- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Rolfsmeier, M. L.
- Articles by Lahue, R. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Rolfsmeier, M. L.
- Articles by Lahue, R. S.
Cis-Elements Governing Trinucleotide Repeat Instability in Saccharomyces cerevisiae
Michael L. Rolfsmeier1,2,a, Michael J. Dixon1,a,b, Luis Pessoa-Brandão3,a, Richard Pelletiera, Juan José Miret4,a, and Robert S. Lahuea,ba Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, Nebraska 68198-6805
b Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, Nebraska 68198-6805
Corresponding author: Robert S. Lahue, Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Box 986805, Omaha, NE 68198-6805., rlahue{at}unmc.edu (E-mail)
Communicating editor: N. ARNHEIM
| ABSTRACT |
|---|
Trinucleotide repeat (TNR) instability in humans is governed by unique cis-elements. One element is a threshold, or minimal repeat length, conferring frequent mutations. Since thresholds have not been directly demonstrated in model systems, their molecular nature remains uncertain. Another element is sequence specificity. Unstable TNR sequences are almost always CNG, whose hairpin-forming ability is thought to promote instability by inhibiting DNA repair. To understand these cis-elements further, TNR expansions and contractions were monitored by yeast genetic assays. A threshold of
1517 repeats was observed for CTG expansions and contractions, indicating that thresholds function in organisms besides humans. Mutants lacking the flap endonuclease Rad27p showed little change in the expansion threshold, suggesting that this element is not altered by the presence or absence of flap processing. CNG or GNC sequences yielded frequent mutations, whereas A-T rich sequences were substantially more stable. This sequence analysis further supports a hairpin-mediated mechanism of TNR instability. Expansions and contractions occurred at comparable rates for CTG tract lengths between 15 and 25 repeats, indicating that expansions can comprise a significant fraction of mutations in yeast. These results indicate that several unique cis-elements of human TNR instability are functional in yeast.
THE genetic behavior of trinucleotide repeats (TNRs) in humans is governed by several unusual features, as judged by the inheritance pattern of families afflicted with Fragile X syndrome, Huntington's disease, or other diseases caused by mutations in endogenous TNRs (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Physical analysis of TNR-containing DNA strands showed that they readily adopt unusual secondary structures, such as hairpins, triplexes, quadruplexes, and slipped-strand conformations (summarized in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Although unusual TNR secondary structures have not been directly demonstrated in vivo, a number of experiments support the idea that hairpins or other aberrant structures are key intermediates in mutation. For example, some sequence specificity for instability has been reported both in Escherichia coli (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
To address more directly the idea that thresholds and sequence are key mediators of TNR instability, this study utilizes a series of TNR constructs in yeast. We took advantage of yeast genetic assays for TNR expansions and contractions that are selective, sensitive, and quantitative to determine the modulation of TNR instability by important cis-elements. We find that thresholds exist in yeast and that TNR instability can usually be predicted on the basis of length of the repeat and its sequence. This study extends the current knowledge of how cis-acting elements influence TNR instability in eukaryotes.
| MATERIALS AND METHODS |
|---|
Strains:
The E. coli strain DH5
[endA1 hsdR17 (rk- mk+) supE44 thi-1 recA1 gyrA (nalr) relA1
(lacI ZYA-argF) U169 deoR] was used for plasmid construction of the TNR and large-scale plasmid preparations. The Saccharomyces cerevisiae strains used were MW 3317-21A (MAT
trp1 ura3-52 ade2
ade8 hom3-10 his3-KpnI met4 met13; ![]()
1 trp1
63 ura3-52 his3-200; obtained from S. Mirkin, University of Illinois at Chicago). The rad27
mutant strain in the MW 3317-21A background was constructed as described previously (![]()
![]()
Plasmids:
All plasmids were constructed using the pBL94 vector, described previously as pURA with a 1.1-kb LYS2 fragment in the "forward" direction (![]()
![]()
![]()
![]()
![]()
