- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Ash, J.
- Articles by Whiteway, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Ash, J.
- Articles by Whiteway, M.
Genetic Analysis of the Interface Between Cdc42p and the CRIB Domain of Ste20p in Saccharomyces cerevisiae
Josée Asha, Cunle Wua, Robert Larocquea, Maleek Jamala, Willem Stevensb, Mike Osborneb, David Y. Thomas1,a,c,d, and Malcolm Whitewaya,ca Genetics, National Research Council, Biotechnology Research Institute, Montreal, Quebec H4P 2R2, Canada
b Biomolecular NMR, National Research Council, Biotechnology Research Institute, Montreal, Quebec H4P 2R2, Canada
c Biology Department, McGill University, Montreal, Quebec H3A 1B1, Canada
d Anatomy and Cell Biology, McGill University, Montreal, Quebec H3A 1B1, Canada
Corresponding author: Malcolm Whiteway, National Research Council, Biotechnology Research Institute, 6100 Royalmount Ave., Montreal, Quebec H4P 2R2, Canada., malcolm.whiteway{at}nrc.ca (E-mail)
Communicating editor: B. J. ANDREWS
| ABSTRACT |
|---|
Mutagenesis was used to probe the interface between the small GTPase Cdc42p and the CRIB domain motif of Ste20p. Members of a cluster of hydrophobic residues of Cdc42p were changed to alanine and/or arginine. The interaction of the wild-type and mutant proteins was measured using the two-hybrid assay; many, but not all, changes reduced interaction between Cdc42p and the target CRIB domain. Mutations in conserved residues in the CRIB domain were also tested for their importance in the association with Cdc42p. Two conserved CRIB domain histidines were changed to aspartic acid. These mutants reduced mating, as well as responsiveness to pheromone-induced gene expression and cell cycle arrest, but did not reduce in vitro the kinase activity of Ste20p. GFP-tagged mutant proteins were unable to localize to sites of polarized growth. In addition, these point mutants were synthetically lethal with disruption of CLA4 and blocked the Ste20p-Cdc42p two-hybrid interaction. Compensatory mutations in Cdc42p that reestablished the two-hybrid association with the mutant Ste20p CRIB domain baits were identified. These mutations improved the pheromone responsiveness of cells containing the CRIB mutations, but did not rescue the lethality associated with the CRIB mutant CLA4 deletion interaction. These results suggest that the Ste20p-Cdc42p interaction plays a direct role in Ste20p kinase function and that this interaction is required for efficient activity of the pheromone response pathway.
A member of the small GTPase superfamily, Cdc42p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Cdc42p function has been extensively studied in the yeast Saccharomyces cerevisiae, where there are three members of the STE20/PAK kinase family: Ste20p, the founding member (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The role of Cdc42p in activation of the pheromone response pathway has been controversial. Initial evidence suggested a direct role because Cdc42p was required for pheromone induction of gene expression (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
DNA purification:
Total yeast DNA was isolated as described (![]()
DNA sequencing:
The concentration of the plasmid DNA to be sequenced was determined by fluorimetry using the DyNA Quant 220 (Hoefer, San Francisco) following the manufacturer's protocol. Sequencing was done with the dRhodamine kit (Perkin-Elmer, Norwalk, CT) and was analyzed on a 377 XL DNA sequencer (Applied Biosystems, Foster City, CA).
PCR:
PCR was done using the standard protocol from the Expand High Fidelity PCR kit (Roche, Indianapolis).
