- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Wieczorek, D. J.
- Articles by Feiss, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Wieczorek, D. J.
- Articles by Feiss, M.
Defining cosQ, the Site Required for Termination of Bacteriophage
DNA Packaging
Douglas J. Wieczoreka and
Michael Feissa
a Genetics Ph.D. Program and Department of Microbiology, University of Iowa, Iowa City, Iowa 52242
Corresponding author: Douglas J. Wieczorek, Department of Microbiology, University of Iowa, 3-315 BSB, Iowa City, IA 52242., wieczorekd{at}mail.medicine.uiowa.edu (E-mail)
Communicating editor: R. MAURER
| ABSTRACT |
|---|
Bacteriophage
is a double-stranded DNA virus that processes concatemeric DNA into virion chromosomes by cutting at specific recognition sites termed cos. A cos is composed of three subsites: cosN, the nicking site; cosB, required for packaging initiation; and cosQ, required for termination of chromosome packaging. During packaging termination, nicking of the bottom strand of cosN depends on cosQ, suggesting that cosQ is needed to deliver terminase to the bottom strand of cosN to carry out nicking. In the present work, saturation mutagenesis showed that a 7-bp segment comprises cosQ. A proposal that cosQ function requires an optimal sequence match between cosQ and cosNR, the right cosN half-site, was tested by constructing double cosQ mutants; the behavior of the double mutants was inconsistent with the proposal. Substitutions in the 17-bp region between cosQ and cosN resulted in no major defects in chromosome packaging. Insertional mutagenesis indicated that proper spacing between cosQ and cosN is required. The lethality of integral helical insertions eliminated a model in which DNA looping enables cosQ to deliver a gpA protomer for nicking at cosN. The 7 bp of cosQ coincide exactly with the recognition sequence for the Escherichia coli restriction endonuclease, EcoO109I.
FOLLOWING DNA replication, many large, double-stranded DNA viruses, such as the herpes and pox viruses and bacteriophage
, produce concatemeric DNA, end-to-end multimers of individual genomes. Virion chromosomes are generated by cutting the concatemeric substrate prior to and during DNA packaging. Specific ends are generated by viral-encoded proteins that recognize and cleave specific DNA sites on the viral chromosome. The mature
-chromosome is a linear chromosome, 48.5 kb in length, with 12-bp cohesive ends at the 5' ends of the strands (![]()
-chromosome is replicated bidirectionally to produce a number of progeny rings. Later, rolling circle replication gives rise to concatemers (![]()
The phage-encoded terminase enzyme is a key player in the
DNA packaging process. Terminase is a heteromultimer composed of two subunits, gpNu1 and gpA (Fig 1). The genes that encode these proteins are located immediately downstream of the cos region at the left end of the mature
-chromosome. The packaging strategy used by bacteriophage
is as follows (![]()
![]()
![]()
is composed of three subsites: cosN, cosB, and cosQ (Fig 1). cosN is the site where staggered nicks are introduced by terminase to generate the cohesive ends of virion DNA and represents the junctions of individual chromosomes in the concatemer. Terminase binds the initial cos site of the concatemer through specific interactions of gpNu1 with cosB and gpA with cosN, forming the initial complex (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
cosN contains a 22-bp element in which 10 of the base pairs show twofold rotational symmetry (![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIAL AND METHODS |
|---|
Media:
Luria broth (LB), Luria agar (LA), and SOB were prepared as described in ![]()
![]()
Strains:
The standard
-strain used was
-P1:5R cI857 Knr nin5; it is designated simply as
-P1 in the text. This strain carries a 10-kb segment of phage P1 DNA encoding functions for plasmid replication and partitioning (![]()
-P1:5R cI857 Knr nin5 prophage replicates as a single copy plasmid using the P1 replication machinery. The cI857 mutation renders the repressor heat labile, allowing prophage induction at 42°. The
-P1:5R cI857 Knr nin5 also carries a 1.3-kb kanamycin-resistance cassette and has a genome size of
46.2 kb (![]()
-P1
cosQ derivative of
-P1:5R cI857 Knr nin5 contains a 14-bp deletion of cosQ from 48,470 to 48,483 (![]()
![]()
+ derivative of MF1427.