The threshold repeat derivatives contained a scrambled (randomized) sequence in addition to the perfect repeat tract. The scrambled sequence on the sense strand, read 5' to 3', contains (CGGCGACGCAACGAACCGAAACGCGGGCCGCGCAAGGACCGCCAA) or subsets thereof. For example the 15-repeat threshold plasmid contained the repeats plus the 3'-most 30 base pairs of the scrambled sequence (starting CCGAAACGC, underlined above). Likewise the 17-repeat threshold plasmid contained the repeats in addition to the 3'-most 24 bp from the scrambled sequence (starting CGCGGGCCG). The final 24 randomized base pairs (beginning CGCGGGCCG) were used to generate a "25+8" repeat plasmid for certain contraction assays. Plasmids were transformed into DH5
using the Hanahan procedure (![]()
Fluctuation analysis:
Fluctuation analysis was performed as previously described (![]()
![]()
PCR of independent expansion or contraction events:
As a safeguard to minimize microheterogeneity of the starting tract size, a portion of each colony was examined by PCR to ensure that the starting tract contained 25 or 50 repeats prior to fluctuation analysis (![]()
-32P]dCTP, was performed with primers that flank the triplet repeat tract. The products of the PCR reactions were analyzed on 6% denaturing polyacrylamide gels and product sizes (±12 repeats) were determined by comparison of the reaction products with a M13 DNA sequence ladder. For strains bearing CGG/CCG repeats, tract sizes were measured by Southern blotting. Colonies were grown in liquid (YPD) cultures for 2 days, the genomic DNA was subsequently extracted and digested with SphI to release the TNR plus a four-nucleotide overhang on each strand. The DNA fragments were resolved on 6% denaturing PAGE gels, electroblotted to a nylon membrane, and hybridized to a radiolabeled probe derived from a (CGG/CCG)25 control fragment. CGG and CCG repeat tract sizes were deduced by comparison with appropriate molecular weight markers.
The fraction of bona fide expansions and contractions, judged by PCR analysis or Southern blotting, was used as a correction factor for rate measurements. At least 25 genetically independent colonies were tested for each strain. For example, if 24 of 30 5-FOA resistant colonies showed expansion by PCR analysis, then the rate of 5-FOA resistance was multiplied by 80% to generate the rate of expansion. For certain constructs, the estimated mutation rate was below the detectable limit of
3 x 10-8 per cell generation. These low rates arose from one of two circumstances. Either there were no colonies on the selective plates (5-FOA-containing media for expansions or media lacking uracil for contractions); or colonies arose on selective media but PCR analysis showed that none of the colonies had altered TNR tracts. To estimate the upper limit of the mutation rate under these circumstances, it was assumed that the next cell plated would have been a bona fide expansion or contraction.
| RESULTS |
|---|
Rationale:
If mechanisms of TNR instability show conservation among species, then some or all of the unusual genetic features of TNR behavior in humans may be manifested in other organisms. This investigation examined if important features of human trinucleotide repeat diseases are recapitulated in S. cerevisiae. Specifically, the hypothesis under scrutiny was that TNR instability in yeast is strongly dependent on two factors. One factor is the length of the repeat tract vs. its threshold. By definition, TNRs longer than the threshold are genetically unstable whereas tracts shorter than the threshold are stable. The TNR sequence is the second strong determinant of instability. Based on observations from human genetics and from structural considerations, it was predicted that the G-C rich sequences CNG (where N is any nucleotide), GAC, and GTC would mutate most frequently, provided that the tract length met or exceeded a threshold level. These characteristics were investigated using selective and sensitive genetic assays capable of identifying expansions and contractions.
Genetic assays:
Rates of TNR expansions or contractions were assessed using quantitative genetic assays in S. cerevisiae (![]()
![]()
30 repeats inactivate the URA3 reporter and the cells are accordingly resistant to 5-FOA. This assay was designed specifically to reveal expansions of
5 repeats because this size class is among the most frequent in the polyglutamine class of human TNR diseases (![]()
![]()
![]()
28 repeats allow functional expression of the URA3 reporter, leading to a phenotypic change from Ura- to Ura+ (able to grow without exogenous uracil). Control experiments with a 28-repeat construct confirmed this prediction. The rate of contraction is therefore proportional to the number of Ura+ colonies. Later, we describe an alternative assay that allows identification of smaller contraction events.
