- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Marsh, T. C.
- Articles by Romero, D. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Marsh, T. C.
- Articles by Romero, D. P.
The Transition From Conjugal Development to the First Vegetative Cell Division Is Dependent on RAD51 Expression in the Ciliate Tetrahymena thermophila
Thomas C. Marsh1,a, Eric S. Coleb, and Daniel P. Romeroaa Department of Pharmacology, Medical School, University of Minnesota, Minneapolis, Minnesota 55455
b Department of Biology, St. Olaf College, Northfield, Minnesota 55057
Corresponding author: Daniel P. Romero, Department of Pharmacology, Medical School, University of Minnesota, 6-120 Jackson Hall, 321 Church St. S.E., Minneapolis, MN 55455., romero{at}lenti.med.umn.edu (E-mail)
Communicating editor: S. L. ALLEN
| ABSTRACT |
|---|
Rad51p, the eukaryotic homolog of the prokaryotic recA protein, catalyzes strand exchange between single- and double-stranded DNA and is involved in both genetic recombination and double-strand break repair in the ciliate Tetrahymena thermophila. We have previously shown that disruption of the Tetrahymena RAD51 somatic macronuclear locus leads to defective germline micronuclear division and that conjugation of two somatic rad51 null strains results in an early meiotic arrest. We have constructed Tetrahymena strains that are capable of RAD51 expression from their parental macronuclei and are homozygous, rad51 nulls in their germline micronuclei. These rad51 null heterokaryons complete all of the early and middle stages of conjugation, including meiosis, haploid nuclear exchange, zygotic fusion, and the programmed chromosome fragmentations, sequence eliminations, and rDNA amplification that occur during macronuclear development. However, the rad51 null progeny fail to initiate the first vegetative cell division following conjugal development. Coincident with the developmental arrest is a disproportionate amplification of rDNA, despite the maintenance of normal total DNA content in the developing macronuclei. Fusion of arrested rad51 null exconjugants to wild-type cells is sufficient to overcome the arrest. Cells rescued by cytoplasmic fusion continue to divide, eventually recapitulating the micronuclear mitotic defects described previously for rad51 somatic nulls.
CILIATED protozoans such as Tetrahymena thermophila possess two structurally distinct nuclei that effectively divide the labor of germline and somatic genetic functions (reviewed in ![]()
The macronucleus is derived from a copy of the zygotic micronucleus through a series of highly controlled developmental processes that occur during sexual reproduction or conjugation (reviewed in ![]()
![]()
![]()
![]()
![]()
15% of the MIC genome complexity to produce a mature MAC genome (![]()
![]()
![]()
The highly conserved Rad51p catalyzes strand exchange between single- and double-stranded DNA during both genetic recombination and double-strand break repair (reviewed in ![]()
![]()
![]()
![]()
Unfortunately, the early conjugal block exhibited by rad51 somatic null cells precludes an evaluation of a rad51 null background on late events during conjugal development (![]()
| MATERIALS AND METHODS |
|---|
General methods:
T. thermophila cultures were grown in 12% PPYS (proteose peptone, yeast extract, and sequestrene), as described in ![]()
![]()
![]()
![]()
|
PCR primers and products:
PCR products were radiolabeled by the incorporation of [
-32P]dATP (specific activity 3000 Ci/mmol) as described (![]()
![]()
![]()
![]()
- P1(+) GACGAATTCGGTATTGC
- P1(-) TCACTCGTTGAAGTC
- P2(+) TCGGTCAGCTAAACCAAC
- P2(-) ATGCGGGTGAGTGCAGAA
- P3(+) AAATTTAACGCGGAAGCTTC
- P3(-) GTTATTTATTGATGTAATAC
RAD51 micronuclear gene replacement:
T. thermophila strains CU248.2 and A*III (Table 1) were grown in 200-ml cultures to a density of 1.0 x 105 cells/ml and starved in 200 ml of 10 mM Tris HCl (pH 7.5) for 18 hr prior to mixing. Pairing efficiency (>90%) was monitored 3 hr after mixing equal numbers of cells, and the mated cells were centrifuged 0.51.5 hr later, washed once in 10 mM HEPES (pH 7.5), and suspended in 2 ml 10 mM HEPES (pH 7.5) at
1 x 107 cells/ml. The concentrated cell suspension was transferred to filter paper in a 100-mm diameter petri dish and placed in the Bio-Rad (Hercules, CA) gene gun chamber. Au particles (0.6 µm in diameter), coated with
1.0 µg of pTtRd51KO (![]()
![]()
![]()
Strains homozygous for the rad51 null allele in their micronuclei (TC105 and TC106; Table 1) were generated by mating the RAD51/rad51-1::neo heterozygote TC104 with strain A*III in a single round I genomic exclusion. Mated pairs and synclones were isolated and subsequently expanded as clonal lines for further genetic analysis. The progeny of an outcross to strain CU428.2 were monitored for pm-r to identify those parental synclones that were homozygous rad51 nulls. Southern blot analysis of the progeny confirmed that the parental strains TC105 and TC106 were homozygous for the rad51-1::neo allele.