General recombinant DNA techniques:
Enzymes for recombinant DNA manipulations were purchased from New England Biolabs (Beverly, MA) and Boehringer Mannheim (Indianapolis) and used according to the manufacturer's recommendations. For cloning segments of
DNA, the commercial vectors pBluescript II SK(-), pIBI31, and pUC19 were used. Plasmid DNA, PCR purifications, and DNA fragments purified from agarose gels were prepared with reagents purchased from QIAGEN (Valencia, CA). Preparation of competent cells and transformations were performed as described by ![]()
Sequence designations:
All references to
-sequence are based on the numbering convention described by ![]()
-sequence begins with the first base of the left cohesive end and continues along the top strand in a 5' to 3' direction. The position of each restriction cut site is given as the first nucleotide of the recognition sequence.
Mutagenesis of cosQ and cosQcosN spacing region:
For all cosQ point mutations from
bp 48,478 to 48,483,
cosQ mutants were constructed by the generation of oligonucleotides bearing the given mutations. Top and bottom strand oligonucleotides were generated bearing the given mutations as well as EcoO109I and BamHI sticky ends. Oligos were annealed and ligated into EcoO109I (
bp 48,473) and BamHI digested pBUC1. pBUC1 is a pBluescript SK(-) based vector with a
DNA insert from bp 48,446 to 458 as well as a BamHI restriction site engineered at bp 48,486. Upon ligation with the oligos, the wild-type cosQcosN spacer sequence is regained. For all cosQ point mutations from
bp 48,468 to 48,473,
cosQ mutants were constructed by the generation of top and bottom strand oligonucleotides bearing the given mutations as well as EcoO109I and XbaI sticky ends. Oligos were annealed and ligated into EcoO109I and XbaI (
bp 48,446) digested pBUC8. pBUC8 is a version of pBUC1 with a wild-type
DNA insert from bp 47,712 to 458. cosQ3 (G48,475C) was constructed by oligo-directed mutagenesis.
cosQ G48,475A and
cosQ G48,475T were isolated as plaque-forming revertants of cosQ3. For all cosQ point mutations from bp 48,476 and 48,477 (with the exception of cosQ1),
cosQ mutants were constructed by the generation of top and bottom strand oligonucleotides bearing the given mutations as well as XbaI and AgeI sticky ends. Oligos were annealed and ligated into XbaI and AgeI digested pBUC9. pBUC9 is a version of pBUC8 containing
cosQ T48,481A resulting in an AgeI site at
bp 48,481. Upon ligation, the wild-type cosQ sequence is regained. cosQ1 (C48,477T) was constructed as described by ![]()
For
cosQsub2, a mutagenic primer containing EcoO109I at bp 48,473 and an AflII substitution at bp 48,486 with the sequence 5' ACGGGTCCTTTCCGGCTTAAGGACAGGTTA 3' was constructed and used for PCR across cos using pCF114 as a template. pCF114 is a pIBI31-based vector containing
DNA from bp 47,942 to 650 and contains cos (![]()
cosQsub3, a mutagenic primer containing the above AflII substitution and BstEII substitution at bp 48,494 with the sequence 5' CGGCTTAAGGAGGTAACCCGGGGCGGCGAC 3' was constructed and used for PCR across cos. The fragment was digested with AflII and EcoRI and ligated into AflII and EcoRI digested pDW202 to generate pDW204.
cosQcosN spacing mutants were constructed by the generation of oligonucleotides bearing the given mutations. For additions of +1 to +4, top and bottom strand oligonucleotides were generated bearing the given mutations as well as EcoO109I and AflII sticky ends. Oligos were annealed and ligated into EcoO109I and AflII digested pDW202 to form pDW306 (+1) containing a SmaI site, pDW307 (+2) containing a NcoI site, pDW308 (+3) containing an AvrII site, and pDW309 (+4) containing a PstI site. For spacing mutants +5 and +11, top and bottom strand oligonucleotides were generated bearing the given mutations as well as EcoO109I and AflII sticky ends. Oligos were annealed and ligated into EcoO109I and AflII digested pDW202 to form pDW301 (+5) and pDW302 (+11), which contains a BstEII site. For +15, pDW302 was digested with AflII, the overhangs were filled in with Klenow enzyme, and blunt-end ligated. For +21, top and bottom strand oligonucleotides were generated bearing the given mutations and an SpeI site as well as BstEII sticky ends and annealed. pDW302 was digested with BstEII and the oligo linker was inserted to generate pDW305; +31 was generated through the double insertion of the +21 oligonucleotide in pDW302 to generate pDW304. Plasmids were confirmed by restriction enzyme digestion and DNA sequencing (see Table 3 and Table 4 for sequence information).
