NURMINSKY, D., D. DE AGUILAR, C. D. BUSTAMANTE, and D. L. HARTL, 2001 Chromosomal effects of rapid gene evolution in Drosophila melanogaster. Science 291:128-130.
OHNO, S., 1970 Evolution by Gene Duplication. Springer, Berlin.
OTTO, S. P., 2000 Detecting the form of selection from DNA sequence data. Trends Genet. 16:526-529.[Medline]
POWELL, J. R., 1997 Progress and Prospects in Evolutionary BiologyThe Drosophila Model. Oxford University Press, New York.
ROZAS, J. and R. ROZAS, 1999 DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.
RUBIN, G. M., M. D. YANDELL, J. R. WORTMAN, G. L. G. MIKLOS, and C. R. NELSON et al., 2000 Comparative genomics of the eukaryotes. Science 287:2204-2215.
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SIMONSEN, K. L., G. A. CHURCHILL, and C. F. AQUADRO, 1995 Properties of statistical tests of neutrality for DNA polymorphism data. Genetics 141:413-429.[Abstract]
SOKAL, R. R., and F. J. ROHLF, 1995 Biometry. Freeman, San Francisco.
SWANSON, W. J., C. F. AQUADRO, and V. D. VACQUIER, 2001a Polymorphism in abalone fertilization proteins is consistent with the neutral evolution of the egg's receptor for lysin (VERL) and positive Darwinian selection of sperm lysin. Mol. Biol. Evol. 18:376-383.
SWANSON, W. J., A. G. CLARK, H. M. WALDRIP-DAIL, M. F. WOLFNER, and C. F. AQUADRO, 2001b Evolutionary EST analysis identifies rapidly evolving male reproductive proteins in Drosophila. Proc. Natl. Acad. Sci. USA 98:7375-7379.
TAJIMA, F., 1989 Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595.
TING, C.-T., S.-C. TSAUR, M. L. WU, and C.-I WU, 1998 A rapidly evolving homeobox at the site of a hybrid sterility gene. Science 282:1501-1504.
TING, C.-T., S.-C. TSAUR, and C.-I WU, 2000 The phylogeny of closely related species as revealed by the genealogy of a speciation gene, Odysseus. Proc. Natl. Acad. Sci. USA 97:5313-5316.
THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.
TSAUR, S. C., C. T. TING, and C.-I WU, 1998 Positive selection driving the evolution of a gene of male reproduction, Acp26Aa, of Drosophila: II. Divergence versus polymorphism. Mol. Biol. Evol. 15:1040-1046.[Abstract]
WANG, W., J. ZHANG, C. ALVAREZ, A. LLOPART, and M. LONG, 2000 The origin of the Jingwei gene and the complex modular structure of its parental gene, yellow emperor, in Drosophila melanogaster. Mol. Biol. Evol. 17:1294-1301.
WANG, W., F. G. BRUNET, E. NERO, and M. LONG, 2002 Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 99(7):4448-4453.
WATTERSON, G. A., 1975 On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 7:256-276.[Medline]
WYCKOFF, G. J., W. WANG, and C.-I WU, 2000 Rapid evolution of male reproductive genes in the descent of man. Nature 403:304-309.[Medline]
YANG, Z., 1997 PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13:555-556.
YANG, Z., 1998 Likelihood ratio tests for detecting positive selection and application to primate lysozyme evolution. Mol. Biol. Evol. 15:568-573.[Abstract]
YI, S. and B. CHARLESWORTH, 2000 A selective sweep associated with a recent gene transposition in Drosophila miranda.. Genetics 156:1753-1763.
This article has been cited by other articles:
![]() |
Q. Zhou, G. Zhang, Y. Zhang, S. Xu, R. Zhao, Z. Zhan, X. Li, Y. Ding, S. Yang, and W. Wang On the origin of new genes in Drosophila Genome Res., September 1, 2008; 18(9): 1446 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Llopart and J. M. Comeron Recurrent Events of Positive Selection in Independent Drosophila Lineages at the Spermatogenesis Gene roughex Genetics, June 1, 2008; 179(2): 1009 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Mikhaylova, K. Nguyen, and D. I. Nurminsky Analysis of the Drosophila melanogaster Testes Transcriptome Reveals Coordinate Regulation of Paralogous Genes Genetics, May 1, 2008; 179(1): 305 - 315. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bhutkar, S. M. Russo, T. F. Smith, and W. M. Gelbart Genome-scale analysis of positionally relocated genes Genome Res., December 1, 2007; 17(12): 1880 - 1887. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Thornton The Neutral Coalescent Process for Recent Gene Duplications and Copy-Number Variants Genetics, October 1, 2007; 177(2): 987 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-S. Shiao, P. Khil, R. D. Camerini-Otero, T. Shiroishi, K. Moriwaki, H.-T. Yu, and M. Long Origins of New Male Germ-line Functions from X-Derived Autosomal Retrogenes in the Mouse Mol. Biol. Evol., October 1, 2007; 24(10): 2242 - 2253. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Begun, H. A. Lindfors, A. D. Kern, and C. D. Jones Evidence for de Novo Evolution of Testis-Expressed Genes in the Drosophila yakuba/Drosophila erecta Clade Genetics, June 1, 2007; 176(2): 1131 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Betran, Y. Bai, and M. Motiwale Fast Protein Evolution and Germ Line Expression of a Drosophila Parental Gene and Its Young Retroposed Paralog Mol. Biol. Evol., November 1, 2006; 23(11): 2191 - 2202. [Abstract] [Full Text] [PDF] |
||||
![]() |







