Genetics, Vol. 162, 603-614, October 2002, Copyright © 2002

Transcription and Double-Strand Breaks Induce Similar Mitotic Recombination Events in Saccharomyces cerevisiae

Sergio González-Barreraa, María García-Rubioa, and Andrés Aguileraa
a Departamento de Genética, Facultad de Biología, Universidad de Sevilla, 41012 Sevilla, Spain

Corresponding author: Andrés Aguilera, Facultad de Biología, Universidad de Sevilla, Avd. Reina Mercedes 6, 41012 Sevilla, Spain., aguilo{at}us.es (E-mail)

Communicating editor: L. S. SYMINGTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have made a comparative analysis of double-strand-break (DSB)-induced recombination and spontaneous recombination under low- and high-transcription conditions in yeast. We constructed two different recombination substrates, one for the analysis of intermolecular gene conversions and the other for intramolecular gene conversions and inversions. Such substrates were based on the same leu2-HOr allele fused to the tet promoter and containing a 21-bp HO site. Gene conversions and inversions were differently affected by rad1, rad51, rad52, and rad59 single and double mutations, consistent with the actual view that such events occur by different recombination mechanisms. However, the effect of each mutation on each type of recombination event was the same, whether associated with transcription or induced by the HO-mediated DSB. Both the highly transcribed DNA and the HO-cut sequence acted as recipients of the gene conversion events. These results are consistent with the hypothesis that transcription promotes initiation of recombination along the DNA sequence being transcribed. The similarity between transcription-associated and DSB-induced recombination suggests that transcription promotes DNA breaks.


DNA is a reactive molecule that can be damaged by radicals, chemicals, or radiation. Such forms of damage can result directly or indirectly in DNA breaks (PAQUES and HABER 1999 Down). A major mechanism of DNA break repair in vegetatively growing cells is homologous recombination. However, DNA metabolic processes such as replication and transcription can strongly influence the incidence of homologous recombination in mitotic cells (PAQUES and HABER 1999 Down; AGUILERA et al. 2000 Down). Thus, replication fork blockage may be an important source of spontaneous mitotic recombination (COX 2001 Down; MICHEL et al. 2001 Down).

Particularly intriguing is the observation that high-transcription levels of a DNA sequence can strongly stimulate its frequency of recombination (AGUILERA 2001 Down). The first evidence of transcription-associated recombination (TAR) was shown in Escherichia coli (IKEDA and MATSUMOTO 1979 Down), in which recombination of phage {lambda} was stimulated by Rpo-mediated transcription. Afterward, TAR was shown in yeast cells by the identification of HOT1, which is a cis-acting recombination hotspot present in the rDNA tandem repeats (VOELKEL-MEIMAN et al. 1987 Down). Hyper-recombination caused by this sequence was dependent on RNA polymerase I (RNAPI) transcription (STEWART and ROEDER 1989 Down; HUANG and KEIL 1995 Down). Subsequently, RNA polymerase II (RNAPII)- driven transcription was also shown to stimulate recombination in Saccharomyces cerevisiae (THOMAS and ROTHSTEIN 1989 Down; NEVO-CASPI and KUPIEC 1994 Down; BRATTY et al. 1996 Down; SAXE et al. 2000 Down) and Schizosaccharomyces pombe (GRIMM et al. 1991 Down). There is a group of proteins in yeast (Hpr1, Tho2, Mft1, Thp2, and Thp1) from which the null mutations lead to transcription defects linked to an increase in direct-repeat recombination (CHAVEZ and AGUILERA 1997 Down; PRADO et al. 1997 Down; PIRUAT and AGUILERA 1998 Down; CHAVEZ et al. 2000 Down; GALLARDO and AGUILERA 2001 Down). In mammalian cells, RNAPII-driven transcription is linked to two important developmentally regulated recombination processes, V(D)J recombination (BLACKWELL et al. 1986 Down; LAUSTER et al. 1993 Down; OLTZ et al. 1993 Down) and immunoglobulin class switching (DANIELS and LIEBER 1995 Down).

Homologous recombination is catalyzed by a number of Rad proteins whose biochemical activities are being identified (PAQUES and HABER 1999 Down; SUNG et al. 2000 Down). RAD51, RAD59, and RAD52 are among those most representative ones due to their particular relevance in different types of recombination events.

Rad51 is the eukaryotic homolog of RecA (ABOUSSEKHRA et al. 1992 Down; BASILE et al. 1992 Down; SHINOHARA et al. 1992 Down; OGAWA et al. 1993 Down). Rad51 promotes homologous pairing and strand-exchange reactions (SUNG 1994 Down). Together with Rad54, Rad55, and Rad57, the Rad51 protein is required for gene conversions and crossovers in which a strand-exchange reaction is a landmark step. However, Rad51 is not required either for deletions or for a large proportion of inversion events occurring between DNA repeats (MCDONALD and ROTHSTEIN 1994 Down; AGUILERA 1995 Down; RATTRAY and SYMINGTON 1995 Down; BAI and SYMINGTON 1996 Down; JABLONOVICH et al. 1999 Down; KANG and SYMINGTON 2000 Down; MALAGON and AGUILERA 2001 Down). These observations are consistent with the actual idea that deletions and inversions may occur in the absence of Rad51 by mechanisms not requiring strand exchange such as break-induced replication (BIR) and single-strand annealing (SSA; BARTSCH et al. 2000 Down; KANG and SYMINGTON 2000 Down; MALAGON and AGUILERA 2001 Down; RATTRAY et al. 2001 Down). In these events, Rad59 seems to play a major role. This hypothesis has raised the possibility that Rad59 is more relevant in reactions occurring in the absence of Rad51-mediated strand exchange. In addition, it explains why the major effect on recombination of rad59 is observed in a rad51 background (BAI and SYMINGTON 1996 Down; AGUILERA 2001 Down; DAVIS and SYMINGTON 2001 Down; MALAGON and AGUILERA 2001 Down). Rad59 seems to be involved in the removal of nonhomologous sequences from the ends of single-strand DNA (ssDNA) and in the reannealing of complementary DNA sequences (PETUKHOVA et al. 1999 Down; SUGAWARA et al. 2000 Down; DAVIS and SYMINGTON 2001 Down).

Rad52 is a strand-annealing protein that forms ring structures at the ends of ssDNA (MORTENSEN et al. 1996 Down; SHINOHARA et al. 1998 Down; PARSONS et al. 2000 Down). In vitro, Rad52 stimulates the Rad51-promoted strand-exchange reaction presumably by overcoming the inhibitory effects of the single-strand binding protein RPA (SUNG 1997 Down; BENSON et al. 1998 Down; NEW et al. 1998 Down; SHINOHARA and OGAWA 1998 Down). Rad52 seems to be essential at an early step of double-strand-break (DSB) recombinational repair prior to or during strand invasion (SUNG et al. 2000 Down). This explains why Rad52 is required for all types of homologous recombination, including deletions between direct repeats, inversions, gene conversions, and crossovers between homologous chromosomes (PAQUES and HABER 1999 Down).

