- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by González-Barrera, S.
- Articles by Aguilera, A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by González-Barrera, S.
- Articles by Aguilera, A.
Transcription and Double-Strand Breaks Induce Similar Mitotic Recombination Events in Saccharomyces cerevisiae
Sergio González-Barreraa, María García-Rubioa, and Andrés Aguileraaa Departamento de Genética, Facultad de Biología, Universidad de Sevilla, 41012 Sevilla, Spain
Corresponding author: Andrés Aguilera, Facultad de Biología, Universidad de Sevilla, Avd. Reina Mercedes 6, 41012 Sevilla, Spain., aguilo{at}us.es (E-mail)
Communicating editor: L. S. SYMINGTON
| ABSTRACT |
|---|
We have made a comparative analysis of double-strand-break (DSB)-induced recombination and spontaneous recombination under low- and high-transcription conditions in yeast. We constructed two different recombination substrates, one for the analysis of intermolecular gene conversions and the other for intramolecular gene conversions and inversions. Such substrates were based on the same leu2-HOr allele fused to the tet promoter and containing a 21-bp HO site. Gene conversions and inversions were differently affected by rad1, rad51, rad52, and rad59 single and double mutations, consistent with the actual view that such events occur by different recombination mechanisms. However, the effect of each mutation on each type of recombination event was the same, whether associated with transcription or induced by the HO-mediated DSB. Both the highly transcribed DNA and the HO-cut sequence acted as recipients of the gene conversion events. These results are consistent with the hypothesis that transcription promotes initiation of recombination along the DNA sequence being transcribed. The similarity between transcription-associated and DSB-induced recombination suggests that transcription promotes DNA breaks.
DNA is a reactive molecule that can be damaged by radicals, chemicals, or radiation. Such forms of damage can result directly or indirectly in DNA breaks (![]()
![]()
![]()
![]()
![]()
Particularly intriguing is the observation that high-transcription levels of a DNA sequence can strongly stimulate its frequency of recombination (![]()
![]()
was stimulated by Rpo-mediated transcription. Afterward, TAR was shown in yeast cells by the identification of HOT1, which is a cis-acting recombination hotspot present in the rDNA tandem repeats (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Homologous recombination is catalyzed by a number of Rad proteins whose biochemical activities are being identified (![]()
![]()
Rad51 is the eukaryotic homolog of RecA (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Rad52 is a strand-annealing protein that forms ring structures at the ends of ssDNA (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
An additional relevant gene for the study of recombination is RAD1, whose product constitutes, together with Rad10, the nucleotide (nt) excision-repair endonuclease activity that cleaves ssDNA "flap" structures (![]()
![]()
![]()
Our main interest is to understand how transcription stimulates recombination. Consequently, we have determined the effect of transcription on two different types of homologous recombination events: Rad51-dependent gene conversions and Rad51-independent inversions. We have undertaken for the first time a comparative genetic and molecular analysis of TAR and double-strand-break (DSB)-induced recombination using the same recombination substrates. We have determined the effect of rad1, rad51, rad52, and rad59 mutants on each type of recombination event. Our results suggest that transcription of a DNA sequence increases the formation of DNA breaks or DNA lesions that are processed into DNA breaks, which could be repaired by double-strand-break repair (DSBR), synthesis-dependent strand annealing (SDSA), BIR, or SSA, depending on the structure and location of the donor sequence.
| MATERIALS AND METHODS |
|---|
Strains and plasmids:
Yeast strains used in this study are listed in Table 1. All strains used for the analyses of recombination of inverted-repeat systems were isogenic with W303. Those used with the plasmid-chromosome recombination construct were derivatives of W303 and its congenic strain AYW3-1Bu-. Deletions of RAD1, RAD51, RAD52, and RAD59 genes were accomplished with the PCR-based method using the kanMX4 (![]()
![]()
![]()
![]()
|
Plasmids constructed for this study are as follows. Plasmid pCM189-L2 is pCM189 (![]()
![]()
![]()
is pRS316 (![]()
in which the 2.36-kb XhoI-HindIII Ptet::leu2-HOr fragment of pCM189-L2HOr has been inserted at XhoI-HindIII of the polylinker. pRS316-TINV is pRS316-INV in which the 1.8-kb blunt-ended EcoRI-XhoI fragment of pCM189 containing the tTA transactivator has been inserted at the blunt-ended XbaI site in the same orientation as the Ptet::leu2-HOr fragment.