Oligonucleotides:
The following oligonucleotides were used:
- KOLI22: CCACTACAATGGATGATG
- ORL19: TTTGTATACACTTATTTTTTTTATAAC
- ORL72: CTACAAAATaGtACtTTTTTTACTTTTCTTG, ScaI
- ORL71: CAAGAAAAGTAAAAAaGTaCtATTTTGTAG, ScaI
- ORL59: CAATGCCAAGgATATCCACCATG, EcoRV
- ORL60: CATGGTGGATATcCTTGGCATTG, EcoRV
- ORL61: GCATATCCACgAcGTcGGCGTGGACTCC, AatII
- ORL62: GGAGTCCACGCCgACgTcGTGGATATGC, AatII
- KOLI42: GATCCTCGACTAAAGATCTTAATGAGCAATGATCC, BglII
- OAF3: CTTCCAATGCATTGGCTGCAGCTAAGAATTCATGACGGGTGATTT, PstI
- OJA33: CCATATGCAAACGCgtAAGTGTGTTGTTGTCG, MluI
- OJA34: CGACAACAACACACTTacGCGTTTGCATATGG, MluI
- OJA37: CTATGCGGTGACgcgtATGATTGGTGATGAACC, MluI
- OJA38: GGTTCATCACCAATCATAcgcGTCACCGCATAG, MluI
- OJA41: GGTGATGAACCAcgTACGTTAGGTTTG, BsiWI
- OJA42: CAAACCTAACGTAcgTGGTTCATCACC, BsiWI
- OJA43: GGTGATGAGgCCggcTACGTTAGGTTTG, NaeI
- OJA44: CAAACCTAACGTAgccGGcTCATCACC, NaeI
- OJA45: CGATGAAGCTcgaGTGGCCGCCTTG, XhoI
- OJA46: CAAGGCGGCCACtcgAGCTTCATCG, XhoI
- OJA47: CGATGAAGCTgcaGTGGCCGCCTTG, PstI
- OJA48: CAAGGCGGCCACtgcAGCTTCATCG, PstI.
The specific restriction sites noted are underlined, and the nucleotides changed for the mutagenesis are in lowercase letters.
Two-hybrid plasmids and the construction of site-directed mutants in CDC42:
Plasmid pVL7 consists of the entire coding sequence of KSS1 (![]()
![]()
![]()
![]()
![]()
Construction of CRIB domain mutants:
Plasmid pAF3 (![]()
![]()
![]()
Construction of CRIB domain mutant-GFP fusions:
Plasmid pRL116 (![]()
![]()
![]()
Construction of random mutants of CDC42:
Plasmid pRL202 was used as a template for Taq polymerase-mediated PCR using oligonucleotides KOLI22 and ORL19. The PCR products were gel purified and cloned into EcoRI- and BamHI-linearized pGAD424 by in vivo recombination to generate a library of CDC42 genes mutated at the frequency characteristic of Taq polymerase nucleotide misincorporation. The library was generated in strain L40 already transformed with the pBTM116 derivative plasmid pRL155, and LEU2+ TRP1+ transformants were selected. These transformants were screened by replica plating to identify colonies that generated a plasmid-based growth on medium lacking histidine and containing 5 mM 3-aminotriazole (3-AT).
Separation of double mutants:
Plasmid pMJ13 contained two mutations, N39S and P69T. These were separated by digesting pMJ13 with EagI and SnaBI, which generates a 1.65-kb fragment containing the N39S mutation and a 5.6-kb fragment with the P69T mutation. An equivalent digestion of pRL202 was performed, and the fragment pairs were ligated together to generate plasmids with the separated mutations. Plasmids containing the independent mutations were sequenced, and a plasmid with N39S was designated pJA49, and P69T was designated pJA50.