An additional relevant gene for the study of recombination is RAD1, whose product constitutes, together with Rad10, the nucleotide (nt) excision-repair endonuclease activity that cleaves ssDNA "flap" structures (TOMKINSON et al. 1993 Down). Rad1 is necessary in recombination for removal of nonhomologous 3' tails, a step essential for the mechanism of SSA responsible for deletions between repeats (FISHMAN-LOBELL and HABER 1992 Down; IVANOV and HABER 1995 Down).

Our main interest is to understand how transcription stimulates recombination. Consequently, we have determined the effect of transcription on two different types of homologous recombination events: Rad51-dependent gene conversions and Rad51-independent inversions. We have undertaken for the first time a comparative genetic and molecular analysis of TAR and double-strand-break (DSB)-induced recombination using the same recombination substrates. We have determined the effect of rad1, rad51, rad52, and rad59 mutants on each type of recombination event. Our results suggest that transcription of a DNA sequence increases the formation of DNA breaks or DNA lesions that are processed into DNA breaks, which could be repaired by double-strand-break repair (DSBR), synthesis-dependent strand annealing (SDSA), BIR, or SSA, depending on the structure and location of the donor sequence.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and plasmids:
Yeast strains used in this study are listed in Table 1. All strains used for the analyses of recombination of inverted-repeat systems were isogenic with W303. Those used with the plasmid-chromosome recombination construct were derivatives of W303 and its congenic strain AYW3-1Bu-. Deletions of RAD1, RAD51, RAD52, and RAD59 genes were accomplished with the PCR-based method using the kanMX4 (WACH et al. 1994 Down) or the hphMX4 (GOLDSTEIN and MCCUSKER 1999 Down) cassettes and the 60-mer oligonucleotides described previously for each rad mutation (MALAGON and AGUILERA 2001 Down). Correct deletions were confirmed by methyl methanesulfonate or UV sensitivity, PCR, and Southern blot analysis as previously described (MALAGON and AGUILERA 2001 Down). Isogenic double mutants were constructed by genetic crosses.


 
View this table:
In this window
In a new window

 
Table 1. Strains

Plasmids constructed for this study are as follows. Plasmid pCM189-L2 is pCM189 (GARI et al. 1997 Down) in which the 1.34-kb BamHI-SspI LEU2 fragment of p414GLEU2 (PIRUAT and AGUILERA 1998 Down) has been inserted at BamHI-HpaI in the polylinker under the tet promoter (Ptet). Plasmid p414GL2HOr is p414GLEU2 with a 25-bp insertion at the EcoRI site of LEU2 (leu2-HOr allele). Such a 25-bp fragment contains the 21-bp HO site (NICKOLOFF et al. 1986 Down) made by hybridization of oligonucleotides AATTTCAGCTTTCCGCAACAGTATA and AATTTATACTGTTGCGGAAAGCTGA. Plasmid pCM189-L2HOr is pCM189 in which the 1.34-kb BamHI-SspI leu2-HOr fragment of p414GL2HOr has been inserted at BamHI-HpaI in the polylinker. Plasmid pRS316-L2{Delta} is pRS316 (SIKORSKI and HIETER 1989 Down) in which the 1.4-kb blunt-ended ClaI-SalI LEU2 fragment has been inserted at the SmaI site in the appropriate orientation. pRS316-INV is pRS316-L2{Delta} in which the 2.36-kb XhoI-HindIII Ptet::leu2-HOr fragment of pCM189-L2HOr has been inserted at XhoI-HindIII of the polylinker. pRS316-TINV is pRS316-INV in which the 1.8-kb blunt-ended EcoRI-XhoI fragment of pCM189 containing the tTA transactivator has been inserted at the blunt-ended XbaI site in the same orientation as the Ptet::leu2-HOr fragment.

Genetic and molecular analysis of recombination:
Recombination frequencies are the median values of fluctuation tests performed with six independent yeast colonies each, as previously described (PRADO and AGUILERA 1995 Down). For every genotype, the fluctuation test was repeated three times with three different yeast transformants. The final frequency shown for each genotype corresponds to the median value of the three median frequencies obtained from the tests. For low- or no-transcription conditions, frequencies were obtained from yeast colonies grown on medium containing 2% glucose medium and 5 µg/ml doxycycline (dox). TAR frequencies were obtained from yeast colonies grown on SC-2% glucose without dox. For the analysis of HO-mediated DSB recombination, mid-log phase yeast cells carrying the HO gene under the control of GAL1 were obtained from SC-3% glycerol/2% lactate + dox liquid cultures and split into two halves. One-half was maintained in liquid SC-3% glycerol/2% lactate + dox (no HO expression) and the other was cultured in SC-2% galactose + dox for 6 hr for transient expression of HO, before performing fluctuation tests. Recombinants were selected on SC-leu-ura containing 2% glucose. HO-induced recombination values were obtained by subtracting the frequency of nonhomologous end-joining (NHEJ) from the total frequency of Leu+ events.

Gene conversions and inversions in the inverted-repeat construct were determined by Southern and PCR analyses. The first was performed on total DNA of independent Leu+ recombinants digested with SspI and probed with the 32P-labeled 1.2-kb ClaI-SspI internal LEU2 fragment. The latter was determined with reactions using a mix of the three oligonucleotides CCGGCAGATCAATTCCTCGATC (a), TTAGAGCGGATGTGGGGGAG (b), and GAAGGTTTTGGGACGCTCGAAG (c).

The directionality of gene conversion in the plasmid-chromosome recombination construct was determined genetically. First, independent Leu+ gene convertants that lost their plasmid were selected on SC + FOA. Afterward the Ura- segregants were scored for their ability to grow on SC-leu, where only gene convertants of the chromosomal leu2-k allele were able to form colonies.

Miscellaneous:
Growth conditions and genetic analyses were performed according to previously published methods (PRADO and AGUILERA 1995 Down). Southern and Northern analyses were performed as described (CHAVEZ and AGUILERA 1997 Down). RNA levels were quantified with a Fuji FLA3000 analyzer and were normalized with respect to the 28S rRNA values.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

A new Ptet::leu2-HOr allele, containing a 21-bp HO site, for the analyses of transcription-associated and DSB-induced recombination:
Our goal in this study was to determine the genetic requirements of TAR in comparison with spontaneous recombination occurring under no- or low-transcription conditions and with DSB-induced recombination. To construct recombination substrates that were valid for the analysis of transcription-associated and DSB-induced recombination we first placed the LEU2 open reading frame under a modified Ptet promoter, which is negatively controlled by the presence of dox (GARI et al. 1997 Down). Using a Ptet::LEU2 fusion (plasmid pCM189-L2) we first showed that dox both impeded growth in SC-leu and reduced the LEU2 mRNA up to 11% of the levels observed without dox (Fig 1A and Fig B).