Genetic and molecular analysis of recombination:
Recombination frequencies are the median values of fluctuation tests performed with six independent yeast colonies each, as previously described (![]()
Gene conversions and inversions in the inverted-repeat construct were determined by Southern and PCR analyses. The first was performed on total DNA of independent Leu+ recombinants digested with SspI and probed with the 32P-labeled 1.2-kb ClaI-SspI internal LEU2 fragment. The latter was determined with reactions using a mix of the three oligonucleotides CCGGCAGATCAATTCCTCGATC (a), TTAGAGCGGATGTGGGGGAG (b), and GAAGGTTTTGGGACGCTCGAAG (c).
The directionality of gene conversion in the plasmid-chromosome recombination construct was determined genetically. First, independent Leu+ gene convertants that lost their plasmid were selected on SC + FOA. Afterward the Ura- segregants were scored for their ability to grow on SC-leu, where only gene convertants of the chromosomal leu2-k allele were able to form colonies.
Miscellaneous:
Growth conditions and genetic analyses were performed according to previously published methods (![]()
![]()
| RESULTS |
|---|
A new Ptet::leu2-HOr allele, containing a 21-bp HO site, for the analyses of transcription-associated and DSB-induced recombination:
Our goal in this study was to determine the genetic requirements of TAR in comparison with spontaneous recombination occurring under no- or low-transcription conditions and with DSB-induced recombination. To construct recombination substrates that were valid for the analysis of transcription-associated and DSB-induced recombination we first placed the LEU2 open reading frame under a modified Ptet promoter, which is negatively controlled by the presence of dox (![]()
|
We next constructed a leu2-HOr allele containing the 21-bp HO site at the LEU2 EcoRI site, instead of the full 117-bp HO site used in most previously reported recombination assays (![]()
4% of total DNA after 2 hr of shifting cells to galactose. Interestingly, this efficiency of HO cleavage was obtained with low transcription. Under high-transcription conditions the overall efficiency of HO cleavage was
2.5-fold lower (Fig 1C). This result suggests that the accessibility or affinity of the HO endonuclease to the 21-bp HO site was significantly reduced by transcription. Relative frequencies of HO-induced recombination were the same under both high- and low-transcription conditions. For this reason only the results with low transcription will be shown.
A plasmid-chromosome construct to study transcription-associated and DSB-induced gene conversions:
We first developed a recombination substrate that permitted us to analyze spontaneous gene conversion events occurring under low- and high-transcription conditions as well as by induction with HO. The recombination construct was based on the leu2-k allele (fill-out of the KpnI site) at the LEU2 chromosomal locus and on the Ptet::leu2-HOr allele in the monocopy plasmid pCM189. In this construct, recombinants were scored as Leu+ colonies. They could arise by gene conversion of either the chromosomal leu2-k allele or the plasmidic leu2-HOr allele (Fig 2A). Leu+ reciprocal exchange events, leading to the integration of the plasmid into the chromosome, were never recovered. This was expected as a consequence of the instability of the resulting dicentric chromosomes (![]()
|
Transcription-associated gene conversions show the same patterns of RAD51 and RAD59 dependency as do DSB-induced gene conversions:
Fig 2B shows that high-transcription levels stimulate gene conversion between the leu2-HOr and leu2-k alleles 8 times the frequency obtained with low transcription. Increases in gene conversions were observed in rad1, rad51, rad59, and rad52 cells as well as in double-mutant combinations. Recombination in both cases was independent of RAD1 and strongly dependent on RAD52. Recombination was significantly reduced in rad51 cells (35 and 45 times with respect to the wild type under low and high levels of transcription, respectively), but weakly affected in rad59 cells (3.8 and 2.1 times). None of the double-mutant combinations done with rad1, rad51, and rad59 showed synergistic effects, rad51 being epistatic over rad1 and rad59, and rad59 being epistatic over rad1 at both low- and high-transcription conditions. However, some quantitative differences existed between low and high transcription. Thus, the highest stimulation of gene conversions by transcription was obtained in rad1 rad59 cells (64 times) and the lowest in rad51 rad59 cells (2 times). The observation that recombination in rad51 rad59 cells was 3 times lower than that in rad51 cells confirms that Rad59 is only slightly required for transcription-associated gene conversion events.