|
|
|
|
Introduction of cosQ mutations into the
-genome:
Plasmids bearing
DNA fragments containing the cosQ variants were introduced, by transformation, into MF1427 lysogenic for
-P1
cosQ. Transformed lysogens were selected for by plating at 31° on LA containing kanamycin and ampicillin. The transformed lysogens were grown overnight in LB plus antibiotics at 31°. Overnight cultures were diluted 1:125 into LB and grown to
3 x 107 cells/ml at 31°. Prophages were induced by incubation at 42° for 20 min, followed by incubation at 37° for 60 min. The lysates were treated with CHCl3 and titered on MF1427. For recombinant phage unable to form plaques, kanamycin-resistance (Knr) transducing particles were titered by diluting lysates in 10 mM MgSO4, and diluted lysates were used to infect MF1427 in TB plus 0.2% maltose. The infected cells were incubated at 31° for 60 min and then plated on LA containing kanamycin at 31°. PCR amplification followed by restriction enzyme analysis and DNA sequencing were performed to verify the crosses.
Phage yield determinations:
MF1427 lysogenized with
-P1:5R cI857 nin5 Knr or a derivative were grown overnight with aeration in LB plus kanamycin at 31°. The cultures were diluted into LB (1:125 dilution) and grown to
3 x 107 cells/ml at 31°. Portions of each culture were removed at this time, diluted 1:10,000 in 10 mM MgSO4, and plated on LA plus kanamycin. Plates were incubated overnight at 31° to determine the number of viable lysogens in each culture. Prophages were induced as described above, and lysates were titered on MF1427. Kanamycin-resistance (Knr) transducing particles were titered by diluting lysates in 10 mM MgSO4, and diluted lysates were used to infect MF2049 (MF1427
+) in TB plus 0.2% maltose. The infected cells were incubated at 31° for 60 min and then plated on LA containing kanamycin at 31°.
In vivo cosmid packaging assay:
MF1427 was lysogenized with
-P1
cosQ and then transformed with pIBI31 containing the 5-, 11-, 15-, 21-, and 31-bp additions between cosQ and cosN. The transformed lysogens were grown and lysates were prepared as described for the phage yield determinations. Ampicillin-resistance (Apr) transducing particles were titered by diluting lysates in 10 mM MgSO4, and diluted lysates were used to infect MF2049 (MF1427
+) in TB plus 0.2% maltose. The infected cells were incubated at 31° for 60 min and then plated on LA containing ampicillin at 31°.
| RESULTS |
|---|
Saturation mutagenesis of cosQ:
The 17-bp sequence from
bp 48,468 to 48,484 (Fig 1) is highly conserved in the related lambdoid phages 21,
80, and N15 (![]()
![]()
-21 hybrid phages containing the terminase genes of 21 and the right chromosomal end of
, including cosQ, are viable, suggesting the conserved 17-bp-long sequence contains cosQ (![]()
-chromosome (![]()
![]()
![]()
To define exactly the extent of cosQ, we constructed 48 mutant phages carrying each of the three possible point mutations for all positions in the sequence from bp 48,468 to 48,483. We used
-P1:5R cI857 Knr nin5 as the parent phage;
-P1 carries a kanamycin-resistance gene and has a plasmid prophage state. To determine the effects of the mutations on chromosome packaging, two virus yield assays were performed. For viable mutants, lysogens were induced and the numbers of plaque-forming units were determined. To analyze the virus yield of non-plaque-forming mutants, we titered progeny phage as kanamycin-resistant (Knr) transducing particles. Knr transduction eliminated the constraint that accompanies the plaque assay, which requires that the mutant phage produce enough phage per induced lysogen to form a plaque. Phages carrying mutations in bp 48,46848,472 and bp 48,48048,483 had little effect on the
-virus yield (Table 1). In contrast, mutations in the 7-bp-long sequence extending from 48,473 to 48,479 exhibited a wide range of effects on virus yields of
-P1 (Table 1; Fig 2). The following is a summary of each position of the 7-bp sequence:
- 48,473: G48,473A resulted in a >10-fold decrease in virus yield. G48,473T and G48,473C were unable to form plaques and resulted in a >100-fold decrease in the ability to produce Knr transducing particles.

View larger version (27K):
In this window
In a new window
Download PPT slide
Figure 2. Relative virus yields of cosQ mutational analysis. The virus yields of the 48 cosQ mutations in the region of
from bp 48,468 to 48,483 are shown relative to wild-type levels (1.0). The bold sequence at the bottom of the figure represents the 16 wild-type nucleotides of the initial sequence of cosQ (top strand) that was examined. The 3 nucleotides above represent the 3 mutations that were introduced for each position in the sequence (16 x 3 = 48). The open bars represent the virus yields of the 21 mutations in the newly defined 7-bp region of cosQ as indicated by the varying degrees of reduction in virus yield. Only 1 mutation in this region, T48,479A, has a virus yield near to that of wild type. The solid bars represent the virus yields of the mutations in the initial cosQ region that lie outside this 7-bp region and are relatively unaffected by mutations at those positions. Standard deviations are shown. - 48,474: All mutations resulted in the inability to produce plaques and a >100-fold decrease in the production of Knr transducing particles.