|
These yeast assays also allow the use of single-colony PCR (![]()
![]()
CTG expansions exhibit a threshold:
Although thresholds have been identified or inferred for a number of human TNR expansion diseases, this feature has not been demonstrated directly in model organisms. Our genetic assay is suitably sensitive to detect a threshold effect. From previous work (![]()
Expansions of CTG repeats in wild-type yeast exhibit a threshold effect (Fig 2A, solid circles). The 0-repeat, randomized control construct defines the baseline. The 10-repeat construct gave the same baseline rate. Since the assay is very sensitive (the detection limit is 3 x 10-8), even rare events would show up. Therefore expansions of 0- or 10-CTG tract are extremely infrequent. In contrast, the expansion rate rose sharply (about 100-fold) as the initial tract size was increased to 20 repeats. Thus a doubling of the CTG tract from 10 to 20 repeats resulted in two orders of magnitude increase in instability. There is a further, less dramatic rate increase when the tract is lengthened from 20 to 25 repeats. The midpoint of the transition, judged as the halfway point between the lowest and highest expansion rates, fell at
15 repeats. We conclude that CTG expansions in wild-type yeast are governed by a threshold of about 15 repeats. If the expansion risk were a simple stochastic function of tract length, there would not be the sharp upward inflection seen in Fig 2A.
|
PCR analysis indicated that the expansions were limited by the size of the initial repeat tract. In 153 of the 154 expansion events arising from the 13- to 20-repeat constructs, PCR sizing showed that the expanded allele size was no more than two times the size of the initial repeat. For example, all expansions examined from the 13-repeat construct ranged from +5 to +11 repeats. These expanded allele sizes are consistent with the idea that hairpin-mediated, aberrant replication events were the source of these expansions, since models for single hairpin intermediates (![]()
![]()
To address the possibility that position effects might influence thresholds, a subset of the constructs used in Fig 2A were integrated at another locus, URA3. TNR expansions at URA3 were assessed using a spot test (Fig 2B). Instability is judged by the number of 5FOAR colonies that appear as the cell suspension is serially diluted by fivefold. Fig 2B (top) shows growth on media containing 5-FOA. In the spot test, a (CTG)25 tract exhibited the highest instability, followed by a repeat containing 17 CTGs. The 17-repeat construct was included as an example near the threshold length; note in Fig 2A that the expansion rate of 15- and 17-repeat constructs is very similar. The difference in expansion rate between 25 and 17 repeats in the spot test is similar to the eightfold quantitative rate difference seen earlier (Fig 2A). In Fig 2B, the (CTG)10 tract was as stable as the randomized control. The lower plate contains no 5-FOA, and all strains grew similarly under these control conditions. These results at URA3 closely parallel the quantitative analysis of expansions at LYS2, suggesting that the threshold for CTG expansions is similar at both integration sites.
If thresholds define a minimal number of repeats necessary for hairpins to persist in vivo, then the flap endonuclease encoded by RAD27 might provide a trans-acting function that alters the threshold. Although long TNR sequences can fold into hairpins that are strong enough to resist Rad27p processing, the enzyme more readily cleaves shorter TNRs that have limited hairpin-forming capacity (![]()
![]()
mutants should exhibit a stronger tendency to expand than in wild type. To address this possibility, the experiment was repeated in a rad27
strain (open circles in Fig 2A). For repeat lengths of 0 or 10 repeats, there were no detectable expansions in rad27
cells. Intermediate repeat lengths of 13, 17, and 20 were 50- to 100-fold more unstable in the mutant strain compared to wild type, consistent with previous demonstrations of rad27
destabilization of TNR tracts (![]()
![]()
![]()
mutant showed an apparent threshold, based on the sharp upward inflection of the response curve. The threshold in the rad27
background, judged as the midpoint of the transition, was about 13 repeats. Thus there seems to be little change in the apparent threshold in the rad27
mutant compared to wild type. PCR analysis showed that about 85% of the expansions in the mutant were limited to gains equal to or less than the original tract length, consistent with a replicational mechanism of instability (![]()
background.