Gene conversions were strongly induced by HO in the plasmid-chromosome assay. When yeast colonies were grown in media containing 2% galactose, all cells became recombinants in wild-type and rad mutant cells as a consequence of recurrent HO cleavage (our unpublished data). Nevertheless, rad51 and rad52 mutants took longer to grow under these conditions, due to their low efficiency of DSB recombinational repair (data not shown). For this reason, we did all experiments with a transient expression of HO for 6 hr in liquid media. Under these conditions, we could obtain a reliable recombination frequency, clearly above spontaneous levels. Fig 2C shows that HO-mediated DSBs induced recombination strongly in all strains tested. However, the pattern of dependency on rad51, rad59, and rad52 was similar to that of the spontaneous recombination under low and high levels of transcription. A strong dependency on RAD51 and RAD52 and a weak dependency on RAD59 was observed (Fig 2C). Thus the frequency of HO-induced recombination was 180-, >106-, and 5.8-fold below wild-type levels in rad51, rad52, and rad59 cells, respectively. These results contrast with the lower dependency on RAD genes observed for spontaneous (non-HO-induced) recombination in which rad51, rad52, and rad59 reduced recombination 53-, 320-, and 2.7-fold below wild-type levels (Fig 2C). The only exception was rad1 in which the frequency of HO-induced gene conversions was 106 times below wild-type levels but the frequency of spontaneous events was reduced only 2.3-fold. This result might be caused by the requirement for Rad1 in recombination events that initiate at heterologous regions (![]()
![]()
![]()
![]()
Transcription-associated gene conversions initiate at the highly transcribed DNA sequence:
Genetic analysis of the directionality of gene conversions in the plasmid-chromosome assay revealed that under high-transcription conditions, most spontaneous recombination events occurred by gene conversion of the strongly transcribed leu2-HOr allele in wild-type and rad strains (Table 2). This is clearly observed in wild-type cells, in which all spontaneous recombination events converted the leu2-HOr allele. As expected, all HO-induced gene conversion events, among a total of 62 Leu+ events analyzed, converted the leu2-HOr allele into LEU2 in wild-type and all rad mutant strains. As all HO-induced Leu+ events were initiated by a DSB at the leu2-HOr allele, it was expected that they occur by copying the wild-type information from the leu2-k allele. Our results, therefore, indicate that transcription facilitates initiation of the recombination event at the strongly transcribed sequence, leu2-HOr, which acts as recipient of information in the gene conversion event. Interestingly, a large majority of spontaneous Leu+ events occurring with low transcription also underwent gene conversion of the leu2-HOr allele in wild-type cells, although to a minor degree (Table 2). This implies that most spontaneous events were also initiated at the leu2-HOr allele. It is likely that the low levels of transcription at the leu2-HOr were enough to facilitate initiation of recombination at this allele.
|
At low transcription, although leu2-HOr is the allele preferentially converted in most strains tested, in most of the rad mutant combinations tested the proportion of conversion of leu2-k (4-bp insertion) is lower than that of leu2-HOr (25-bp insertion) relative to high transcription (Table 2). The case of the rad1 rad51 cells is worth mentioning, in which spontaneous gene conversion of the chromosomal leu2-k allele was clearly favored as compared to other rad mutants, including rad1 and rad51 single mutants. This may reflect a higher difficulty in conversion of long heterologies in rad mutants.