- 48,475: G48,475A and G48,475T reduce the virus yield about 5-fold and 2.5-fold, respectively. G48,475C was unable to form plaques, resulting in a >10-fold decrease in the production of Knr transducing particles.
- 48,476: T48,476A and T48,476C resulted in a >10-fold decrease in virus yield, while T48,476G reduced virus yield
3-fold. - 48,477: C48,477A and C 48,477T reduced the virus yield about 3- and 8-fold, respectively, while C48,477G resulted in a >10-fold decrease.
- 48,478: All mutations resulted in the inability to produce plaques and a >1000-fold decrease in the yield of Knr transducing particles.
- 48,479: T48,479A and T48,479G resulted in the inability to produce plaques and a >10-fold decrease in the yield of Knr transducing particles. Interestingly, of the 21 mutations in this sequence, T48,479C was the only mutation that failed to exhibit a significant reduction in virus yield.
From the data presented, cosQ resides in the 7-bp sequence extending from 48,473 to 48,479. It is interesting to note that this sequence, GGGTCCT, corresponds to the recognition sequence for the restriction enzyme EcoO109I, (G/A)GGNCC(T/C).
Sequence matching of cosQ with cosN half-sites:
Sequence similarity has been observed between cosQ and the two half-sites of cosN, cosNL and cosNR (Fig 3). ![]()
![]()
|
We examined this possibility of an optimum sequence match between cosQ and cosNR to test this aspect of our depolarization model of cosQ. Six mutant phages were analyzed to test this model for the sequence match requirement between cosQ and cosNR. The first three consisted of the cosQ1, cosQ2, and cosQ3 mutations alone. The cosQ1, cosQ2, and cosQ3 mutations resulted in phage yields
13, 9, and 3% of wild type, respectively (Table 1 and Table 2). Thus, the cosQ2 and cosQ3 mutations reduce the phage yield; cosQ2 by itself has a negative effect in the absence of the cosQ1 mutation. Since these mutations individually reduce the match to 2/7, the potential requirement for a 3/7 match between cosQ and cosN remained valid. An absence of a discernible phenotype would have allowed us to conclude that these base pairs are not necessary for proper cosQ function and that a 3/7 match is not necessary.
Three constructs consisting of the various combinations of the three mutations, cosQ1, cosQ2, and cosQ3, were further analyzed (Table 2). The cosQ1 cosQ2 double mutant increased the phage yield
6-fold over the yields of the single mutants, while the cosQ1 cosQ3 and cosQ2 cosQ3 double mutants had phage yields reduced >1000-fold. From these data, we can conclude the following: (1) cosQ2 is not general suppressor of cosQ mutations and (2) the cosQ1 cosQ3 double mutant has the proposed optimal sequence of 3/7. Since this construct has a severe defect, the proposal that a 3/7 match between cosQ and cosNR is required for cosQ function is not supported.
Spacing and sequence requirement between cosQ and cosN:
We examined the 17-bp region between cosQ and cosN to determine whether it was necessary for chromosome packaging. Sequence comparisons between phage
and
80, phage 21, and N15, three related lambdoid phages, identified two stretches of conserved bases, a 4-bp stretch consisting of ATCC and a second region consisting of CXXGTTA (see Fig 4; ![]()
by substitution with ClaI (data not shown) and AflII restriction sites. These substitution alleles, sub1 and sub2, respectively, displayed wild-type phenotypes. We then constructed the sub3 allele, consisting of a BstEII restriction site in the second of these conserved stretches of DNA in addition to the AflII restriction site of the sub2 allele.
cosQsub3 had a mild decrease in virus yield (Table 3). We concluded that nucleotides between cosQ and cosN can be altered without producing serious effects on chromosome packaging.
|
In the looping/hop version of the depolarization model, it was proposed that the region of DNA between cosQ and cosN bends to form a loop in order for cosQ and cosN to be aligned in the same orientation for transfer of the gpA subunit from cosQ to cosN (![]()
cosQ lysogen. The prophages were induced and the efficiency of packaging the plasmids into ampicillin-resistant (Apr) transducing particles was determined. The yields of the spacing mutants were normalized to that of the phage containing the sub2 allele through which the mutants were generated. This served as a positive control. All plasmids containing the alterations of 5 bp or greater were unable to be packaged efficiently (Table 3).