Transfer of N39S and P69T mutations:
The N39S and P69T mutations were transferred to the wild-type CDC42 gene. In plasmid pRS315 CDC42 (![]()
Strain constructions:
Strains are listed in Table 1. Strains JAY25 and JAY26 were derived from strain W303-1A by replacing, respectively, the histidines 345 and 348 of STE20 with aspartic acid. SalI to BamHI fragments of 1.1 kb containing the mutated region of STE20 from pRL155 and pRL156 were subcloned into pRS306 cut with SalI and BamHI to create plasmids pJA45 and pJA46. Plasmids pJA45 (H345D) and pJA46 (H348D) were targeted to the STE20 locus by cleavage with ClaI, leading to duplication of the STE20 locus flanking the vector and URA3 marker. Loop-outs of the URA3 marker were identified by growth on medium with 5-fluoroorotic acid (5-FOA), and strains with the histidines replaced with asparagines were detected as showing reduced mating in 4-hr mating tests. These replacement alleles were confirmed by digesting PCR products generated from strains JAY25 and JAY26 using oligonucleotides ORL1 and ODH77 with the diagnostic restriction enzymes AatII for JAY25 and EcoRV for JAY26. Subsequently, strains JAY25 and JAY26, together with W303-1A, were transformed to sst1::URA3 using plasmid pJGsst1 (![]()
|
ß-Galactosidase assays:
For the assay with strains JAY39, JAY40, and JAY54, induction with 0.4 µg/ml of
-mating factor was done for 2 hr prior to the ß-gal assays. Standard conditions were used for ß-gal assays (![]()
Quantitative mating:
Quantitative matings were done on filter discs as described (![]()
Kinase assays:
In vitro kinase assays were performed essentially as described (![]()
-32P]ATP (10 µCi/µl at 6000 Ci/mmol) and 2 µg of myelin basic protein (MBP), and the reactions were incubated at 30° for 15 min. One set of mock reactions processed without addition of [
-32P]ATP was used for Western blot analysis to reveal the amount of Ste20p in the immune complexes.
Preparation of total yeast cell extracts:
Overnight cultures were diluted 1:20 and grown in selective media to an A600 of 1.0. A total of 1 ml of these cultures was harvested by centrifugation at 3000 x g and resuspended in 100 µl of loading buffer. Cells were then disrupted by boiling for 5 min. The extracts were clarified by centrifugation in a microcentrifuge at top speed for 10 min at room temperature. Twenty microliters of the supernatants was loaded on 12% SDS-PAGE gels.
Western blot analysis:
Protein samples were resolved on 12% SDS-PAGE and transferred on Immobilon-P membrane (Millipore, Bedford, MA). The membranes were probed first with affinity-purified anti-CDC42 antiserum, incubated with anti-rabbit HRP (Santa-Cruz), and developed using Lumilight Plus chemiluminescent substrate (Roche). The anti-Cdc42p antibody was raised in rabbits against purified bacterially expressed glutathione S-transferase (GST)-Cdc42p. The antibody was affinity purified against GST-Cdc42p immobilized on nitrocellulose membranes essentially as described (![]()
Fluorescence microscopy:
Cells of strain YCW563 containing the plasmids pRL116C.4, pJA82, pJA83, pRS315:CDC42, and pJA55 were grown overnight in selective medium. GFP was visualized with a Leica DMIRE2 inverted microscope (Leica Microsystemes, Montreal) equipped with a Hamamatsu cooled CCD camera and a Ludl motorized stage at x630 magnification. Openlab software (Improvision, Lexington, MA) and Adobe Photoshop were used for image acquisition and manipulation. Pheromone treated cells were incubated in the presence of 74 µg/ml
-factor for 3 hr to trigger shmoo formation.
| RESULTS |
|---|
Recent structural studies (![]()
![]()
![]()
![]()
Hydrophobic residues of Cdc42p are involved in association with Ste20p:
NMR analyses have identified residues of Cdc42p whose resonances are modified through an interaction with CRIB domain peptides (![]()
![]()
![]()
|
|
Conserved residues in the Ste20p CRIB domain are necessary for protein function:
An alignment of CRIB domains from several proteins has defined a core consensus region of 12 amino acids (![]()
Previous work had shown that the CRIB domain of the Ste20p kinase was essential for the Ste20p kinase to support cellular growth in the absence of Cla4p (![]()
![]()
Strains containing the H345D and H348D alleles were assayed for the effects of the mutations on Ste20p function in the pheromone response pathway. In contrast to the complete deletion of the CRIB domain, which had essentially no effect on the response of cells to mating (![]()
![]()
-factor, strains JAY39 and JAY40 generated 13 and 11 Miller units of activity, respectively, while the wild-type control strain JAY54 generated 120 Miller units under the same conditions. Thus the CRIB domain mutations also reduced pheromone-responsive gene induction
10-fold (Fig 4, rows 1, 6, and 11).