TAR between inverted repeats occurs similarly to DSB-induced recombination in a RAD51-independent and RAD59-dependent manner:
Recombination was next analyzed between inverted repeats. The rationale was that inversions can also occur by a mechanism different from gene conversions and reciprocal exchange (![]()
![]()
![]()
5' allele. This leu2
5' copy was not transcribed, as determined by Northern analysis (data not shown). With this assay, Leu+ recombinants could occur in principle either by gene conversion of the leu2-HOr copy, whether or not associated with an inversion of the region located between the repeats, or by a crossover upstream of the HO site of leu2-HOr (Fig 3A).
|
High-transcription conditions stimulated recombination in both wild-type and rad mutants, although at low level (2- to 11-fold). We believe that this is the case because, in contrast to gene conversions in the plasmid-chromosome system, the basal recombination levels in this system were already high (above 10-4). This introduces a background noise above which TAR is less clearly detected.
The pattern of dependency of the RAD genes of both TAR and recombination under low-transcription conditions was similar. Fig 3B shows that spontaneous inverted-repeat recombination was strongly affected in rad52 cells. In contrast to the gene conversion events of the plasmid-chromosome assay, inverted-repeat recombination was not affected by the rad51 mutation and was slightly reduced by rad59 (4- to 8-fold below wild-type levels). Indeed, as inversions in rad59 cells represent half the proportion of total inversions as compared to wild-type cells (Fig 4), the decreases caused by rad59 in the frequency of total Leu+ inversions are between 6.8- and 12.4-fold (Fig 3 and Fig 4). The rad59 and rad51 mutations show additive effects on the reduction of the frequency of inverted-repeat recombination, consistent with previous observations (![]()
![]()
![]()
![]()
|
This result, different from those of the plasmid-chromosome system, indicates that gene conversion may not be the major spontaneous recombination event between inverted repeats under both low- and high-transcription conditions. Instead, a Rad51-independent and Rad1- and Rad59-dependent mechanism might be the primary pathway leading to Leu+ events between inverted repeats, presumably BIR and SSA, as suggested previously (![]()
![]()
![]()
When HO was induced for 6 hr in 2% galactose, recombination was strongly stimulated. Again, DSB-induced recombinants were almost abolished in rad52 cells, unaffected in rad1 and rad51 cells, and reduced in rad59 cells (5.3-fold below wild-type levels; Fig 3C), showing, therefore, the same pattern of genetic requirements as spontaneous recombination.
Finally, PCR analysis of independent Leu+ recombination events showed that 30% were associated with an inversion in wild-type cells under low- and high-transcription conditions (Fig 4). There are no significant differences (P < 0.05) in the proportion of inversions in wild-type and rad cells. Indeed, the percentage of inversions was also similar for DSB-induced recombination in wild-type, rad51, and rad59 cells (our unpublished data). These results confirm that inversions may occur efficiently in the absence of Rad51, via a Rad1- and Rad59-dependent recombination mechanism with both low and high transcription. It is worth noting that inversions are frequently in association with plasmids carrying noninverted repeats (our unpublished data).
Illegitimate end-joining causes high levels of Leu+ events at the leu2-HOr allele:
In wild-type and rad strains HO induced Leu+ recombinants two to three orders of magnitude above spontaneous levels. Unexpectedly, HO-induced Leu+ events were very high in rad52 strains (1.7 and 3.3 x 10-4 for the plasmid-chromosome and inverted-repeat recombination assays, respectively). Here we show that such a high frequency of recombination was the result of NHEJ. We know that leu2
strains with plasmid pCM189-L2HOr, carrying only a leu2-HOr copy, should never lead to Leu+ events by homologous recombination because they lack wild-type LEU2 sequences acting as donors of information. However, using these assays, HO-induced Leu+ events were obtained at frequencies ranging from 1.5 to 3.0 x 10-4 in wild-type, rad51 rad59, and rad52 strains. These frequencies were similar to those of HO-induced Leu+ events obtained with the plasmid-chromosome system in rad51 rad59 (1.96 x 10-4) and rad52 cells (1.7 x 10-4) or with the TINV inverted-repeat constructs in rad52 cells (3.3 x 10-4). This is explained by the capability of our 25-bp insertion mutation containing the 21-bp HO site to be converted by illegitimate NHEJ into 27-bp insertions that reestablish the LEU2 wild-type frame (![]()
| DISCUSSION |
|---|
For the comparative analysis of TAR and DSB-induced recombination we developed new inter- and intramolecular recombination substrates on the basis of a leu2-HOr allele fused to the regulated Ptet promoter and containing a 21-bp HO site. These substrates allowed the study of different types of recombination events, including gene conversions and inversions, which may occur by distinct mechanisms as deduced from their different dependencies on Rad51 and Rad59. We have shown that highly transcribed sequences act as recipients of gene conversions. Importantly, TAR shows similar dependencies such as HO-induced recombination on the DSB-repair genes RAD1, RAD51, RAD52, and RAD59. These results suggest that high transcription facilitates the formation of DNA breaks along the DNA sequence being transcribed. We argue that transcription is able to increase all types of homologous recombination events, whether occurring by DSBR, SDSA, or BIR/SSA mechanisms.