Sequence dependence of expansion and contraction rates:
There has been no extensive sequence analysis of TNR instability in eukaryotic systems, so it was informative to test different repeats side-by-side in yeast. If predictions from human genetics and from in vitro studies hold true, we expected that CNG and GNC sequences would be the most unstable, based on their ability to form hairpins. To address this hypothesis, expansion rates for 25-repeat tracts were measured for six variations of the G-C rich sequences and compared to four A-T rich TNRs with limited ability to fold into hairpins. Similarly, contractions from 50-repeat runs were measured for the same six G-C rich sequences plus two TNRs with limited hairpin-forming capacity. Scrambled controls provided estimates of the baseline for both expansions and contractions. It is important to note the nomenclature for these experiments. For expansions, the cited sequence resides on the lagging daughter strand, since most models for TNR expansions envision hairpin formation in the Okazaki fragment (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Examination of the expansion and contraction rates of the different triplet repeats revealed two different groups. These results are depicted graphically in Fig 3, to help clarify the groupings. Precise values and experimental errors are presented in Table 1. The first group, which exhibited high rates for both expansions and contractions, contained the five G-C rich triplets CTG, CGG, CCG, GTC, and GAC. Compared to the scrambled controls, expansion rates for this group ranged from 50- to 3000-fold higher and contraction rates were 400 to 40,000 times greater. For all sequences within this group, contractions occurred about 3100 times more frequently than expansions, although the difference in starting repeat length (50 compared to 25) may explain some of the tendency toward contractions. Further evidence in support of a replication model for TNR expansions in group one is that there is virtually no alteration in the expansion rate in a rad52 strain for GAC expansions (4.0 x 10-7 vs. 1.0 x 10-6 in wild type), consistent with previous findings for CTG (![]()
![]()
![]()
![]()
|
|
Sequences in group two (TTC, CTA, TAG, GAA, and CAG) exhibited expansion rates that were at or close to the scrambled control baseline (Fig 3). These sequences therefore show little tendency to expand in our system when the tract length is 25 repeats. When contractions were assayed, (TAG)50 showed a modest but detectable rate, suggesting some hairpin-forming ability and consistent with observations from meiotic recombination experiments (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Direct comparison of expansions and contractions for CTG tracts of 15 to 25 repeats:
The results from Fig 3 suggest that contraction rates are substantially higher than expansion rates in our system. However, the comparison is not direct, due in part to the difference in tract length (25 compared to 50 repeats). Also, the changes detectable for expansions (gains of
5 repeats) were different from that for contractions (losses of 2242 repeats). A more direct comparison was performed by monitoring expansions and contractions of the same size tract, (CTG)25, as diagrammed in Fig 4A. Expansions of
5 repeats were detected by the scheme described earlier. To measure contractions, the assay was adapted slightly by using a (CTG)25 tract to which 24 bp of scrambled sequences, equivalent to 8 repeats, were added ("25+8" configuration). The total tract length is therefore equivalent to 33 repeats, which prevents expression of URA3 and thus confers a Ura- phenotype. Contractions that remove 525 repeats are sufficient to restore functional expression of URA3 and thereby generate the Ura+ phenotype, as confirmed by control experiments with 8-repeat and 28-repeat constructs. Contractions of 525 repeats can be detected from the 25+8 construct, while expansions of the same range are scorable for (CTG)25. Therefore, the results from expansion and contraction assays can be compared directly.
|
The contraction rate for the 25+8 reporter was 2.7 x 10-5 per cell generation (Fig 4A), about 3-fold higher than the expansion rate for (CTG)25. This result suggests that for (CTG)25, contractions outnumber expansions, but not by nearly as much as for longer CTG repeats in yeast. Other groups have shown that runs of 64130 triplet repeats contract at a minimum of 20-fold more often than they expand (![]()
![]()
![]()
![]()
The similarity in expansion and contraction rates for (CTG)25 encouraged us to examine tract lengths with other repeat lengths. There were two goals to this experiment: first, to see if the contraction rates could help verify the threshold of about 15 repeats that was observed for expansions. If expansions and contractions occur through similar, hairpin-based intermediates, then perhaps the thresholds would be similar. The second goal was to see if expansions and contractions occur with similar rates for other tract lengths near the threshold, as seen for 25 repeats. The results are shown in Fig 4B. The solid circles are the expansion data, reiterated here for comparison. The open circles between 0 and 33 repeats represent contraction data using an approach analogous to that used in Fig 4A. In other words, the 33-repeat contraction reporter was (CTG)33, or a "33+0" configuration, and the 0-repeat reporter had all scrambled sequence, or "0+33." As an example of intermediate length tracts, the 15-CTG contraction construct had a "15+18" configuration. Since the overall length of each reporter was equivalent to 33 total repeats, all rates measured contractions of 5 repeats or larger. Therefore these contraction data over this size range can be compared directly to expansion rates, since all experiments detect similar size events.