|
|
We determined the catalytic activity of the Ste20p kinase containing the modified histidines. The Ste20p kinase was immunoprecipitated from strains W303-1A, JAY25, and JAY26 as described (![]()
|
The loss of biological function in the absence of modification to the kinase activity suggested that some other aspect of Cdc42p function was compromised. We constructed GFP fusions to the CRIB domain point mutants of Ste20p to analyze cellular localization. Previous work had established that wild-type Ste20p localized to sites of polarized growth and was concentrated in small buds and at the tips of larger buds (![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Conserved residues in the Ste20p CRIB domain are necessary for association with Cdc42p:
Both histidine substitution mutants dramatically affected the Ste20p-Cdc42p interaction as measured by the two-hybrid assay. Two-hybrid DNA-binding domain chimeras of the STE20 N terminus containing the wild-type sequence (pAF3), the H345D allele (pRL155), or the H348 allele (pRL156) were tested with the Cdc42p activation domain chimera pRL202. As shown in Fig 7, both the H345D and the H348D mutations reduced the two-hybrid association signal to background levels, showing that the residues are involved in the interaction between the two proteins.
|
The two-hybrid interaction assay was used to identify mutant versions of Cdc42p that could reestablish protein-protein interaction with a bait plasmid containing the H345D version of the Ste20p CRIB domain. Plasmid pRL202 was subjected to random PCR mutagenesis as described in MATERIALS AND METHODS. The mutagenized PCR product was cotransformed with BamHI- and SalI-linearized plasmid pGAD424 (![]()
2000 transformants screened that reproducibly provided plasmid-dependent HIS3+ activity in strain L40 containing pRL155. Sequencing this plasmid (pMJ13) established that it contained two nucleotide substitutions (A234 to C234 and A567 to C567) that resulted in two amino acid substitutions in Cdc42p, N39S, and P69T. We tested whether both substitutions were necessary for the reestablishment of the two-hybrid interaction with pRL155 by constructing derivatives of pRL202 with the two single mutations. Neither plasmid pJA49, containing the N39S substitution, nor plasmid pJA50, containing the P69T substitution, gave a strong two-hybrid interaction with pRL155. We also tested the specificity of the double mutant. pMJ13 had a normal two-hybrid interaction with pAF3, showing that the amino acid substitutions did not block interaction between the mutant Cdc42 protein and the wild-type CRIB domain. In addition, the double mutant was capable of interacting with pRL156, which contains the H348D substitution. However, the protein was still specific for interaction with the Ste20 N terminus; the mutant Cdc42p construct did not show any interaction with pVL7, which contains the Kss1p kinase (![]()
We investigated whether other combinations of mutations could reestablish the two-hybrid interaction with pRL155 containing the H435D substitution. Plasmids pJA49 and pJA50 were used as templates for a round of PCR mutagenesis as described. Mutant plasmids that conferred growth of L40 transformed with pRL155 on plates with 5 mM 3-AT were identified and sequenced (Table 2). When pJA49 (N39S) was used as a template, we identified two plasmids in which P69 was mutated to T, regenerating the combination identified in pMJ13. In addition to P69T, we found that G60S, G12S, G12H, D65G, and Y64H mutations in combination with N39S could confer growth in the presence of 5 mM 3-AT. When pJA50 (P69T) was used as the template, we identified three plasmids with the N39S mutation. In addition, we identified the Y64H change that also was found together with the N39S substitution. Finally, we identified one triple-mutant combination, which had both the N39S and the G12S substitutions, together with the template P69T change.