Intra- and intermolecular recombination events show different Rad51 and Rad59 requirements:
All homologous recombination events analyzed in this study were Rad52 dependent. However, we observed different Rad51 and Rad59 genetic requirements between intramolecular gene conversions and intermolecular gene conversion and inversions, regardless of whether they initiated spontaneously (under low- and high-transcription conditions) or by an HO-induced DSB. As expected, intermolecular gene conversions were dependent on the Rad51 strand-exchange protein. This is consistent with a number of published observations (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In contrast to intermolecular events, gene conversion and inversion between inverted repeats occur with wild-type efficiency in rad51 cells. This result confirms that inverted-repeat recombination leading to Leu+ events is efficient in the absence of a Rad51-mediated strand-exchange reaction. It is likely that in the absence of Rad51 many Leu+ inverted-repeat recombination events occur via BIR followed by SSA as previously proposed (![]()
![]()
![]()
As expected from the observation that Rad51 and Rad59 control different genetic recombination pathways (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
It is likely that in wild-type cells BIR is responsible for only a low proportion of events (![]()
![]()
![]()
![]()
![]()
![]()
Finally, it is worth noting that Rad1 had little effect on both spontaneous and DSB-induced interchromosomal gene conversion and inverted-repeat recombination, with one exception: HO-induced plasmid-chromosome gene conversions are Rad1 dependent. This was unexpected, because cleavage of the 21-bp HO site leads to tails containing 16- and 9-nt heterologous 3'-ended strands (![]()
![]()
![]()
Transcription-associated and DSB-induced recombination events are similar and show identical gene requirements:
We have used two different constructs containing the same leu2 alleles to show that transcription induces any type of recombination event. Our results, together with previously reported data on deletions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Transcription stimulates recombination in all rad mutants tested, confirming that transcription induces all types of recombination events, whether or not Rad51 and Rad59 dependent. Consistent with our results, a parallel study showed that transcription of the recipient molecule increases ectopic recombination between heterologous chromosomes in both rad51 and rad59 mutants (J. A. FREEDMAN and S. JINKS-ROBERTSON, unpublished results). Importantly, using the same recombination systems we show for the first time that spontaneous recombination occurring under both low and high transcription has the same RAD51, RAD52, and RAD59 gene requirements as HO-induced recombination (Fig 2 and Fig 3). This is so, despite the different pattern of RAD dependency observed for each type of recombination event studied. The similar gene requirements of TAR and HO-induced recombination suggest that the initiation events stimulated by transcription are DNA breaks and/or lesions that subsequently lead to DNA breaks.