The contraction rate for 0 CTG repeats was below detection (<3 x 10-8; Fig 4B). In contrast, contraction rates for 15- to 33-repeat tracts increased over 100-fold in a nearly linear fashion on this semilogarithmic plot. An approximate doubling of the initial tract length (from 15 to 33 repeats) led to over two orders of magnitude change in contraction rates. Extending the contraction analysis to tracts shorter than 15 was judged to be noninformative, since short repeat tracts would artificially limit the observable contractions to very small lengths. This technical limitation of the experiment prevented us from extending the contraction analysis to lengths below 15 repeats, where additional information might have helped define a potential contraction threshold. Two other features of the results in Fig 4B are noteworthy. First, there is considerable similarity with the expansion rates between 15 and 25 repeats. The rate ratios (contractions/expansions) ranged from one to five, with an average ratio of three. Thus expansions and contractions occur with comparable rates over this range of tract lengths. Second, the expansion and contraction rates between 13 and 33 repeats form a nearly continuous line. Using the midpoint analysis described earlier, a threshold value of about 17 repeats was estimated from the combined data points. Although the contraction experiment does not permit a precise threshold measurement, the very similar threshold estimates for CTG expansions (15 repeats) and for the combined CTG expansion and contraction rates (17 repeats) are consistent with the hypothesis that expansions and contractions are governed by similar threshold lengths.
Single-colony PCR of contractions was used to determine the spectrum of actual changes in this experiment. Fig 4C shows the analysis for initial repeat tracts of 15 and 33 repeats. From the starting tract of 15 CTGs, the contracted alleles clustered from -9 to -14 repeats. Contractions of the 33-repeat reporter were generally larger (-10 to -27), but they overlapped a portion of the first spectrum. Although control experiments showed that the assay system is capable of detecting contractions ranging from -5 to -25 repeats, no contractions in the -5 to -8 range were observed for any of the tracts examined. The reason for this is not known. The data in Fig 4C help rule out an alternative interpretation of the nearly 200-fold difference in rate between the 15- and 33-repeat reporters. The alternative explanation is that the two reporters measure different size contractions and therefore are not directly comparable. By this scenario, the 33-repeat construct yields only large contractions, possibly greater than the entire 15 CTG tract in the shorter reporter. However, the results in Fig 4C show substantial overlap in the 1014 contraction range for the two reporters. In fact, 9 of 27 contractions observed for the 33-repeat tract were losses of 1014 repeats. Therefore only a 3-fold reduction in contraction rate can be attributed to possible deletion size differences, whereas the rate analysis shows an almost 200-fold change.
| DISCUSSION |
|---|
The results of this investigation reveal that several major cis-elements that govern human TNR instability are operative in the model system S. cerevisiae. First, CTG expansions in yeast show a threshold of
15 repeats, indicating the first direct demonstration of a functional threshold in an organism besides humans. CTG contractions gave results consistent with, although not definitive for, a threshold of about 17 repeats. Our threshold experiments help to further differentiate the behavior of TNRs compared with other simple elements. For example, mutation rates in yeast increase with the length of the tract for runs of mononucleotides (![]()
![]()
![]()
![]()
![]()
![]()
![]()
This study provides a direct demonstration of a TNR threshold of about 15 repeats for CTG expansions. The most compelling evidence is that the rate of expansions increased over 100-fold when the CTG tract length was increased from 10 to 20 repeats (Fig 2). It is inherently clear that a simple dependence on tract length cannot explain the sharp upward increase in expansion rate between 10 and 20 repeats. There was no evidence for a genetic position effect to explain this observation, since similar thresholds were observed at two different integration sites. Therefore we conclude that the threshold value of 15 is bona fide. A parallel approach defined an apparent threshold for CTG contractions of 17 repeats. The similarity in the two threshold values is consistent with the hypothesis that similar mechanisms govern TNR expansions and contractions in our system. In human diseases, the generally accepted threshold value is about 35 repeats (![]()