Electrofusion:
Cytoplasmic fusion was as described by ![]()
1.0 x 105 cells/ml in 1% PPYS, and selected for growing cells in 100 µg/ml pm.
Nuclear staining and visualization:
Prior to staining with 4', 6-diamidino-2-phenylindole (DAPI), cells were fixed by three sequential washes of 50% MeOH, 70% MeOH, and MeOH:HOAc (70%:15%) and air dried on microscope slides at 37°. Fixed cells were stained with DAPI (0.1 µg/ml), followed by a wash in 95% EtOH. Samples were examined with an Olympus B-Max fluorescence microscope at x320 magnification using a x40 oil-immersion objective lens, a 1.6 optivar setting, and a x5 ocular lens. Micrographs were recorded digitally using a SPOT camera and imaging software.
Feulgen staining:
Mating pairs or exconjugant cultures (1 ml) were gently centrifuged in an IEC CL centrifuge (1000 rpm, 2 min). The supernatant was discarded, and the pellet washed in 50% methanol, 70% methanol, and 70% methanol/10% glacial acetic acid. Cell pellets were suspended in 150 µl of 70% methanol/10% glacial acetic acid and dropped onto clean microscope slides alongside drops of wild-type mating cells (CU428.2 x CU438.1), harvested, and fixed 2 hr after conjugation was initiated. The micronuclei of wild-type pairs provided a reliable diploid (2N4C) standard to quantify the macronuclear DNA content of exconjugants by cytophotometry (![]()
Samples were fixed for 5 min in Carnoy's solution (EtOH:glacial acetic acid, 3:1), rinsed in dH2O, and transferred to 5 M HCl for precisely 20 min to complete hydrolysis. Slides were rinsed and transferred to Schiff's reagent for 2 hr at 25°. After a rinse in dH2O, slides were treated for 10 min in dH2O:1 M HCl:10% K2S2O5 (18:1:1), rinsed twice in dH2O, and dehydrated through a series of 25 min washes in EtOH (35, 50, 70, 95, 100, and 100%). Air-dried slides were mounted in Euparal with coverslips.
Cytophotometry:
A Zeiss (Thornwood, NY) Axiskop microscope with a x63 oil immersion objective, a set of motorized filter changers, and a Zeiss MSP-21 photometer were used to measure the relative macronuclear DNA content of exconjugants. A dual wavelength cytophotometry protocol was used to mathematically transform light absorbance values of Feulgen-stained nuclei at two optimal wavelengths (480 and 560 nm), making it possible to determine the relative amount of Feulgen-stained material present in each nucleus (![]()
Biotinylated rDNA probe:
Approximately 2 µg of the Tetrahymena rDNA vector pD5H8 (![]()
![]()
Fluorescence in situ hybridization:
Biotinylated rDNA probe hybridization to fixed Tetrahymena cells was adapted from a procedure developed by ![]()
50 ng biotinylated rDNA probe at 37° overnight. Specific hybridization of the probe was achieved by successive 0.5-ml washes of 40% formamide, 2x SSC (37°, 10 min), 2x SSC (25°, 10 min), and 1x SSC (25°, 10 min).