View larger version (78K):
In this window
In a new window
Download PPT slide
 
Figure 1. Expression of Ptet::LEU2 and kinetics of HO cleavage at the Ptet::leu2-HOr fusion. (A) Molecular and genetic analysis of expression of a Ptet::LEU2 fusion. Colony formation of the wild-type strain (WS) containing the plasmid pCM189-L2 (Ptet::LEU2) after 3 days on SC-ura-leu supplemented with 5 or 20 µg/ml dox. (B) Northern analysis of the WS wild-type transformant grown in SC-ura supplemented with 5 or 20 µg/ml dox. The percentages of LEU2 mRNA are referred to the zero time values and were obtained after normalizing values with respect to the 28S rRNA. Identical results were obtained with the leu2-HOr allele (not shown). (C) Southern analysis of HO cleavage in the leu2-HOr allele under low (L; 5 µg/ml dox) and high (H; -dox) transcription conditions in the OI-15 wild-type strain. SC-3% glycerol-2% lactate-ura with or without dox mid-log phase cultures were split into two halves. One-half was supplemented with 2% glucose and the other with 2% galactose. DNA samples were taken at hourly intervals and digested with EcoRI for Southern analysis. A scheme of plasmid pCM189-L2HOr containing the leu2-HOr allele and the quantification data of the 6.6-kb band resulting from HO cleavage and EcoRI restriction is shown. A 32P-labeled 1.2-kb ClaI-SspI internal LEU2 fragment was used as a probe (gray line). The 7.3- and 3.4-kb bands correspond to the chromosomal leu2-3,112 marker. Sizes are indicated in kilobases.

We next constructed a leu2-HOr allele containing the 21-bp HO site at the LEU2 EcoRI site, instead of the full 117-bp HO site used in most previously reported recombination assays (PAQUES and HABER 1999 Down). We used a leu2-HOr substrate under the control of Ptet to be able to use the PGAL1::HO fusion to study TAR and DSB-induced recombination with the same substrates. Transcript levels of Ptet::leu2-HOr were the same as in Ptet::LEU2 as determined by Northern analyses (Fig 1; data not shown). We analyzed by Southern hybridization the kinetics of HO cleavage in this allele, under conditions of high (-dox) or low transcription (+dox) of the leu2-HOr allele. As expected, HO did not cleave the 21-bp HO site with full efficiency (Fig 1C). The levels of DSBs reached a maximum value of ~4% of total DNA after 2 hr of shifting cells to galactose. Interestingly, this efficiency of HO cleavage was obtained with low transcription. Under high-transcription conditions the overall efficiency of HO cleavage was ~2.5-fold lower (Fig 1C). This result suggests that the accessibility or affinity of the HO endonuclease to the 21-bp HO site was significantly reduced by transcription. Relative frequencies of HO-induced recombination were the same under both high- and low-transcription conditions. For this reason only the results with low transcription will be shown.

A plasmid-chromosome construct to study transcription-associated and DSB-induced gene conversions:
We first developed a recombination substrate that permitted us to analyze spontaneous gene conversion events occurring under low- and high-transcription conditions as well as by induction with HO. The recombination construct was based on the leu2-k allele (fill-out of the KpnI site) at the LEU2 chromosomal locus and on the Ptet::leu2-HOr allele in the monocopy plasmid pCM189. In this construct, recombinants were scored as Leu+ colonies. They could arise by gene conversion of either the chromosomal leu2-k allele or the plasmidic leu2-HOr allele (Fig 2A). Leu+ reciprocal exchange events, leading to the integration of the plasmid into the chromosome, were never recovered. This was expected as a consequence of the instability of the resulting dicentric chromosomes (SUROSKY and TYE 1985 Down). Therefore, this recombination construct was designed specifically to study gene conversion events.



View larger version (35K):
In this window
In a new window
Download PPT slide
 
Figure 2. Plasmid-chromosome recombination constructs used to study transcription-associated and HO-induced gene conversion. (A) Recombination between pCM189-L2HOr, carrying the leu2-HOr allele under Ptet, and chromosome III, carrying the leu2-k allele under its own promoter, PLEU2. Leu+ recombinants can arise by gene conversion of either allele, leu2-HOr or leu2-k. (B) Recombination frequencies at low (5 µg/ml dox) and high levels of transcription (-dox). (C) Low-transcription spontaneous (-HO) and DSB-induced (+HO) Leu+ recombination frequencies after 6 hr of HO activation in 2% galactose under low-transcription conditions. Each value represents the median of three different fluctuation tests, each performed with three different transformants. Strains used were AYW3-1Bu- (wild-type), AWR1-2B (rad1), AWR1-2BH (rad1), AWR51-2B (rad51), AWR52-3B (rad52), AWR59-5C (rad59), AWR159-13C (rad1 rad59), AWR151-2BH (rad1 rad51), AWR5159-1A (rad51 rad59), MAWR-4C (wild-type), MAWR1-3C (rad1), MAWR59-3C (rad59), MAWR51-3D (rad51), and MAWR52-8D (rad52). HO-induced homologous recombination values were obtained by subtracting the frequency of illegitimate Leu+ recombinants (2.2 x 10-4) from the total frequency of Leu+ events (see text). Those cases (rad52 and rad51 rad59) with resulting frequencies below 1 x 10-4 are indicated as below detection (BD). In such cases, the fold-increase value was not applicable (NA).

Transcription-associated gene conversions show the same patterns of RAD51 and RAD59 dependency as do DSB-induced gene conversions:
Fig 2B shows that high-transcription levels stimulate gene conversion between the leu2-HOr and leu2-k alleles 8 times the frequency obtained with low transcription. Increases in gene conversions were observed in rad1, rad51, rad59, and rad52 cells as well as in double-mutant combinations. Recombination in both cases was independent of RAD1 and strongly dependent on RAD52. Recombination was significantly reduced in rad51 cells (35 and 45 times with respect to the wild type under low and high levels of transcription, respectively), but weakly affected in rad59 cells (3.8 and 2.1 times). None of the double-mutant combinations done with rad1, rad51, and rad59 showed synergistic effects, rad51 being epistatic over rad1 and rad59, and rad59 being epistatic over rad1 at both low- and high-transcription conditions. However, some quantitative differences existed between low and high transcription. Thus, the highest stimulation of gene conversions by transcription was obtained in rad1 rad59 cells (64 times) and the lowest in rad51 rad59 cells (2 times). The observation that recombination in rad51 rad59 cells was 3 times lower than that in rad51 cells confirms that Rad59 is only slightly required for transcription-associated gene conversion events.