|
We determined whether the N39S P69T allele of Cdc42p was able to improve the function of Ste20p containing the H345D and H348D substitutions. Strains JAY54, JAY39, and JAY40 were transformed with pRS315 or derivatives of pRS315 plasmids containing wild-type Cdc42p or mutant versions of Cdc42p with the N39S, the P69T, or the double N39S/P69T substitutions. These transformants were tested to determine the consequence of the presence of the mutant CDC42 constructs. As previously noted in Fig 3, in cells with the vector plasmid pRS315, the H345D and H348D substitutions reduced mating
10-fold relative to that of the wild-type strain. These reductions were sensitive to the level of Cdc42p; introduction of an extra copy of wild-type CDC42 in strains JAY39 and JAY40 improved mating
2-fold, although introduction of an extra copy of the CDC42P69T allele generated no improvement in mating in these strains. Intriguingly, the presence of the CDC42P69T allele had a detrimental effect on mating in an otherwise wild-type strain, while the other plasmids had essentially no effect on mating levels in JAY54. In both strains JAY39 and JAY40, the presence of the N39S/P69T double mutant raised the mating level to essentially that of the wild-type strain with the double-mutant plasmid.
Similar results were obtained for pheromone-induced expression of the fus1::LacZ. The presence of the various CDC42 alleles had little effect on fus1::LacZ expression in strain JAY54, but the N39S/P69T allele improved induction in both JAY39 and JAY40 (Fig 7). Finally, we tested whether the N39S/P69T allele could rescue the inviability of the cla4::TRP1 allele coupled with either the ste20H345D or the ste20H348D allele. Strains M98001-2A (pVT STE20) and M98014-1A (pVT STE20; Table 1) were transformed with plasmid pSTE20, pRS315CDC42, or pRS315cdc42N39S/P69T, and the resulting transformants were challenged on 5-FOA medium to determine whether the wild-type STE20 allele was still necessary to support viability. The introduction of the STE20 gene on the HIS3 plasmid allowed the growth of the transformants on 5-FOA medium, whereas the introduction of either the wild-type or the N39S/P69T versions of Cdc42p did not permit growth on 5-FOA plates. This establishes that although the N39S/P69T allele is able to suppress the mating and gene expression defects of the Ste20H3345D and Ste20H348D alleles, the modified Cdc42 protein was not capable of rescuing the need for Ste20p CRIB function in the absence of Cla4p (data not shown).
We tested whether the double-mutant version of CDC42 was able to improve the localization of the H345D and H348D versions of Ste20p. The wild-type and double-mutant versions of CDC42 were introduced into strains containing the mutant versions of Ste20GFP, and cellular localization was analyzed. As shown in Fig 8, the presence of the mutant Cdc42p did not dramatically change the cellular mislocalization of Ste20GFP during either normal vegetative growth or shmoo formation. In some cells there is evidence of improved localization of the Ste20GFP signal to sites of polarized growth, but overall the H345D- and H348D-substituted Ste20GFP fusions are poorly localized even when coexpressed with the modified Cdc42p.