We then constructed more subtle spacing alterations between cosQ and cosN consisting of the addition of 1 bp (
cosQadd1) to 4 bp (
cosQadd4). We performed the kanamycin transduction assay as a measure of packaging efficiency by counting the number of Knr transducing particles produced per infected cell (Table 4). The number of Knr transducing particles per infected cell for the sub2 allele was set at 100%. As the spacing was increased from +1 to +5, the values were 101, 62, 19, 1, and <0.001%, respectively. In addition, a plaque-forming unit assay was also performed for the plaque-forming spacing mutants, and the virus yields relative to the sub2 allele were in close agreement with the Knr transduction results (data not shown). These results indicate that as the distance between cosQ and cosN is increased, the severity of the packaging defect also increases. Proper spacing between cosQ and cosN is required.
| DISCUSSION |
|---|
Genetic structure of cosQ:
To accurately define cosQ, we constructed 48 mutant phages carrying each of the three point mutations for all positions in the sequence from bp 48,468 to 48,483. It became evident after examining the effects the various mutations had on virus yields that a 7-bp region from bp 48,473 to 48,479 was required for cosQ function. All mutations flanking cosQ, i.e., from bp 48,468 to 48,472 and from bp 48,480 to 48,483, had little or no effect on phage production (Table 1; Fig 2). In contrast, mutations in the 7-bp region from bp 48,473 to 48,479 resulted in a wide range of effects on phage production. Of the 21 mutations in this region, only one mutation, T48,478C, had a burst size near that of wild-type
-P1. Only five other mutations resulted in virus yields of >10% of wild type: G48,475A (30%), G48,475T (56%), T48,476G (35%), C48,477A (32%), and C48,477T (13%). All other mutations in this region resulted in a >10-fold decrease in phage yield.
The 7-bp cosQ segment is quite small. ![]()
-development in cells with integration host factor (IHF), have strong phenotypic effects in cells lacking IHF (![]()
The 7-bp cosQ segment is coincident with a recognition site for the EcoO109I restriction-modification system. EcoO109I is a type II restriction endonuclease isolated from E. coli with the heptanucleotide recognition sequence 5'-PuG
GNCCPy-3' (![]()
-like phages cannot easily mutate to inactivate the EcoO109I target site, so E. coli strains that have the EcoO109I system have a defense against many
-like phages that is not easily circumvented. We have recently found that methylation of cosQ by the EcoO109I methylase mildly interferes with growth of
cos+ and severely interferes with the growth of phages bearing mild cosQ mutations that retain the EcoO109I recognition site (D. WIECZOREK and M. FEISS, unpublished observations).
We also examined the 17-bp region between cosQ and cosN to determine whether it was necessary for chromosome packaging. Sequence comparisons between phages
, 21,
80, and N15 identified two stretches of conserved bases, a 4-bp stretch consisting of ATCC and a second region consisting of CXXGTTA (see Fig 4). Altering the first of these stretches in
by substituting ClaI and AflII restriction sites resulted in a wild-type phenotype. The resulting wild-type levels of phage production further indicate that sequence outside of the newly defined 7-bp region is not essential for proper cosQ function. A third allele composed of a BstEII restriction site in the second of these conserved stretches of DNA in addition to the AflII restriction site resulted in a mild decrease in the burst size. This additional substitution alters the 7-bp immediately adjacent to cosN. This mild reduction in virus yield may be an effect of an alteration of cosN and have no bearing on the role of the cosQ site. ![]()
![]()
Depolarization model:
Sequence similarities between cosQ and the R boxes of cosB as well as the half-sites of cosN have been observed, raising the possibility that cosQ is recognized by either gpNu1 or gpA, the small and large subunits of terminase. Molecular and genetic evidence against a role for gpNu1 in the recognition of cosQ has previously been presented. ![]()
![]()
dependent on IHF for plaque formation, while the presence of IHF was not able to suppress the defect in the R4 sequence. ![]()
A role for gpA in the recognition of cosQ remains a possibility. ![]()
![]()
![]()
|
Three constructs consisting of combinations of the cosQ1, cosQ2, and cosQ3 mutations were analyzed to determine whether an optimum 3/7-bp match between cosQ and cosNR was necessary for efficient DNA packaging. While the cosQ1 cosQ2 double mutant, with a 3/7 match, was healthy, the cosQ2 cosQ3 double mutant (1/7 match) and cosQ1 cosQ3 double mutant (3/7 match) reduced the phage yield >1000-fold. The cosQ1 cosQ3 double mutant restored the sequence match between cosQ and cosNR to the proposed optimal match of 3/7. Since this construct results in inefficient chromosome packaging, we can conclude that a 3/7 match between cosQ and cosNR is not sufficient for cosQ function, and this evidence fails to lend support to this version of the depolarization model of cosQ.