Gene conversions were strongly induced by HO in the plasmid-chromosome assay. When yeast colonies were grown in media containing 2% galactose, all cells became recombinants in wild-type and rad mutant cells as a consequence of recurrent HO cleavage (our unpublished data). Nevertheless, rad51 and rad52 mutants took longer to grow under these conditions, due to their low efficiency of DSB recombinational repair (data not shown). For this reason, we did all experiments with a transient expression of HO for 6 hr in liquid media. Under these conditions, we could obtain a reliable recombination frequency, clearly above spontaneous levels. Fig 2C shows that HO-mediated DSBs induced recombination strongly in all strains tested. However, the pattern of dependency on rad51, rad59, and rad52 was similar to that of the spontaneous recombination under low and high levels of transcription. A strong dependency on RAD51 and RAD52 and a weak dependency on RAD59 was observed (Fig 2C). Thus the frequency of HO-induced recombination was 180-, >106-, and 5.8-fold below wild-type levels in rad51, rad52, and rad59 cells, respectively. These results contrast with the lower dependency on RAD genes observed for spontaneous (non-HO-induced) recombination in which rad51, rad52, and rad59 reduced recombination 53-, 320-, and 2.7-fold below wild-type levels (Fig 2C). The only exception was rad1 in which the frequency of HO-induced gene conversions was 106 times below wild-type levels but the frequency of spontaneous events was reduced only 2.3-fold. This result might be caused by the requirement for Rad1 in recombination events that initiate at heterologous regions (FISHMAN-LOBELL and HABER 1992 Down; IVANOV and HABER 1995 Down; PAQUES and HABER 1997 Down; COLAIACOVO et al. 1999 Down). Most spontaneous events could initiate at the homologous leu2 sequences, outside the HO site, which would not require Rad1/Rad10 to be processed.

Transcription-associated gene conversions initiate at the highly transcribed DNA sequence:
Genetic analysis of the directionality of gene conversions in the plasmid-chromosome assay revealed that under high-transcription conditions, most spontaneous recombination events occurred by gene conversion of the strongly transcribed leu2-HOr allele in wild-type and rad strains (Table 2). This is clearly observed in wild-type cells, in which all spontaneous recombination events converted the leu2-HOr allele. As expected, all HO-induced gene conversion events, among a total of 62 Leu+ events analyzed, converted the leu2-HOr allele into LEU2 in wild-type and all rad mutant strains. As all HO-induced Leu+ events were initiated by a DSB at the leu2-HOr allele, it was expected that they occur by copying the wild-type information from the leu2-k allele. Our results, therefore, indicate that transcription facilitates initiation of the recombination event at the strongly transcribed sequence, leu2-HOr, which acts as recipient of information in the gene conversion event. Interestingly, a large majority of spontaneous Leu+ events occurring with low transcription also underwent gene conversion of the leu2-HOr allele in wild-type cells, although to a minor degree (Table 2). This implies that most spontaneous events were also initiated at the leu2-HOr allele. It is likely that the low levels of transcription at the leu2-HOr were enough to facilitate initiation of recombination at this allele.


 
View this table:
In this window
In a new window

 
Table 2. Spontaneous mitotic gene conversion proportions in the plasmid-chromosome system

At low transcription, although leu2-HOr is the allele preferentially converted in most strains tested, in most of the rad mutant combinations tested the proportion of conversion of leu2-k (4-bp insertion) is lower than that of leu2-HOr (25-bp insertion) relative to high transcription (Table 2). The case of the rad1 rad51 cells is worth mentioning, in which spontaneous gene conversion of the chromosomal leu2-k allele was clearly favored as compared to other rad mutants, including rad1 and rad51 single mutants. This may reflect a higher difficulty in conversion of long heterologies in rad mutants.

TAR between inverted repeats occurs similarly to DSB-induced recombination in a RAD51-independent and RAD59-dependent manner:
Recombination was next analyzed between inverted repeats. The rationale was that inversions can also occur by a mechanism different from gene conversions and reciprocal exchange (BARTSCH et al. 2000 Down; MALAGON and AGUILERA 2001 Down; RATTRAY et al. 2001 Down). Therefore, we constructed an inverted-repeat assay (TINV) on the basis of the Ptet::leu2-HOr allele and a leu2{Delta}5' allele. This leu2{Delta}5' copy was not transcribed, as determined by Northern analysis (data not shown). With this assay, Leu+ recombinants could occur in principle either by gene conversion of the leu2-HOr copy, whether or not associated with an inversion of the region located between the repeats, or by a crossover upstream of the HO site of leu2-HOr (Fig 3A).



View larger version (37K):
In this window
In a new window
Download PPT slide
 
Figure 3. TINV inverted-repeat construct used to study TAR and HO-induced recombination. (A) Plasmid substrate pRS316-TINV carrying two inverted leu2 sequences. One copy is the leu2-HOr allele under Ptet and the other is a 5'-end truncated allele (leu2{Delta}5'). Transcription of leu2 is driven only from Ptet. Leu+ recombinants can arise by gene conversion of leu2-HOr without an associated inversion or by crossover occurring upstream of the HO site, whether or not associated with gene conversion. (B and C) As in Fig 2. Strains used were WS (wild type), WSR52 (rad52), WSR59 (rad59), WSR1-1C (rad1), WSR51-8A (rad51), MKOS-3B (rad51), WSR52-5C (rad52), WSR159-3B (rad1 rad59), WSR151-10D (rad1 rad51), and WSR5951-1D (rad51 rad59). Other details as in Fig 2.

High-transcription conditions stimulated recombination in both wild-type and rad mutants, although at low level (2- to 11-fold). We believe that this is the case because, in contrast to gene conversions in the plasmid-chromosome system, the basal recombination levels in this system were already high (above 10-4). This introduces a background noise above which TAR is less clearly detected.

The pattern of dependency of the RAD genes of both TAR and recombination under low-transcription conditions was similar. Fig 3B shows that spontaneous inverted-repeat recombination was strongly affected in rad52 cells. In contrast to the gene conversion events of the plasmid-chromosome assay, inverted-repeat recombination was not affected by the rad51 mutation and was slightly reduced by rad59 (4- to 8-fold below wild-type levels). Indeed, as inversions in rad59 cells represent half the proportion of total inversions as compared to wild-type cells (Fig 4), the decreases caused by rad59 in the frequency of total Leu+ inversions are between 6.8- and 12.4-fold (Fig 3 and Fig 4). The rad59 and rad51 mutations show additive effects on the reduction of the frequency of inverted-repeat recombination, consistent with previous observations (BAI and SYMINGTON 1996 Down; MALAGON and AGUILERA 2001 Down). As reported with other assays, Rad1 becomes important in spontaneous inverted-repeat recombination when Rad51 is absent (AGUILERA 1995 Down; RATTRAY and SYMINGTON 1995 Down).