|
Localization of the mutant residues on structures (![]()
![]()
![]()
![]()
|
| DISCUSSION |
|---|
Ste20p is the founding member of the PAK family of protein kinases (![]()
![]()
Previous structural studies had implicated a number of residues of the human Cdc42 protein in interactions with peptides synthesized to correspond to the CRIB domain region of PAK (![]()
![]()
![]()
![]()
![]()
![]()
However, some of the hydrophobic residues appear directly implicated in the association with the CRIB domain. The V44R substitution did not influence protein stability, but eliminated the two-hybrid interaction with the Ste20p CRIB domain. Previous analysis of a V44A substitution (![]()
We also examined the importance of residues within the Ste20p CRIB domain for binding to the Cdc42 protein. Two conserved histidine residues at positions 345 and 348 were mutated to aspartic acids. Both mutations blocked the association of the kinase and the GTPase as measured by the two-hybrid assay. This loss of association was correlated with a loss of biological function; when the H345D and H348D substitutions were introduced into the endogenous STE20 gene, neither the ste20H345D nor the ste20H348D alleles were able to rescue the deletion of CLA4. This confirms previous results obtained for CRIB domain deletions (![]()
![]()
![]()
![]()
Even though the kinase activity was normal, the strains containing the ste20H345D and the ste20H348D alleles were compromised in STE20 function in the pheromone response pathway. Strains containing the alleles showed reduced mating and reduced ability to induce the fus1::lacZ reporter construct when treated with mating pheromone. These phenotypes appeared to result from the defect in the association of Cdc42p with the Ste20p kinase. Mutations that reestablished the two-hybrid association with the H345D allele of the STE20 CRIB domain with Cdc42p were selected in Cdc42p. This strategy identified a double-mutant CDC42N39S,P69T that was capable of a more effective association with both the H345D and the H348D CRIB mutations. The double mutant and the two single mutations were transferred to a nonfusion version of Cdc42p to test the consequences of the changes on the function of Cdc42p. The double mutant provided a significant improvement in the mating response of cells containing either the H345D or the H348D mutation. Similarly, the double mutant was able to restore essentially normal pheromone responsiveness to the H345D and H348D mutant strains. Analysis of the single mutants showed that neither was able to reestablish the two-hybrid association on its own. In the biological assays the P69T mutation actually reduced mating and pheromone response relative to the wild-type CDC42, while the N39S substitution caused a moderate improvement.
Although the double mutant was necessary for the enhanced association with the mutant CRIB domain, other double-mutant combinations, including N39S G60S, N39S G12S, and G12H, N39S D65G, N39S Y64H, and Y64H P69T, were capable of enhancing the two-hybrid association between Cdc42p and the Ste20 CRIB domain containing the H345D substitution. Although the initial N39S P69T allele did not influence residues implicated in the GTPase activity of Cdc42p, residues equivalent to G12 and Y64 have been found to reduce the GTPase activity of Cdc42 homologs in other systems (![]()
![]()
![]()
The reduced mating and pheromone inducibility of the H345D and H348D substitutions contrasts with what was observed for the deletion of the CRIB domains of Ste20p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The improved function exhibited by the H345D and H348D strains in the presence of the N39S P69T version of Cdc42p was limited to improving mating and pheromone responsiveness. The modified Cdc42p did not rescue the inviability of cells containing the histidine substitutions in STE20 when they were coupled to the cla4 mutation, and the modified Cdc42p did not dramatically improve the localization of the histidine substitution mutants of the Ste20-GFP fusion protein. The two-hybrid association of the H345D and H348D alleles of Ste20p with the N39S P69T allele of Cdc42p was considerably less than the association measured for the wild-type proteins. Thus the improvement in some Ste20p functions and not in others may be attributed to the strength of the associations; weak improvements in function or localization may improve mating without allowing the rescue of the missing cla4 function.
Previous studies provided conflicting data on the requirement for Cdc42p in Ste20p function in the mating pathway (![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Biochemistry Department, McGill University, Montreal, Quebec H3A 1B1, Canada. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Peter Pryciak for comments on the manuscript. This is NRC publication no. 44853.
Manuscript received April 4, 2002; Accepted for publication October 7, 2002.
| LITERATURE CITED |
|---|
ABDUL-MANAN, N., B. AGHAZADEH, G. A. LIU, A. MAJUMDAR, and O. OUERFELLI et al., 1999 Structure of Cdc42 in complex with the GTPase-binding domain of the Wiskott-Aldrich syndrome protein. Nature 399:379-383.[Medline]
ADAMS, A. E. M., D. I. JOHNSON, R. M. LONGNECKER, B. F. SLOAT, and J. R. PRINGLE, 1990 CDC42 and CDC43, two additional genes involved in budding and the establishment of cell polarity in the yeast Saccharomyces cerevisiae.. J. Cell Biol. 111:131-142.