An alternative explanation for the behavior of the cosQ1cosQ2 double mutant is that one of the mutations simply increases gpA's binding affinity to cosQ so that transfer of gpA to cosNR does not take place, while the second mutation decreases gpA's binding affinity. Thus, a combination of the two would cancel each other out. In this view, cosQ3 might either increase or decrease gpA's binding affinity to cosQ and therefore be able to suppress the defect of either the cosQ1 or cosQ2 mutation, resulting in a healthy phage. The fact that both the cosQ1cosQ3 and cosQ2cosQ3 double mutants are unhealthy argues against such a simple scenario. We note that the virus yields for
cosQ1,
cosQ2, and
cosQ3 are similar (Table 2).
![]()
![]()
![]()
![]()
These observations fail to support aspects of our looping/hop version of the depolarization model as presented by ![]()
![]()
Recognition of cosQ:
Our ultimate goals in this study of cosQ are to identify the factor that binds or recognizes this site and to determine how cosQ recognition contributes to packaging termination. We are confident that the factor we are seeking is involved in the translocation complex; candidates include gpNu1, gpA, and the portal protein gpB. BLAST searches involving the EcoO109I restriction endonuclease, the EcoO109I methylase, and the known
-proteins involved in the translocation complex, gpNu1, gpA, and gpB, have shown no significant homology regarding potential protein-cosQ DNA recognition motifs. We cannot rule out the possibility that a host protein may in fact be involved in the recognition of the cosQ site. Because most in vitro packaging studies to date (![]()
It has been reported that the product of gp49 (endonuclease VII) of bacteriophage T4 is a Holliday-structure resolvase (X-solvase) responsible for clearing branched replicative DNA prior to packaging (![]()
![]()
![]()
![]()
![]()
, suppressors of cosQ mutations have been localized to the portal protein, gpB, indicating the packaging complex involves terminase, the portal vertex, cos-containing DNA, and potentially other factors necessary for the termination of DNA packaging (![]()
, and it is not clear that
DNA needs to be debranched prior to packaging. Whether a host enzyme fulfills a similar or alternate role of gp49 for phage
in E. coli remains to be seen. Pseudorevertant analysis is underway in hopes of identifying allele-specific trans-acting suppressors of our cosQ mutations.
| ACKNOWLEDGMENTS |
|---|
We thank our co-workers, Carol Duffy, Qi Hang, Jenny Meyer, and Jean Sippy for advice and interest during the course of this work. This work was supported by National Institutes of Health (NIH) Research Grant GM-51611 and NIH Genetics Research Training Grant T32GM08629 (D.W.).
Manuscript received January 29, 2001; Accepted for publication March 16, 2001.
| LITERATURE CITED |
|---|
ARBER, W., L. ENQUIST, B. HOHN, N. E. MURRAY and K. MURRAY, 1983 Experimental methods for use with lambda, pp. 433466 in Lambda II, edited by R. W. HENDRIX, J. W. ROBERTS, F. W. STAHL and R. A. WEISBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BEAR, S., D. COURT, and D. I. FRIEDMAN, 1983 An accessory role for integration host factor: characterization of a lambda mutant dependent upon integration host factor for DNA packaging. J. Virol. 52:966-972.
BECKER, A. and H. MURIALDO, 1990 Bacteriophage
DNA: the beginning of the end. J. Bacteriol. 172:2819-2824
BECKER, A., M. MARKO, and M. GOLD, 1977 Early events in the in vitro packaging of bacteriophage
DNA. Virology 78:291-305[Medline].
CATALANO, C. E., D. CUE, and M. FEISS, 1995 Virus DNA packaging: the strategy used by phage
. Mol. Microbiol. 16:1075-1086[Medline].
CUE, D. and M. FEISS, 1992 Genetic analysis of cosB, the binding site for terminase, the DNA packaging enzyme of bacteriophage
. J. Mol. Biol. 228:58-71[Medline].
CUE, D. and M. FEISS, 1993 A site required for the termination of packaging of the phage
chromosome. Proc. Natl. Acad. Sci. USA 90:9290-9294
CUE, D. and M. FEISS, 1997 Genetic evidence that recognition of cosQ, the signal for termination of phage
DNA packaging, depends on the extent of head filling. Genetics 147:7-17[Abstract].