View larger version (29K):
In this window
In a new window
Download PPT slide
 
Figure 4. Molecular analysis of inversions in the TINV inverted-repeat system. (A) Scheme of the inverted-repeat substrate, indicating the primers (a, b, and c), PCR products (black line), and SspI fragments (gray line) expected from PCR and Southern analyses. (B) PCR analysis using a combination of primers a, b, and c and Southern analysis after digestion with SspI of total DNA from Leu+ independent recombinants. Sizes are indicated in kilobases. (C) Percentage of inversions in each strain under low and high levels of transcription. Strains are those used in Fig 3. The total number of Leu+ independent recombinants tested are shown in parentheses. An asterisk indicates that the difference from the wild-type value is statistically significant according to a {chi}2 test (P < 0.05).

This result, different from those of the plasmid-chromosome system, indicates that gene conversion may not be the major spontaneous recombination event between inverted repeats under both low- and high-transcription conditions. Instead, a Rad51-independent and Rad1- and Rad59-dependent mechanism might be the primary pathway leading to Leu+ events between inverted repeats, presumably BIR and SSA, as suggested previously (BARTSCH et al. 2000 Down; MALAGON and AGUILERA 2001 Down; RATTRAY et al. 2001 Down).

When HO was induced for 6 hr in 2% galactose, recombination was strongly stimulated. Again, DSB-induced recombinants were almost abolished in rad52 cells, unaffected in rad1 and rad51 cells, and reduced in rad59 cells (5.3-fold below wild-type levels; Fig 3C), showing, therefore, the same pattern of genetic requirements as spontaneous recombination.

Finally, PCR analysis of independent Leu+ recombination events showed that 30% were associated with an inversion in wild-type cells under low- and high-transcription conditions (Fig 4). There are no significant differences (P < 0.05) in the proportion of inversions in wild-type and rad cells. Indeed, the percentage of inversions was also similar for DSB-induced recombination in wild-type, rad51, and rad59 cells (our unpublished data). These results confirm that inversions may occur efficiently in the absence of Rad51, via a Rad1- and Rad59-dependent recombination mechanism with both low and high transcription. It is worth noting that inversions are frequently in association with plasmids carrying noninverted repeats (our unpublished data).

Illegitimate end-joining causes high levels of Leu+ events at the leu2-HOr allele:
In wild-type and rad strains HO induced Leu+ recombinants two to three orders of magnitude above spontaneous levels. Unexpectedly, HO-induced Leu+ events were very high in rad52 strains (1.7 and 3.3 x 10-4 for the plasmid-chromosome and inverted-repeat recombination assays, respectively). Here we show that such a high frequency of recombination was the result of NHEJ. We know that leu2{Delta} strains with plasmid pCM189-L2HOr, carrying only a leu2-HOr copy, should never lead to Leu+ events by homologous recombination because they lack wild-type LEU2 sequences acting as donors of information. However, using these assays, HO-induced Leu+ events were obtained at frequencies ranging from 1.5 to 3.0 x 10-4 in wild-type, rad51 rad59, and rad52 strains. These frequencies were similar to those of HO-induced Leu+ events obtained with the plasmid-chromosome system in rad51 rad59 (1.96 x 10-4) and rad52 cells (1.7 x 10-4) or with the TINV inverted-repeat constructs in rad52 cells (3.3 x 10-4). This is explained by the capability of our 25-bp insertion mutation containing the 21-bp HO site to be converted by illegitimate NHEJ into 27-bp insertions that reestablish the LEU2 wild-type frame (MOORE and HABER 1996 Down). Therefore, our results indicate that HO can induce detectable gene conversion events in all rad mutants analyzed except rad51 rad59 and rad52 and inverted-repeat recombination in all rad mutants except rad52. For this reason, HO-induced recombination values were obtained by subtracting the frequency of NHEJ from the total frequency of Leu+ events (Fig 2 and Fig 3).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

For the comparative analysis of TAR and DSB-induced recombination we developed new inter- and intramolecular recombination substrates on the basis of a leu2-HOr allele fused to the regulated Ptet promoter and containing a 21-bp HO site. These substrates allowed the study of different types of recombination events, including gene conversions and inversions, which may occur by distinct mechanisms as deduced from their different dependencies on Rad51 and Rad59. We have shown that highly transcribed sequences act as recipients of gene conversions. Importantly, TAR shows similar dependencies such as HO-induced recombination on the DSB-repair genes RAD1, RAD51, RAD52, and RAD59. These results suggest that high transcription facilitates the formation of DNA breaks along the DNA sequence being transcribed. We argue that transcription is able to increase all types of homologous recombination events, whether occurring by DSBR, SDSA, or BIR/SSA mechanisms.

Intra- and intermolecular recombination events show different Rad51 and Rad59 requirements:
All homologous recombination events analyzed in this study were Rad52 dependent. However, we observed different Rad51 and Rad59 genetic requirements between intramolecular gene conversions and intermolecular gene conversion and inversions, regardless of whether they initiated spontaneously (under low- and high-transcription conditions) or by an HO-induced DSB. As expected, intermolecular gene conversions were dependent on the Rad51 strand-exchange protein. This is consistent with a number of published observations (SUGAWARA et al. 1995 Down; BRATTY et al. 1996 Down; ELIAS-ARNANZ et al. 1996 Down; BARTSCH et al. 2000 Down), confirming that the major mitotic mechanism leading to intermolecular gene conversions is either DSBR (SZOSTAK et al. 1983 Down) or SDSA (HASTINGS 1988 Down; MCGILL et al. 1989 Down), which requires Rad51-mediated strand exchange (PAQUES and HABER 1999 Down). However, it is worth noting that the levels of plasmid-chromosome gene conversions in rad51 mutants were still fivefold above rad52 levels. There is evidence that the most likely mechanism for recombination in the absence of Rad51-mediated strand exchange is BIR (MALKOVA et al. 1996 Down; SIGNON et al. 2001 Down). It is possible, therefore, that in rad51 cells plasmid-chromosome gene conversions occurred via BIR initiated at either 3'-end of the DSB. This would result in a linear plasmid containing leu2 repeats that would yield a converted Leu+ circular plasmid by SSA.