To detect the biotinylated rDNA probe in situ, the fixed and probed cells were incubated in a 100-µl solution with 2 µg FITC conjugated to avidin (Vector Labs, Burlingame, CA) for 30 min at 25° [0.5 M NaCl, 0.1 M Na2CO3 (pH 8.2)]. Background binding of the fluorescent tag to the fixed cells was reduced by three sequential washes (10 min at 25°) with 4x SSC; 4x SSC, 0.2% Triton-X-100; and 4x SSC. One drop of VectaShield w/DAPI (Vector Labs) was added to the cell pellet prior to placing 20 µl of the suspension on microscope slides. Cells were scanned under a Bio-Rad MRC1000/1024 laser confocal microscope (UMN Imaging Center, Dr. Mark Sanders, director).
| RESULTS |
|---|
Construction of micronuclear rad51 homozygous null strains:
The T. thermophila RAD51 micronuclear locus was targeted for disruption with a selectable marker (pm-r) that has been described previously for disruption of the RAD51 macronuclear locus (![]()
![]()
Since progeny from a star mating, such as that described above, retain their parental macronuclei (![]()
![]()
![]()
![]()
A developmental arrest phenotype for whole genome rad51 null exconjugants:
TC105 and TC106 were starved and mixed to initiate conjugation, and their progression through the various conjugal stages was monitored cytologically (![]()
![]()
![]()
|
Coincident with the increase in cell mass was an apparent increase in the macronuclear anlage volume for rad51 null exconjugants (Fig 1). Normal conjugants rapidly increase the DNA content of the anlage, increasing from 2C at the first postzygotic nuclear division to 16C at the time of conjugant separation, ultimately reaching a maximum of 128C in immature cells upon completion of their second vegetative cell cycle (![]()
Although the volume of the average rad51 null exconjugant macronucleus was greater than that of similarly immature wild-type cells a few days after pair separation (Fig 1), their DNA content rarely exceeded the normal 128C maximum (Fig 2). Both wild-type and mutant exconjugants replicate their macronuclear DNA at the same rate until shortly after pair separation, when DNA levels are
16C for the developing anlage. Beyond this stage, macronuclear DNA accumulation is abnormally slow in the rad51 null cells, lagging 2448 hr behind wild-type exconjugants before achieving 128C. By the time rad51 null exconjugants have achieved a macronuclear DNA content of 128C, matching their wild-type counterparts, wild-type exconjugants have passed through at least one exconjugant cell division and have entered subsequent rounds of exconjugant mitosis (![]()
|
Cytosolic "rescue" of rad51 nulls by electrofusion:
It was conceivable that the inability of rad51 null exconjugants to initiate the first vegetative division is due to an irreversible block in the cell cycle, comparable to a check-point arrest. To directly address this question, we performed the following "cytosolic rescue" experiment. Wild-type pm-s CU428.2 cells were electrofused (![]()
![]()
|
Molecular analysis of rad51 null exconjugants:
Despite an abnormally large cell size that arises as a consequence of fission block, rad51 null exconjugants retain the ability to monitor and regulate their macronuclear DNA content, rarely exceeding the G2 maximum of 128C observed for wild-type cells (Fig 2). The developmental arrest coincides precisely with the period of anlagen development, when numerous genome rearrangements occur to give rise to the macronuclear genome. To more completely characterize rad51 null exconjugants in this developmental arrest, total DNA was isolated from whole cells over a period of 7 days following conjugation and digested with restriction enzymes prior to Southern blot analysis. Somewhat surprisingly, a prominent restriction fragment pattern with an intensity that increased over time was evident in stained agarose gels (Fig 4). The pattern varied as a function of the restriction enzyme used, and the fragment sizes were indicative of the mature rDNA palindrome. Although the rDNA palindrome is normally amplified during exconjugant development (![]()
|
Localization of rDNA in rad51 nulls:
Fluorescence in situ hybridization (FISH) has been used to localize Tetrahymena rDNA to the periphery of the macronuclear membrane in a punctate, nucleolar staining pattern (![]()
![]()
|
| DISCUSSION |
|---|
RAD51 and the cell cycle:
The macronuclear anlagen differ from macronuclei at any other stage of the Tetrahymena life cycle. In addition to palindromic rDNA amplification, which is specifically limited to this developmental period (![]()
32C just prior to cytokinesis (![]()
![]()
|
We have shown previously that somatic rad51 null cells eventually become severely aneuploid over the course of multiple cell divisions, a phenomenon attributed to an anaphase delay during micronuclear mitosis (![]()
In contrast, micronuclear mitosis fails to initiate in rad51 null exconjugants, preventing as-yet-undetermined downstream events that normally lead to the first vegetative division from occurring. It is not clear whether the absence of RAD51 in null exconjugants is directly or indirectly responsible for the first vegetative division cell cycle arrest. A RAD51 homolog from human tissues (hsREC2) has been implicated in cell cycle control via the phosphorylation of cyclinE/cdk2 (![]()
![]()
![]()
It is also conceivable that RAD51's involvement in the first cell cycle may be indirect, perhaps by ensuring the proper processing of another macronuclear locus whose function is to initiate the first cell cycle. Expression of such unknown factor(s) is not limited to the period of exconjugant development, because electrofusion of vegetatively dividing wild-type cells to the arrested exconjugants is sufficient to prompt their division.