The main emerging question is how transcription through one DNA sequence can contribute to the initiation of recombination, that is, to the formation of DNA breaks. We envision two possible scenarios (![]()
![]()
![]()
![]()
In an alternative scenario, the opening of the chromatin structure of the DNA strands, facilitated by the transient accumulation of supercoiled negative DNA behind the advancing RNAPII, could increase the accessibility of DNA-damaging agents, such as free radicals (![]()
![]()
![]()
![]()
![]()
In summary, our results provide evidence that transcription elongation may contribute to the formation of DNA breaks or lesions that are subsequently converted into DSBs. Such breaks would be repaired by DSBR, SDSA, BIR, or SSA, depending on the structure and location of the donor sequence, and therefore can potentially lead to all types of homologous recombination events.
| ACKNOWLEDGMENTS |
|---|
We thank F. Prado for reading the manuscript, M. Kupiec for providing strains MK279 and OI-15, S. Jinks-Robertson for communicating unpublished data, and D. Haun for style supervision. Research was funded by grants from the Spanish Ministry of Science and Technology (BMC200-0439) and the Human Frontier Science Program (RG1999/0075). S.G.-B. was a recipient of a predoctoral training grant from the Spanish Ministry of Education and Culture.
Manuscript received April 9, 2002; Accepted for publication July 1, 2002.
| LITERATURE CITED |
|---|
ABOUSSEKHRA, A., R. CHANET, A. ADJIRI, and F. FABRE, 1992 Semidominant suppressors of Srs2 helicase mutations of Saccharomyces cerevisiae map in the RAD51 gene, whose sequence predicts a protein with similarities to procaryotic RecA proteins. Mol. Cell. Biol. 12:3224-3234.
AGUILERA, A., 1995 Genetic evidence for different RAD52-dependent intrachromosomal recombination pathways in Saccharomyces cerevisiae.. Curr. Genet. 27:298-305.[Medline]
AGUILERA, A., 2001 Double-strand break repair: Are Rad51/RecADNA joints barriers to DNA replication? Trends Genet. 17:318-321.[Medline]
AGUILERA, A., 2002 The connection between transcription and genomic instability. EMBO J. 21:195-201.[Medline]
AGUILERA, A., S. CHAVEZ, and F. MALAGON, 2000 Mitotic recombination in yeast: elements controlling its incidence. Yeast 16:731-754.[Medline]
BAI, Y. and L. S. SYMINGTON, 1996 A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae.. Genes Dev. 10:2025-2037.
BARTSCH, S., L. E. KANG, and L. S. SYMINGTON, 2000 RAD51 is required for the repair of plasmid double-stranded DNA gaps from either plasmid or chromosomal templates. Mol. Cell. Biol. 20:1194-1205.
BASILE, G., M. AKER, and R. K. MORTIMER, 1992 Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51.. Mol. Cell. Biol. 12:3235-3246.
BELETSKII, A. and A. S. BHAGWAT, 1996 Transcription-induced mutations: increase in C to T mutations in the nontranscribed strand during transcription in Escherichia coli. Proc. Natl. Acad. Sci. USA 93:13919-13924.
BELETSKII, A., A. GRIGORIEV, S. JOYCE, and A. S. BHAGWAT, 2000 Mutations induced by bacteriophage T7 RNA polymerase and their effects on the composition of the T7 genome. J. Mol. Biol. 300:1057-1065.[Medline]
BENSON, F. E., P. BAUMANN, and S. C. WEST, 1998 Synergistic actions of Rad51 and Rad52 in recombination and DNA repair. Nature 391:401-404.[Medline]
BLACKWELL, T. K., M. W. MOORE, G. D. YANCOPOULOS, H. SUH, and S. LUTZKER et al., 1986 Recombination between immunoglobulin variable region gene segments is enhanced by transcription. Nature 324:585-589.[Medline]
BRATTY, J., G. FERBEYRE, C. MOLINARO, and R. CEDERGREN, 1996 Stimulation of mitotic recombination upon transcription from the yeast GAL1 promoter but not from other RNA polymerase I, II and III promoters. Curr. Genet. 30:381-388.[Medline]
CHAVEZ, S. and A. AGUILERA, 1997 The yeast HPR1 gene has a functional role in transcriptional elongation that uncovers a novel source of genome instability. Genes Dev. 11:3459-3470.
CHAVEZ, S., T. BEILHARZ, A. G. RONDON, H. ERDJUMENT-BROMAGE, and P. TEMPST et al., 2000 A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae.. EMBO J. 19:5824-5834.[Medline]
COLAIACOVO, M. P., F. PÂQUES, and J. E. HABER, 1999 Removal of one nonhomologous DNA end during gene conversion by a RAD1- and MSH2-independent pathway. Genetics 151:1409-1423.