In contrast to intermolecular events, gene conversion and inversion between inverted repeats occur with wild-type efficiency in rad51 cells. This result confirms that inverted-repeat recombination leading to Leu+ events is efficient in the absence of a Rad51-mediated strand-exchange reaction. It is likely that in the absence of Rad51 many Leu+ inverted-repeat recombination events occur via BIR followed by SSA as previously proposed (BARTSCH et al. 2000 Down; MALAGON and AGUILERA 2001 Down). Indeed, the detection of duplicated inverted-repeat fragments among the recombination products of mre11, rad50, and sae2/com1 cells is consistent with BIR as a mechanism responsible for inversions (RATTRAY et al. 2001 Down).

As expected from the observation that Rad51 and Rad59 control different genetic recombination pathways (BAI and SYMINGTON 1996 Down), Rad51-independent spontaneous and DSB-induced inverted-repeat gene conversions and inversions are more dependent on Rad59 than are Rad51-dependent plasmid-chromosome gene conversions (Fig 2 and Fig 3). These results are consistent with the idea that Rad59 plays an important role in the formation of inversions (SUGAWARA et al. 2000 Down; DAVIS and SYMINGTON 2001 Down; MALAGON and AGUILERA 2001 Down). Rad59 has strand-annealing activity (PETUKHOVA et al. 1999 Down; DAVIS and SYMINGTON 2001 Down) and might be important, together with Rad52, for strand invasion in the absence of Rad51 (BARTSCH et al. 2000 Down; AGUILERA 2001 Down; DAVIS and SYMINGTON 2001 Down). Therefore, Rad59 may be required in inverted-repeat recombination for the initial BIR event and for the putative SSA event following BIR.

It is likely that in wild-type cells BIR is responsible for only a low proportion of events (MALKOVA et al. 1996 Down; SIGNON et al. 2001 Down). However, if both inter- and intramolecular events can theoretically occur in rad51 cells by BIR/SSA, the question arising is why this mechanism is much more efficient in intramolecular events. We believe that invasion of a 3'-end into a "closed" DNA structure clearly requires Rad51, as has been suggested previously (SUGAWARA et al. 1995 Down). However, in intrachromosomal repeats, where invasion occurs at a sequence adjacent to the site of initiation, recombination can efficiently take place in the absence of Rad51. It is likely that the DSB will change the supercoiling (DUGUET 1997 Down) and chromatin structure of the DNA (DOWNS et al. 2000 Down; PAULL et al. 2000 Down), leading to an "open" DNA structure at the adjacent repeat sequence and facilitating, in consequence, Rad59-Rad52-dependent strand invasion in the absence of Rad51.

Finally, it is worth noting that Rad1 had little effect on both spontaneous and DSB-induced interchromosomal gene conversion and inverted-repeat recombination, with one exception: HO-induced plasmid-chromosome gene conversions are Rad1 dependent. This was unexpected, because cleavage of the 21-bp HO site leads to tails containing 16- and 9-nt heterologous 3'-ended strands (NICKOLOFF et al. 1986 Down). Nevertheless, Rad1/Rad10 has been shown not to be required for the removal of heterologous tails <30 bp in intramolecular events (PRADO and AGUILERA 1995 Down; PAQUES and HABER 1997 Down). Considering the hypothesis mentioned above, it is possible that the 16- and 9-bp heterologous tails significantly diminish the invasion efficiency of the 3' end into a closed DNA sequence (intermolecular event) but not into a less restrictive open DNA sequence (intramolecular events). Removal of the heterologous tails by Rad1 would therefore facilitate strand invasion in intermolecular events and the formation of plectonemic joint molecules.

Transcription-associated and DSB-induced recombination events are similar and show identical gene requirements:
We have used two different constructs containing the same leu2 alleles to show that transcription induces any type of recombination event. Our results, together with previously reported data on deletions (THOMAS and ROTHSTEIN 1989 Down) and ectopic recombination (BRATTY et al. 1996 Down; NEVO-CASPI and KUPIEC 1996 Down; SAXE et al. 2000 Down), indicate that transcription does not specifically stimulate a particular type of recombination mechanism, whether DSBR, SDSA, BIR, or SSA. Gene conversions occurring between different DNA molecules are strongly stimulated by transcription (Fig 2), consistent with the observations that ectopic gene conversions between heterologous chromosomes are stimulated by transcription (BRATTY et al. 1996 Down; NEVO-CASPI and KUPIEC 1996 Down; SAXE et al. 2000 Down). As reported for ectopic recombination (SAXE et al. 2000 Down), we observed that the highly transcribed DNA sequence is preferentially converted; that is, it acts as a recipient of information in our plasmid-chromosome assay (Table 2). According to the DSBR (SZOSTAK et al. 1983 Down) and SDSA models (HASTINGS 1988 Down; MCGILL et al. 1989 Down), the results are consistent with the idea that transcription stimulates the initiation of recombination.

Transcription stimulates recombination in all rad mutants tested, confirming that transcription induces all types of recombination events, whether or not Rad51 and Rad59 dependent. Consistent with our results, a parallel study showed that transcription of the recipient molecule increases ectopic recombination between heterologous chromosomes in both rad51 and rad59 mutants (J. A. FREEDMAN and S. JINKS-ROBERTSON, unpublished results). Importantly, using the same recombination systems we show for the first time that spontaneous recombination occurring under both low and high transcription has the same RAD51, RAD52, and RAD59 gene requirements as HO-induced recombination (Fig 2 and Fig 3). This is so, despite the different pattern of RAD dependency observed for each type of recombination event studied. The similar gene requirements of TAR and HO-induced recombination suggest that the initiation events stimulated by transcription are DNA breaks and/or lesions that subsequently lead to DNA breaks.

The main emerging question is how transcription through one DNA sequence can contribute to the initiation of recombination, that is, to the formation of DNA breaks. We envision two possible scenarios (AGUILERA 2002 Down). First, transcription can encounter the replication machinery and lead to a replication fork blockage. Such a blockage could cause a fork reversal leading to Holliday junctions with one arm formed with the newly synthesized leading and lagging strands and with a recombinogenic double-strand tail (SEIGNEUR et al. 1998 Down; MICHEL et al. 2001 Down). Interestingly, experiments using E. coli strains with high levels of the (p)ppGp signal molecules that modulate RNAP activity or with a mutated RNAP suggest that the RNAP might contribute to the formation of recombinogenic Holliday junctions by promoting fork reversal (MCGLYNN and LLOYD 2000 Down).