BEST, A., S. AHMED, R. KOZMA, and L. LIM, 1996 The Ras-related GTPase Rac1 binds tubulin. J. Biol. Chem. 271:3756-3762.
BISHOP, A. L. and A. HALL, 2000 Rho GTPases and their effector proteins. Biochem. J. 348(Pt 2):241-255.[Medline]
BOURNE, H. R., D. A. SANDERS, and F. MCCORMICK, 1990 The GTPase superfamily: a conserved switch for diverse cell functions. Nature 348:125-132.[Medline]
BURBELO, P. D., D. DRECHSEL, and A. HALL, 1995 A conserved binding motif defines numerous candidate target proteins for both Cdc42 and Rac GTPases. J. Biol. Chem. 270:29071-29074.
CHANT, J., 1996 Generation of cell polarity in yeast. Curr. Opin. Cell Biol. 8:557-565.[Medline]
CHIEN, C. T., P. L. BARTEL, R. STERNGLANZ, and S. FIELDS, 1991 The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA 88:9578-9582.
COURCHESNE, W. E., R. KUNISAWA, and J. THORNER, 1989 A putative protein kinase overcomes pheromone induced arrest of cell cycling in S. cerevisiae.. Cell 58:1107-1119.[Medline]
CVRCKOVA, F. and K. NASMYTH, 1993 Yeast G1 cyclins CLN1 and CLN2 and a GAP-like protein have a role in bud formation. EMBO J. 12:5277-5286.[Medline]
CVRCKOVA, F., C. DE VIRGILIO, E. MANSER, J. R. PRINGLE, and K. NASMYTH, 1995 Ste20-like protein kinases are required for normal localization of cell growth and for cytokinesis in budding yeast. Genes Dev. 9:1817-1830.
EBY, J. J., S. P. HOLLY, F. VAN DROGEN, A. V. GRISHIN, and M. PETER et al., 1998 Actin cytoskeleton organization regulated by the PAK family of protein kinases. Curr. Biol. 8:967-970.[Medline]
EMERSON, S. D., V. S. MADISON, R. E. PALERMO, D. S. WAUGH, and J. E. SCHEFFLER et al., 1995 Solution structure of the Ras-binding domain of c-Raf-1 and identification of its Ras interaction surface. Biochemistry 34:6911-6918.[Medline]
EVANGELISTA, M., K. BLUNDELL, M. S. LONGTINE, C. J. CHOW, and N. ADAMES et al., 1997 Bni1p, a yeast formin linking cdc42p and the actin cytoskeleton during polarized morphogenesis. Science 276:118-122.
GIZACHEW, D., W. GUO, K. K. CHOHAN, M. J. SUTCLIFFE, and R. E. OSWALD, 2000 Structure of the complex of Cdc42Hs with a peptide derived from P-21 activated kinase. Biochemistry 39:3963-3971.[Medline]
GUO, W., M. J. SUTCLIFFE, R. A. CERIONE, and R. E. OSWALD, 1998 Identification of the binding surface on Cdc42Hs for p21-activated kinase. Biochemistry 37:14030-14037.[Medline]
HIGUCHI, R., B. KRUMMEL, and R. K. SAIKI, 1988 A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16:7351-7367.
HOLLY, S. P. and K. J. BLUMER, 1999 PAK-family kinases regulate cell and actin polarization throughout the cell cycle of Saccharomyces cerevisiae. J. Cell Biol. 147:845-856.
JARVIS, E. E., D. C. HAGEN, and G. F. SPRAGUE, JR., 1988 Identification of a DNA segment that is necessary and sufficient for alpha-specific gene control in Saccharomyces cerevisiae: implications for regulation of alpha-specific and a-specific genes. Mol. Cell. Biol. 8:309-320.
LAMSON, R. E., M. J. WINTERS, and P. M. PRYCIAK, 2002 Cdc42 regulation of kinase activity and signaling by the yeast p21-activated kinase Ste20. Mol. Cell. Biol. 22:2939-2951.