COX, M. M., 2001 Recombinational DNA repair of damaged replication forks in Escherichia coli: questions. Annu. Rev. Genet. 35:53-82.[Medline]
DANIELS, G. A. and M. R. LIEBER, 1995 RNA:DNA complex formation upon transcription of immunoglobulin switch regions: implications for the mechanism and regulation of class switch recombination. Nucleic Acids Res. 23:5006-5011.
DATTA, A. and S. JINKS-ROBERTSON, 1995 Association of increased spontaneous mutation rates with high levels of transcription in yeast. Science 268:1616-1619.
DAVIS, A. P. and L. S. SYMINGTON, 2001 The yeast recombinational repair protein Rad59 interacts with Rad52 and stimulates single-strand annealing. Genetics 159:515-525.
DOWNS, J. A., N. F. LOWNDES, and S. P. JACKSON, 2000 A role for Saccharomyces cerevisiae histone H2A in DNA repair. Nature 408:1001-1004.[Medline]
DUGUET, M., 1997 When helicase and topoisomerase meet!. J. Cell Sci. 110:1345-1350.[Abstract]
ELIAS-ARNANZ, M., A. A. FIRMENICH, and P. BERG, 1996 Saccharomyces cerevisiae mutants defective in plasmid-chromosome recombination. Mol. Gen. Genet. 252:530-538.[Medline]
FISHMAN-LOBELL, J. and J. E. HABER, 1992 Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1.. Science 258:480-484.
FREDERICO, L. A., T. A. KUNKEL, and B. R. SHAW, 1990 A sensitive genetic assay for the detection of cytosine deamination: determination of rate constants and the activation energy. Biochemistry 29:2532-2537.[Medline]
GALLARDO, M. and A. AGUILERA, 2001 A new hyperrecombination mutation identifies a novel yeast gene, THP1, connecting transcription elongation with mitotic recombination. Genetics 157:79-89.
GARI, E., L. PIEDRAFITA, M. ALDEA, and E. HERRERO, 1997 A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae.. Yeast 13:837-848.[Medline]
GOLDSTEIN, A. L. and J. H. MCCUSKER, 1999 Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.. Yeast 15:1541-1553.[Medline]
GRIMM, C., P. SCHAER, P. MUNZ, and J. KOHLI, 1991 The strong ADH1 promoter stimulates mitotic and meiotic recombination at the ADE6 gene of Schizosaccharomyces pombe.. Mol. Cell. Biol. 11:289-298.
HASTINGS, P. J., 1988 Recombination in the eukaryotic nucleus. Bioessays 9:61-64.[Medline]
HUANG, G. S. and R. L. KEIL, 1995 Requirements for activity of the yeast mitotic recombination hotspot HOT1: RNA polymerase I and multiple cis-acting sequences. Genetics 141:845-855.[Abstract]
IKEDA, H. and T. MATSUMOTO, 1979 Transcription promotes recA-independent recombination mediated by DNA-dependent RNA polymerase in Escherichia coli.. Proc. Natl. Acad. Sci. USA 76:4571-4575.
IVANOV, E. L. and J. E. HABER, 1995 RAD1 and RAD10, but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:2245-2251.[Abstract]
JABLONOVICH, Z., B. LIEFSHITZ, R. STEINLAUF, and M. KUPIEC, 1999 Characterization of the role played by the RAD59 gene of Saccharomyces cerevisiae in ectopic recombination. Curr. Genet. 36:13-20.[Medline]
KANG, L. E. and L. S. SYMINGTON, 2000 Aberrant double-strand break repair in rad51 mutants of Saccharomyces cerevisiae.. Mol. Cell. Biol. 20:9162-9172.