In an alternative scenario, the opening of the chromatin structure of the DNA strands, facilitated by the transient accumulation of supercoiled negative DNA behind the advancing RNAPII, could increase the accessibility of DNA-damaging agents, such as free radicals (AGUILERA 2002 Down). This could lead to recombinogenic DNA breaks, whether directly or after the subsequent action of the replication fork. The rationale for this hypothesis is that ssDNA is more reactive than double-strand DNA (FREDERICO et al. 1990 Down). This would be consistent with the observations that the spontaneous mutagenesis of a gene increases with transcription, as shown in E. coli (BELETSKII and BHAGWAT 1996 Down) and S. cerevisiae (DATTA and JINKS-ROBERTSON 1995 Down). Indeed, the mutation rate is higher with a mutant T7 polymerase having a slower elongation rate (BELETSKII et al. 2000 Down).

In summary, our results provide evidence that transcription elongation may contribute to the formation of DNA breaks or lesions that are subsequently converted into DSBs. Such breaks would be repaired by DSBR, SDSA, BIR, or SSA, depending on the structure and location of the donor sequence, and therefore can potentially lead to all types of homologous recombination events.


*  ACKNOWLEDGMENTS

We thank F. Prado for reading the manuscript, M. Kupiec for providing strains MK279 and OI-15, S. Jinks-Robertson for communicating unpublished data, and D. Haun for style supervision. Research was funded by grants from the Spanish Ministry of Science and Technology (BMC200-0439) and the Human Frontier Science Program (RG1999/0075). S.G.-B. was a recipient of a predoctoral training grant from the Spanish Ministry of Education and Culture.

Manuscript received April 9, 2002; Accepted for publication July 1, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ABOUSSEKHRA, A., R. CHANET, A. ADJIRI, and F. FABRE, 1992  Semidominant suppressors of Srs2 helicase mutations of Saccharomyces cerevisiae map in the RAD51 gene, whose sequence predicts a protein with similarities to procaryotic RecA proteins. Mol. Cell. Biol. 12:3224-3234.[Abstract/Free Full Text]

AGUILERA, A., 1995  Genetic evidence for different RAD52-dependent intrachromosomal recombination pathways in Saccharomyces cerevisiae.. Curr. Genet. 27:298-305.[Medline]

AGUILERA, A., 2001  Double-strand break repair: Are Rad51/RecA–DNA joints barriers to DNA replication? Trends Genet. 17:318-321.[Medline]

AGUILERA, A., 2002  The connection between transcription and genomic instability. EMBO J. 21:195-201.[Medline]

AGUILERA, A., S. CHAVEZ, and F. MALAGON, 2000  Mitotic recombination in yeast: elements controlling its incidence. Yeast 16:731-754.[Medline]

BAI, Y. and L. S. SYMINGTON, 1996  A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae.. Genes Dev. 10:2025-2037.[Abstract/Free Full Text]

BARTSCH, S., L. E. KANG, and L. S. SYMINGTON, 2000  RAD51 is required for the repair of plasmid double-stranded DNA gaps from either plasmid or chromosomal templates. Mol. Cell. Biol. 20:1194-1205.[Abstract/Free Full Text]

BASILE, G., M. AKER, and R. K. MORTIMER, 1992  Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51.. Mol. Cell. Biol. 12:3235-3246.[Abstract/Free Full Text]

BELETSKII, A. and A. S. BHAGWAT, 1996  Transcription-induced mutations: increase in C to T mutations in the nontranscribed strand during transcription in Escherichia coli. Proc. Natl. Acad. Sci. USA 93:13919-13924.[Abstract/Free Full Text]

BELETSKII, A., A. GRIGORIEV, S. JOYCE, and A. S. BHAGWAT, 2000  Mutations induced by bacteriophage T7 RNA polymerase and their effects on the composition of the T7 genome. J. Mol. Biol. 300:1057-1065.[Medline]

BENSON, F. E., P. BAUMANN, and S. C. WEST, 1998  Synergistic actions of Rad51 and Rad52 in recombination and DNA repair. Nature 391:401-404.[Medline]

BLACKWELL, T. K., M. W. MOORE, G. D. YANCOPOULOS, H. SUH, and S. LUTZKER et al., 1986  Recombination between immunoglobulin variable region gene segments is enhanced by transcription. Nature 324:585-589.[Medline]

BRATTY, J., G. FERBEYRE, C. MOLINARO, and R. CEDERGREN, 1996  Stimulation of mitotic recombination upon transcription from the yeast GAL1 promoter but not from other RNA polymerase I, II and III promoters. Curr. Genet. 30:381-388.[Medline]

CHAVEZ, S. and A. AGUILERA, 1997  The yeast HPR1 gene has a functional role in transcriptional elongation that uncovers a novel source of genome instability. Genes Dev. 11:3459-3470.[Abstract/Free Full Text]

CHAVEZ, S., T. BEILHARZ, A. G. RONDON, H. ERDJUMENT-BROMAGE, and P. TEMPST et al., 2000  A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae.. EMBO J. 19:5824-5834.[Medline]

COLAIACOVO, M. P., F. PÂQUES, and J. E. HABER, 1999  Removal of one nonhomologous DNA end during gene conversion by a RAD1- and MSH2-independent pathway. Genetics 151:1409-1423.[Abstract/Free Full Text]

COX, M. M., 2001  Recombinational DNA repair of damaged replication forks in Escherichia coli: questions. Annu. Rev. Genet. 35:53-82.[Medline]

DANIELS, G. A. and M. R. LIEBER, 1995  RNA:DNA complex formation upon transcription of immunoglobulin switch regions: implications for the mechanism and regulation of class switch recombination. Nucleic Acids Res. 23:5006-5011.[Abstract/Free Full Text]

DATTA, A. and S. JINKS-ROBERTSON, 1995  Association of increased spontaneous mutation rates with high levels of transcription in yeast. Science 268:1616-1619.[Abstract/Free Full Text]

DAVIS, A. P. and L. S. SYMINGTON, 2001  The yeast recombinational repair protein Rad59 interacts with Rad52 and stimulates single-strand annealing. Genetics 159:515-525.[Abstract/Free Full Text]

DOWNS, J. A., N. F. LOWNDES, and S. P. JACKSON, 2000  A role for Saccharomyces cerevisiae histone H2A in DNA repair. Nature 408:1001-1004.[Medline]

DUGUET, M., 1997  When helicase and topoisomerase meet!. J. Cell Sci. 110:1345-1350.[Abstract]

ELIAS-ARNANZ, M., A. A. FIRMENICH, and P. BERG, 1996  Saccharomyces cerevisiae mutants defective in plasmid-chromosome recombination. Mol. Gen. Genet. 252:530-538.[Medline]

FISHMAN-LOBELL, J. and J. E. HABER, 1992  Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1.. Science 258:480-484.[Abstract/Free Full Text]