Although other factors may be involved, a likely candidate for mediating the cytoplasmic rescue is Rad51p itself. An experiment where somatic rad51 null cells (TC102 or TC103; ![]()
What is normally a narrow window for rDNA amplification (![]()
It is only after electrofusion of rad51 null exconjugants to wild-type cells, followed by multiple cell fissions over a period of days, that the ratio of rDNA to non-rDNA in the macronucleus approaches that of normal cells (Fig 4). This is consistent with a mechanism of rDNA copy number regulation (relative to that of the overall macronuclear DNA content) that is activated only after the first vegetative cell division.
RAD51 and rDNA palindrome formation:
The programmed genomic remodeling that occurs during development of a new macronucleus from a copy of the zygotic micronucleus in Tetrahymena is as yet poorly understood (![]()
![]()
![]()
![]()
Despite the successful maturation of rDNA palindromes in rad51 null exconjugants (Fig 4), a role for RAD51 in the initial palindrome formation from a monomeric intermediate cannot be entirely ruled out. Northern blot analysis of RNA extracted from synchronously mated Tetrahymena reveals a continuum of RAD51 expression throughout conjugation, with two maxima occurring at prezygotic and exconjugant development (![]()
![]()
A germline rDNA cis mutation that delays rDNA palindrome formation until the later stages of exconjugant development has been identified (![]()
![]()
To address the question of RAD51 involvement in rDNA palindrome formation, we are currently constructing Tetrahymena heterokaryons that are homozygous for both rad51-1::neo and rmm11. We anticipate that during conjugation of two strains with this genotype, maturation of the rmm11 rDNA palindrome will be delayed until gene expression is entirely dependent on the developing macronuclei, which will be incapable of wild-type RAD51 expression. The cell cycle arrest at the first vegetative division (Fig 1) and continued rDNA amplification in rad51 null exconjugants (Fig 4 and Fig 5) will facilitate the detection of de novo rDNA molecules in the progeny from this cross. The absence of rDNA palindromes in the developing anlage would strongly suggest a role for RAD51 in palindrome formation. Conversely, detection of rDNA palindromes in exconjugants would support the conclusion that rDNA maturation is independent of RAD51.
| FOOTNOTES |
|---|
1 Present address: Department of Chemistry, University of St. Thomas, St. Paul, MN 55105. ![]()
| ACKNOWLEDGMENTS |
|---|
This work was supported by research grants to D.P.R. from the National Institutes of Health (GM-50861), the Minnesota Medical Foundation (CRF-185-98), and the University of Minnesota Graduate School. Support was also provided to E.S.C. by the National Science Foundation (MCB 9807555).
Manuscript received November 3, 2000; Accepted for publication January 2, 2001.
| LITERATURE CITED |
|---|
BIANCO, P. R., R. B. TRACY, and S. C. KOWALCZYKOWSKI, 1998 DNA strand exchange proteins: a biochemical and physical comparison. Frontiers Biosci. 17:D570-603.
BRUNS, P. J. and D. CASSIDY-HANLEY, 2000 Methods for genetic analysis. Methods Cell Biol. 62:229-240[Medline].
BUTLER, D. K., L. E. YASUDA, and M. C. YAO, 1995 An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila. Mol. Cell. Biol. 15:7117-7126[Abstract].