LAUSTER, R., C. A. REYNAUD, I. L. MARTENSSON, A. PETER, and D. BUCCHINI et al., 1993 Promoter, enhancer and silencer elements regulate rearrangement of an immunoglobulin transgene. EMBO J. 12:4615-4623.[Medline]
MALAGON, F. and A. AGUILERA, 2001 Yeast spt6-140 mutation, affecting chromatin and transcription, preferentially increases recombination in which Rad51p-mediated strand exchange is dispensable. Genetics 158:597-611.
MALKOVA, A., E. L. IVANOV, and J. E. HABER, 1996 Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136.
MCDONALD, J. P. and R. ROTHSTEIN, 1994 Unrepaired heteroduplex DNA in Saccharomyces cerevisiae is decreased in RAD1 RAD52-independent recombination. Genetics 137:393-405.[Abstract]
MCGILL, C., B. SHAFER, and J. STRATHERN, 1989 Coconversion of flanking sequences with homothallic switching. Cell 57:459-467.[Medline]
MCGLYNN, P. and R. G. LLOYD, 2000 Modulation of RNA polymerase by (p)ppGpp reveals a RecG-dependent mechanism for replication fork progression. Cell 101:35-45.[Medline]
MICHEL, B., M. J. FLORES, E. VIGUERA, G. GROMPONE, and M. SEIGNEUR et al., 2001 Rescue of arrested replication forks by homologous recombination. Proc. Natl. Acad. Sci. USA 98:8181-8188.
MOORE, J. K. and J. E. HABER, 1996 Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:2164-2173.[Abstract]
MORTENSEN, U. H., C. BENDIXEN, I. SUNJEVARIC, and R. ROTHSTEIN, 1996 DNA strand annealing is promoted by the yeast Rad52 protein. Proc. Natl. Acad. Sci. USA 93:10729-10734.
NEVO-CASPI, Y. and M. KUPIEC, 1994 Transcriptional induction of Ty recombination in yeast. Proc. Natl. Acad. Sci. USA 91:12711-12715.
NEVO-CASPI, Y. and M. KUPIEC, 1996 Induction of Ty recombination in yeast by cDNA and transcription: role of the RAD1 and RAD52 genes. Genetics 144:947-955.[Abstract]
NEW, J. H., T. SUGIYAMA, E. ZAITSEVA, and S. C. KOWALCZYKOWSKI, 1998 Rad52 protein stimulates DNA strand exchange by Rad51 and replication protein A. Nature 391:407-410.[Medline]
NICKOLOFF, J. A., E. Y. CHEN, and F. HEFFRON, 1986 A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast. Proc. Natl. Acad. Sci. USA 83:7831-7835.
OGAWA, T., X. YU, A. SHINOHARA, and E. H. EGELMAN, 1993 Similarity of the yeast RAD51 filament to the bacterial RecA filament. Science 259:1896-1899.
OLTZ, E. M., F. W. ALT, W. C. LIN, J. CHEN, and G. TACCIOLI et al., 1993 A V(D)J recombinase-inducible B-cell line: role of transcriptional enhancer elements in directing V(D)J recombination. Mol. Cell. Biol. 13:6223-6230.
PÂQUES, F. and J. E. HABER, 1997 Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccharomyces cerevisiae.. Mol. Cell. Biol. 17:6765-6771.[Abstract]
PÂQUES, F. and J. E. HABER, 1999 Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.. Microbiol. Mol. Biol. Rev. 63:349-404.
PARSONS, C. A., P. BAUMANN, E. VAN DYCK, and S. C. WEST, 2000 Precise binding of single-stranded DNA termini by human RAD52 protein. EMBO J. 19:4175-4181.[Medline]
PAULL, T. T., E. P. ROGAKOU, V. YAMAZAKI, C. U. KIRCHGESSNER, and M. GELLERT et al., 2000 A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr. Biol. 10:886-895.[Medline]
PETUKHOVA, G., S. A. STRATTON, and P. SUNG, 1999 Single strand DNA binding and annealing activities in the yeast recombination factor Rad59. J. Biol. Chem. 274:33839-33842.
PIRUAT, J. I. and A. AGUILERA, 1998 A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination. EMBO J. 17:4859-4872.[Medline]




2 test (P < 0.05).