CUE, D. and M. FEISS, 1998 Termination of packaging of the bacteriophage
chromosome: cosQ is required for nicking the bottom strand of cosN.. J. Mol. Biol. 280:11-29[Medline].
DANIELS, D., J. SCHROEDER, W. SZYBALSKI, F. SANGER, A. COULSEN et al., 1983 Completed annotated lambda sequence, pp. 519676 in Lambda II, edited by R. W. HENDRIX, J. W. ROBERTS, F. W. STAHL and R. A. WEISBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
DAVIDSON, A. and M. GOLD, 1987 A novel in vitro DNA packaging system demonstrating a direct role for the bacteriophage
FI gene product. Virology 161:305-315[Medline].
DAVIDSON, A. and M. GOLD, 1992 Mutations abolishing the endonuclease activity of bacteriophage
terminase lie in two distinct regions of the A gene, one of which may encode a "leucine zipper" DNA binding domain. Virology 189:21-30[Medline].
EMMONS, S. W., 1974 Bacteriophage lambda derivatives carrying two copies of the cohesive end site. J. Mol. Biol. 83:511-525[Medline].
FEISS, M., 1986 Terminase and the recognition, cutting, and packaging of
chromosomes. Trends Genet. 2:100-104.
FEISS, M., and A. BECKER, 1983 DNA packaging and cutting, pp. 305330 in Lambda II, edited by R. W. HENDRIX, J. W. ROBERTS, F. W. STAHL and R. A. WEISBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
FEISS, M., W. WIDNER, G. MILLER, G. JOHNSON, and S. CHRISTIANSEN, 1983 Structure of the bacteriophage lambda cohesive end site: location of the sites of terminase binding (cosB) and nicking (cosN). Gene 24:207-218[Medline].
FEISS, M., J. SIPPY, and G. MILLER, 1985 Processive action of terminase during sequential packaging of bacteriophage
chromosomes. J. Mol. Biol. 186:759-771[Medline].
FRACKMAN, S., D. A. SIEGELE, and M. FEISS, 1984 A functional domain of bacteriophage
terminase for prohead binding. J. Mol. Biol. 180:283-300[Medline].
FRANKEL, F. R., M. L. BATCHELER, and C. K. CLARK, 1971 The role of gene 49 in DNA replication and head morphogenesis in bacteriophage T4. J. Mol. Biol. 62:439-463[Medline].
FURTH, M. E., and S. H. WICKNER, 1983 Lambda DNA replication, pp. 145173 in Lambda II, edited by R. W. HENDRIX, J. W. ROBERTS, F. W. STAHL and R. A. WEISBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
GOLZ, S. and B. KEMPER, 1999 Association of Holliday-structure resolving endonuclease VII with gp20 from the packaging machine of T4. J. Mol. Biol. 285:1131-1144[Medline].
HANAHAN, D., 1983 Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline].
HIGGINS, R. R. and A. BECKER, 1994 The
terminase enzyme measures the point of its endonucleolytic attack 47 ± 2 bp away from its site of specific DNA binding, the R site. EMBO J. 13:6162-6171[Medline].
HIGGINS, R. R. and A. BECKER, 1995 Interaction of terminase, the DNA packaging enzyme of phage
, with its cos DNA substrate. J. Mol. Biol. 252:31-46[Medline].
HIGGINS, R. R., H. J. LUCKO, and A. BECKER, 1988 Mechanisms of cos DNA cleavage by bacteriophage
terminase: multiple roles of ATP. Cell 54:765-775[Medline].
HOHN, B., 1983 DNA sequences necessary for packaging of bacteriophage
DNA. Proc. Natl. Acad. Sci. USA 80:7456-7460
HWANG, Y. and M. FEISS, 1995 A defined system for in vitro
DNA packaging. Virology 211:367-376[Medline].
HWANG, Y. and M. FEISS, 1996 Mutations affecting the high affinity ATPase center of gpA, the large subunit of bacteriophage
terminase, inactivate the endonuclease activity of terminase. J. Mol. Biol. 261:524-535[Medline].
LUFTIG, R. B., W. B. WOOD, and R. OKINARA, 1971 On the nature of gene 49-defective heads and their role as intermediates. J. Mol. Biol. 57:555-573[Medline].
MILLER, G. and M. FEISS, 1988 The bacteriophage
cohesive end site: isolation of spacing/substitution mutations that result in dependence on Escherichia coli integration host factor. Mol. Gen. Genet. 212:157-165[Medline].