BUTLER, D. K., L. E. YASUDA, and M. C. YAO, 1996 Induction of large DNA palindrome formation in yeastimplications for gene amplification and genome stability in eukaryotes. Cell 87:1115-1122[Medline].
CAMPBELL, C. and D. P. ROMERO, 1998 Identification and characterization of the RAD51 gene from the ciliate Tetrahymena thermophila. Nucleic Acids Res. 26:3165-3172
CASSIDY-HANLEY, D., J. BOWEN, J. H. LEE, E. COLE, and L. A. VERPLANK et al., 1997 Germline and somatic transformation of mating Tetrahymena thermophila by particle bombardment. Genetics 146:135-147[Abstract].
COLE, E. S. and T. A. SOELTER, 1997 A mutational analysis of conjugation in Tetrahymena thermophila. 2. Phenotypes affecting middle and late developmentthird prezygotic nuclear division, pronuclear exchange, pronuclear fusion, and postzygotic development. Dev. Biol. 189:233-245[Medline].
COLE, E. S., D. CASSIDY-HANLEY, J. HEMISH, J. TUAN, and P. J. BRUNS, 1997 A mutational analysis of conjugation in Tetrahymena thermophila. 1. Phenotypes affecting early developmentmeiosis to nuclear selection. Dev. Biol. 189:215-232[Medline].
COYNE, R. S., D. L. CHALKER, and M. C. YAO, 1996 Genome downsizing during ciliate developmentnuclear division of labor through chromosome restructuring. Annu. Rev. Genet. 30:557-578[Medline].
DEAK, J. C. and F. P. DOERDER, 1998 High frequency intragenic recombination during macronuclear development in Tetrahymena thermophila restores the wild-type serh1 gene. Genetics 148:1109-1115
DOERDER, F. P. and L. E. DE BAULT, 1975 Cytofluorometric analysis of nuclear DNA during meiosis, fertilization and macronuclear development in the ciliate Tetrahymena pyriformis, syngen 1. J. Cell Sci. 17:471-493[Abstract].
DOERDER, F. P. and S. K. SHABATURA, 1980 Genomic exclusion in Tetrahymena thermophila: a cytogenetic and cytofluorometric study. Dev. Genet. 1:205-218.
GAERTIG, J. and E. S. COLE, 2000 The role of cortical geometry in nuclear development of Tetrahymena thermophila. J. Eukaryot. Microbiol. 47:590-596[Medline].
GAERTIG, J., T. H. THATCHER, K. E. MCGRATH, R. C. CALLAHAN, and M. A. GOROVSKY, 1993 Perspectives on tubulin isotype function and evolution based on the observation that Tetrahymena thermophila microtubules contain a single
- and ß-tubulin. Cell Motil. Cytoskeleton 25:243-253[Medline].
HAMILTON, E. P. and E. ORIAS, 2000 Genetic crosses: setting up crosses, testing progeny, and isolating phenotypic assortants. Methods Cell Biol. 62:219-228[Medline].
HAVRE, P. A., M. C. RICE, M. NOE, and E. B. KMIEC, 1998 The human REC2/RAD51B gene acts as a DNA damage sensor by inducing G1 delay and hypersensitivity to ultraviolet irradiation. Cancer Res. 58:4733-4739
HAVRE, P. A., M. RICE, R. RAMOS, and E. B. KMIEC, 2000 HsRec2/Rad51L1, a protein influencing cell cycle progression, has protein kinase activity. Exp. Cell Res. 254:33-44[Medline].
KAPLER, G. M., 1993 Developmentally regulated processing and replication of the Tetrahymena rDNA minichromosome. Curr. Opin. Genet. Dev. 3:730-735[Medline].
KAPLER, G. M. and E. H. BLACKBURN, 1994 A weak germ-line excision mutation blocks developmentally controlled amplification of the rDNA minichromosome of Tetrahymena thermophila. Genes Dev. 8:84-95
KAPLER, G. M., E. ORIAS, and E. H. BLACKBURN, 1994 Tetrahymena thermophila mutants defective in the developmentally programmed maturation and maintenance of the rDNA minichromosome. Genetics 137:455-466[Abstract].
KARRER, K. M., 2000 Tetrahymena genetics: two nuclei are better than one. Methods Cell Biol. 62:127-186[Medline].