FREDERICO, L. A., T. A. KUNKEL, and B. R. SHAW, 1990  A sensitive genetic assay for the detection of cytosine deamination: determination of rate constants and the activation energy. Biochemistry 29:2532-2537.[Medline]

GALLARDO, M. and A. AGUILERA, 2001  A new hyperrecombination mutation identifies a novel yeast gene, THP1, connecting transcription elongation with mitotic recombination. Genetics 157:79-89.[Abstract/Free Full Text]

GARI, E., L. PIEDRAFITA, M. ALDEA, and E. HERRERO, 1997  A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae.. Yeast 13:837-848.[Medline]

GOLDSTEIN, A. L. and J. H. MCCUSKER, 1999  Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.. Yeast 15:1541-1553.[Medline]

GRIMM, C., P. SCHAER, P. MUNZ, and J. KOHLI, 1991  The strong ADH1 promoter stimulates mitotic and meiotic recombination at the ADE6 gene of Schizosaccharomyces pombe.. Mol. Cell. Biol. 11:289-298.[Abstract/Free Full Text]

HASTINGS, P. J., 1988  Recombination in the eukaryotic nucleus. Bioessays 9:61-64.[Medline]

HUANG, G. S. and R. L. KEIL, 1995  Requirements for activity of the yeast mitotic recombination hotspot HOT1: RNA polymerase I and multiple cis-acting sequences. Genetics 141:845-855.[Abstract]

IKEDA, H. and T. MATSUMOTO, 1979  Transcription promotes recA-independent recombination mediated by DNA-dependent RNA polymerase in Escherichia coli.. Proc. Natl. Acad. Sci. USA 76:4571-4575.[Abstract/Free Full Text]

IVANOV, E. L. and J. E. HABER, 1995  RAD1 and RAD10, but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:2245-2251.[Abstract]

JABLONOVICH, Z., B. LIEFSHITZ, R. STEINLAUF, and M. KUPIEC, 1999  Characterization of the role played by the RAD59 gene of Saccharomyces cerevisiae in ectopic recombination. Curr. Genet. 36:13-20.[Medline]

KANG, L. E. and L. S. SYMINGTON, 2000  Aberrant double-strand break repair in rad51 mutants of Saccharomyces cerevisiae.. Mol. Cell. Biol. 20:9162-9172.[Abstract/Free Full Text]

LAUSTER, R., C. A. REYNAUD, I. L. MARTENSSON, A. PETER, and D. BUCCHINI et al., 1993  Promoter, enhancer and silencer elements regulate rearrangement of an immunoglobulin transgene. EMBO J. 12:4615-4623.[Medline]

MALAGON, F. and A. AGUILERA, 2001  Yeast spt6-140 mutation, affecting chromatin and transcription, preferentially increases recombination in which Rad51p-mediated strand exchange is dispensable. Genetics 158:597-611.[Abstract/Free Full Text]

MALKOVA, A., E. L. IVANOV, and J. E. HABER, 1996  Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136.[Abstract/Free Full Text]

MCDONALD, J. P. and R. ROTHSTEIN, 1994  Unrepaired heteroduplex DNA in Saccharomyces cerevisiae is decreased in RAD1 RAD52-independent recombination. Genetics 137:393-405.[Abstract]

MCGILL, C., B. SHAFER, and J. STRATHERN, 1989  Coconversion of flanking sequences with homothallic switching. Cell 57:459-467.[Medline]

MCGLYNN, P. and R. G. LLOYD, 2000  Modulation of RNA polymerase by (p)ppGpp reveals a RecG-dependent mechanism for replication fork progression. Cell 101:35-45.[Medline]

MICHEL, B., M. J. FLORES, E. VIGUERA, G. GROMPONE, and M. SEIGNEUR et al., 2001  Rescue of arrested replication forks by homologous recombination. Proc. Natl. Acad. Sci. USA 98:8181-8188.[Abstract/Free Full Text]

MOORE, J. K. and J. E. HABER, 1996  Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:2164-2173.[Abstract]

MORTENSEN, U. H., C. BENDIXEN, I. SUNJEVARIC, and R. ROTHSTEIN, 1996  DNA strand annealing is promoted by the yeast Rad52 protein. Proc. Natl. Acad. Sci. USA 93:10729-10734.[Abstract/Free Full Text]

NEVO-CASPI, Y. and M. KUPIEC, 1994  Transcriptional induction of Ty recombination in yeast. Proc. Natl. Acad. Sci. USA 91:12711-12715.[Abstract/Free Full Text]

NEVO-CASPI, Y. and M. KUPIEC, 1996  Induction of Ty recombination in yeast by cDNA and transcription: role of the RAD1 and RAD52 genes. Genetics 144:947-955.[Abstract]

NEW, J. H., T. SUGIYAMA, E. ZAITSEVA, and S. C. KOWALCZYKOWSKI, 1998  Rad52 protein stimulates DNA strand exchange by Rad51 and replication protein A. Nature 391:407-410.[Medline]

NICKOLOFF, J. A., E. Y. CHEN, and F. HEFFRON, 1986  A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast. Proc. Natl. Acad. Sci. USA 83:7831-7835.[Abstract/Free Full Text]

OGAWA, T., X. YU, A. SHINOHARA, and E. H. EGELMAN, 1993  Similarity of the yeast RAD51 filament to the bacterial RecA filament. Science 259:1896-1899.[Abstract/Free Full Text]

OLTZ, E. M., F. W. ALT, W. C. LIN, J. CHEN, and G. TACCIOLI et al., 1993  A V(D)J recombinase-inducible B-cell line: role of transcriptional enhancer elements in directing V(D)J recombination. Mol. Cell. Biol. 13:6223-6230.[Abstract/Free Full Text]

QUES, F. and J. E. HABER, 1997  Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccharomyces cerevisiae.. Mol. Cell. Biol. 17:6765-6771.[Abstract]

QUES, F. and J. E. HABER, 1999  Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.. Microbiol. Mol. Biol. Rev. 63:349-404.[Abstract/Free Full Text]

PARSONS, C. A., P. BAUMANN, E. VAN DYCK, and S. C. WEST, 2000  Precise binding of single-stranded DNA termini by human RAD52 protein. EMBO J. 19:4175-4181.[Medline]

PAULL, T. T., E. P. ROGAKOU, V. YAMAZAKI, C. U. KIRCHGESSNER, and M. GELLERT et al., 2000  A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr. Biol. 10:886-895.[Medline]

PETUKHOVA, G., S. A. STRATTON, and P. SUNG, 1999  Single strand DNA binding and annealing activities in the yeast recombination factor Rad59. J. Biol. Chem. 274:33839-33842.[Abstract/Free Full Text]

PIRUAT, J. I. and A. AGUILERA, 1998  A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination. EMBO J. 17:4859-4872.[Medline]

P