MISE, K. and K. NAKAJIMA, 1985 Restriction endonuclease EcoO109I from Escherichia coli H709c with heptanucleotide recognition site 5'-PuG
GNCCPy. Gene 36:363-367[Medline].
MIWA, T. and K. MATSUBARA, 1983 Lambda phage DNA sequences affecting the packaging process. Gene 24:199-206[Medline].
MIZUUCHI, K., B. KEMPER, J. HAYS, and R. A. WEISBERG, 1982 T4 endonuclease VII cleaves Holliday structures. Cell 29:357-365[Medline].
PAL, S. K. and D. K. CHATTORAJ, 1988 P1 plasmid replication: initiator sequestration is inadequate to explain control by initiator-binding sites. J. Bacteriol. 172:2819-2824.
RAVIN, V., N. RAVIN, S. CASJENS, M. E. FORD, and G. F. HATFULL et al., 2000 Genomic sequence and analysis of the atypical temperate bacteriophage N15. J. Mol. Biol. 299:53-73[Medline].
RUBINCHIK, S., W. PARRIS, and M. GOLD, 1994a The in vitro endonuclease activity of gene product A, the large subunit of the bacteriophage
terminase, and its relationship to the endonuclease activity of the holoenzyme. J. Biol. Chem. 269:13575-13585
RUBINCHIK, S., W. PARRIS, and M. GOLD, 1994b The in vitro ATPases of bacteriophage
terminase and its large subunit, gene product A. J. Biol. Chem. 269:13586-13593
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning; A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SANGER, F., A. R. COULSON, G. F. HONG, D. F. HILL, and G. B. PETERSEN, 1982 Nucleotide sequence of bacteriophage lambda DNA. J. Mol. Biol. 162:729-773[Medline].
SHINDER, G. and M. GOLD, 1988 The Nu1 subunit of bacteriophage lambda binds to specific sites in cos DNA. J. Virol. 62:387-392
SIPPY, J. and M. FEISS, 1992 Analysis of a mutation affecting the specificity domain for prohead binding of the bacteriophage
terminase. J. Bacteriol. 174:850-856
SIPPY ARENS, J., Q. HANG, Y. HWANG, B. TUMA, and S. MAX et al., 1999 Mutations that extend the specificity of the endonuclease activity of
terminase. J. Bacteriol. 181:218-224
SIX, E. and C. A. C. KLUG, 1973 Bacteriophage P4: a satellite virus depending on a helper such as prophage P2. Virology 51:327-344[Medline].
SMITH, M. P. and M. FEISS, 1993 Sites and gene products involved in lambdoid phage DNA packaging. J. Bacteriol. 175:2393-2399
STERNBERG, N. and S. AUSTIN, 1983 Isolation and characterization of P1 minireplicons, l-P1:5R and l-P1:5L. J. Bacteriol. 153:800-812
WU, W. F., S. CHRISTIANSEN, and M. FEISS, 1988 Domains for protein-protein interactions at the N- and C-termini of the large subunit of bacteriophage
terminase. Genetics 119:477-484
XU, S. and M. FEISS, 1991a Structure of the bacteriophage
cohesive end site: Genetic analysis of the site (cosN) at which nicks are introduced by terminase. J. Mol. Biol. 220:281-292[Medline].
XU, S. and M. FEISS, 1991b The last duplex base-pair of the phage
chromosome: Involvement in packaging, ejection, and routing of
DNA. J. Mol. Biol. 220:293-306[Medline].
YEO, A. and M. FEISS, 1995a Mutational analysis of the prohead binding domain of the large subunit of terminase, the bacteriophage
DNA packaging enzyme. J. Mol. Biol. 245:126-140[Medline].
YEO, A. and M. FEISS, 1995b Specific interaction of terminase, the DNA packaging enzyme of bacteriophage
, with the portal protein of the prohead. J. Mol. Biol. 245:141-150[Medline].
YEO, A., L. KOSTURKO, and M. FEISS, 1990 Structure of the bacteriophage
cohesive end site: bent DNA on both sides of the site, cosN, at which terminase introduces nicks during chromosome maturation. Virology 174:329-334[Medline].
This article has been cited by other articles:
![]() |
J. E. Cronan Cosmid-Based System for Transient Expression and Absolute Off-to-On Transcriptional Control of Escherichia coli Genes J. Bacteriol., November 15, 2003; 185(22): 6522 - 6529. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Wieczorek and M. Feiss Genetics of cosQ, the DNA-Packaging Termination Site of Phage {lambda}: Local Suppressors and Methylation Effects Genetics, September 1, 2003; 165(1): 11 - 21. [Abstract] |