MARSH, T. C., E. S. COLE, K. R. STUART, C. CAMPBELL, and D. P. ROMERO, 2000 RAD51 is required for propagation of the germinal nucleus in Tetrahymena thermophila. Genetics 154:1587-1596
MCCORMICK-GRAHAM, M. and D. P. ROMERO, 1996 A single telomerase RNA is sufficient for the synthesis of variable telomeric DNA repeats in ciliates of the Genus Paramecium. Mol. Cell. Biol. 16:1871-1879[Abstract].
MENDELSOHN, M. L., 1958 The two-wavelength method of microspectrophotometry. A microspectrophotometer and tests on model systems. J. Biophys. Biochem. Cytol. 4:407-414
ORIAS, E., 1986 Ciliate conjugation, pp. 4594 in The Molecular Biology of the Ciliated Protozoa, edited by J. G. GALL. Academic Press, Orlando, FL.
ORIAS, E. and M. FLACKS, 1975 Macronuclear genetics of Tetrahymena. I. Random distribution of macronuclear gene copies in T. pyriformis, syngen 1. Genetics 79:187-206
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
WARD, J. G., P. BLOMBERG, N. HOFFMAN, and M. C. YAO, 1997 The intranuclear organization of normal, hemizygous and excision-deficient rRNA genes during developmental amplification in Tetrahymena thermophila. Chromosoma 106:233-242[Medline].
YAO, M.-C., 1996 Programmed DNA deletions in Tetrahymena: mechanisms and implications. Trends Genet. 12:26-30[Medline].
YAO, M.-C. and C. H. YAO, 1991 Transformation of Tetrahymena to cycloheximide resistance with a ribosomal protein gene through sequence replacement. Proc. Natl. Acad. Sci. USA 88:9493-9497
YAO, M.-C., J. CHOI, S. YOKOYAMA, C. F. AUSTERBERRY, and C. H. YAO, 1984 DNA elimination in Tetrahymena: a developmental process involving extensive breakage and rejoining of DNA at defined sites. Cell 36:433-440[Medline].
YU, G.-L. and E. H. BLACKBURN, 1990 Amplification of tandemly repeated origin control sequences confers a replication advantage on rDNA replicons in Tetrahymena thermophila. Mol. Cell. Biol. 10:2070-2080
ZHANG, Z., D. M. MACALPINE, and G. M. KAPLER, 1997 Developmental regulation of DNA replication: replication fork barriers and programmed gene amplification in Tetrahymena thermophila. Mol. Cell. Biol. 17:6147-6156[Abstract].
This article has been cited by other articles:
![]() |
K. E. Kirk, C. Christ, J. M. McGuire, A. G. Paul, M. Vahedi, K. R. Stuart, and E. S. Cole Abnormal Micronuclear Telomeres Lead to an Unusual Cell Cycle Checkpoint and Defects in Tetrahymena Oral Morphogenesis Eukaryot. Cell, October 1, 2008; 7(10): 1712 - 1723. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Smith, S. E. Torigoe, J. Maxson, L. C. Fish, and E. A. Wiley A Class II Histone Deacetylase Acts on Newly Synthesized Histones in Tetrahymena Eukaryot. Cell, March 1, 2008; 7(3): 471 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Cervantes, R. S. Coyne, X. Xi, and M.-C. Yao The Condensin Complex Is Essential for Amitotic Segregation of Bulk Chromosomes, but Not Nucleoli, in the Ciliate Tetrahymena thermophila Mol. Cell. Biol., June 15, 2006; 26(12): 4690 - 4700. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Matsuda and J. D. Forney The SUMO Pathway Is Developmentally Regulated and Required for Programmed DNA Elimination in Paramecium tetraurelia Eukaryot. Cell, May 1, 2006; 5(5): 806 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Smith, J. S. Yakisich, G. M. Kapler, E. S. Cole, and D. P. Romero A {beta}-Tubulin Mutation Selectively Uncouples Nuclear Division and Cytokinesis in Tetrahymena thermophila Eukaryot. Cell, October 1, 2004; 3(5): 1217 - 1226. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Marsh, T. C.
- Articles by Romero, D. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Marsh, T. C.
- Articles by Romero, D. P.