LEBERER, E., D. DIGNARD, D. HARCUS, D. Y. THOMAS, and M. WHITEWAY, 1992 The protein kinase homologue Ste20p is required to link the yeast pheromone response G-protein beta gamma subunits to downstream signalling components. EMBO J. 11:4815-4824.[Medline]
LEBERER, E., D. DIGNARD, D. HARCUS, L. HOUGAN, and M. WHITEWAY et al., 1993 Cloning of Saccharomyces cerevisiae STE5 as a suppressor of a Ste20 protein kinase mutant: structural and functional similarity of Ste5 to Far1. Mol. Gen. Genet. 241:241-254.[Medline]
LEBERER, E., C. WU, T. LEEUW, A. FOUREST-LIEUVIN, and J. E. SEGALL et al., 1997 Functional characterization of the Cdc42p binding domain of yeast Ste20p protein kinase. EMBO J. 16:83-97.[Medline]
LEEUW, T., C. WU, J. D. SCHRAG, M. WHITEWAY, and D. Y. THOMAS et al., 1998 Interaction of a G-protein beta-subunit with a conserved sequence in Ste20/PAK family protein kinases. Nature 391:191-195.[Medline]
LEI, M., W. LU, W. MENG, M. C. PARRINI, and M. J. ECK et al., 2000 Structure of PAK1 in an autoinhibited conformation reveals a multistage activation switch. Cell 102:387-397.[Medline]
LIN, D., A. S. EDWARDS, J. P. FAWCETT, G. MBAMALU, and J. D. SCOTT et al., 2000 A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nat. Cell Biol. 2:540-547.[Medline]
MANSER, E., T. LEUNG, H. SALIHUDDIN, Z. S. ZHAO, and L. LIM, 1994 A brain serine/threonine protein kinase activated by Cdc42 and Rac1. Nature 367:40-46.[Medline]
MARCUS, S., A. POLVERINO, M. BARR, and M. WIGLER, 1994 Complexes between STE5 and components of the pheromone mitogen-activated protein kinase module. Proc. Natl. Acad. Sci. USA 91:7762-7766.
MARTIN, H., A. MENDOZA, J. M. RODRIGUEZ-PACHON, M. MOLINA, and C. NOMBELA, 1997 Characterization of SKM1, a Saccharomyces cerevisiae gene encoding a novel Ste20/PAK-like protein kinase. Mol. Microbiol. 23:431-444.[Medline]
MORREALE, A., M. VENKATESAN, H. R. MOTT, D. OWEN, and D. NIETLISPACH et al., 2000 Structure of Cdc42 bound to the GTPase binding domain of PAK. Nat. Struct. Biol. 7:384-388.[Medline]
MOSKOW, J. J., A. S. GLADFELTER, R. E. LAMSON, P. M. PRYCIAK, and D. J. LEW, 2000 Role of Cdc42p in pheromone-stimulated signal transduction in Saccharomyces cerevisiae. Mol. Cell. Biol. 20:7559-7571.
MOTT, H. R., D. OWEN, D. NIETLISPACH, P. N. LOWE, and E. MANSER et al., 1999 Structure of the small G protein Cdc42 bound to the GTPase-binding domain of ACK. Nature 399:384-388.[Medline]
MURRAY, J. M. and D. I. JOHNSON, 2001 The Cdc42p GTPase and its regulators Nrf1p and Scd1p are involved in endocytic trafficking in the fission yeast Schizosaccharomyces pombe. J. Biol. Chem. 276:3004-3009.
NICHOLLS, A., K. A. SHARP, and B. HONIG, 1991 Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11:281-296.[Medline]
NUR, E. K. M. S., A. SIZELAND, G. D'ABACO, and H. MARUTA, 1992 Asparagine 26, glutamic acid 31, valine 45, and tyrosine 64 of Ras proteins are required for their oncogenicity. J. Biol. Chem. 267:1415-1418.