![]()
![]()
![]()
![]()
Although 35 repeats has been estimated from in vitro experiments to provide maximum hairpin strength (![]()
![]()
![]()
![]()
We examined thresholds in a rad27
background because several reports (![]()
![]()
![]()
mutation appears not to manifest itself by reducing CTG thresholds. The relatively short threshold of 15 repeats in wild-type backgrounds may have limited our ability to observe reduction of the threshold in the rad27
strain. It is possible that threshold changes in rad27
cells may be more apparent for sequences that exhibit a longer threshold in wild-type cells. Testing this possibility awaits the identification of such sequences. The large majority of CTG expansions from starting tract sizes of 1325 repeats in the rad27
strain are likely due to aberrant replication, based on the sizes of the expanded alleles. The remaining
15% of events in the rad27
strain may arise from recombination (![]()
![]()
In humans, nearly all TNR expansion diseases arise from CNG sequences (![]()
![]()
![]()
![]()
![]()
Genetic analysis of 10 different TNRs in our yeast assay separated the triplets into two groups with a rough correlation between genetic instability and hairpin-forming capacity. Group one triplets (CTG, CGG, CCG, GAC, and GTC), which form hairpins in solution, showed high expansion and contraction rates. The contraction rates for CTG and CAG integrated at URA3 (this article) were virtually identical to values seen when these sequences were integrated at ADE8 or HIS3 loci (![]()
![]()
![]()
![]()
![]()
![]()
The TNR repeat length influences the ratio of contractions to expansions. Unlike transmission in humans, microbial systems have not mimicked the proclivity toward expansions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 These authors contributed equally to this work. ![]()
2 Present address: University of California, Division of Biological Sciences, Section of Microbiology, 1 Shields Ave., Davis, CA 95616. ![]()
3 Present address: Department of Biochemistry and Molecular Genetics, University of Colorado Health Sciences Center, 4200 E. Ninth Ave., Box B121, Denver, CO 80262. ![]()
4 Present address: OSI Pharmaceuticals Inc., 106 Charles Lindbergh Blvd., Uniondale, NY 11553-3649. ![]()
| ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health award GM-61961, by funds from the Eppley Institute, and by a research grant from the Muscular Dystrophy Association (all to R.S.L.), by National Cancer Institute (NCI) Training Grant T32 CA09476 (M.L.R. and M.J.D.), by a Hereditary Disease Foundation postdoctoral fellowship (J.J.M.), and by NCI Cancer Center Support Grant P30 CA36727 (Eppley Institute).
Manuscript received October 20, 2000; Accepted for publication January 18, 2001.
| LITERATURE CITED |
|---|
ASHLEY, C. T., JR. and S. T. WARREN, 1995 Trinucleotide repeat expansion and human disease. Annu. Rev. Genet. 29:703-728[Medline].
BALAKUMARAN, B. S., C. H. FREUDENREICH, and V. A. ZAKIAN, 2000 CGG/CCG repeats exhibit orientation-dependent instability and orientation-independent fragility in Saccharomyces cerevisiae.. Hum. Mol. Genet. 9:93-100
CAMPUZANO, V., L. MONTERMINI, M. D. MOLTO, L. PIANESE, and M. COSSEE et al., 1996 Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science 271:1423-1427[Abstract].
CUMMINGS, C. J. and H. Y. ZOGHBI, 2000 Fourteen and counting: unraveling trinucleotide repeat diseases. Hum. Mol. Genet. 9:909-916
FREUDENREICH, C. H., J. B. STAVENHAGEN, and V. A. ZAKIAN, 1997 Stability of a CTG/CAG trinucleotide repeat in yeast is dependent on its orientation in the genome. Mol. Cell. Biol. 17:2090-2098[Abstract].
FREUDENREICH, C. H., S. M. KANTROW, and V. A. ZAKIAN, 1998 Expansion and length-dependent fragility of CTG repeats in yeast. Science 279:853-856
GACY, A. M. and C. T. MCMURRAY, 1998 Influence of hairpins on template reannealing at trinucleotide repeat duplexes: a model for slipped DNA. Biochemistry 37:9426-9434[Medline].
GACY, A. M., G. GOELLNER, N. JURANIC, S. MACURA, and C. T. MCMURRAY, 1995 Trinucleotide repeats that expand in human disease form hairpin structure in vitro. Cell 81:533-540[Medline].
GACY, A. M., G. M. GOELLNER, C. SPIRO, X. CHEN, and G. GUPTA et al., 1998 GAA instability in Friedreich's ataxia shares a common, DNA-directed and intraallelic mechanism with other trinucleotide diseases. Mol. Cell 1:583-593[Medline].
GORDENIN, D. A., T. A. KUNKEL, and M. A. RESNICK, 1997 Repeat expansionall in a flap? Nat. Genet. 16:116-118[Medline].
GUSELLA, J. F. and M. E. MACDONALD, 1996 Trinucleotide instability: a repeating theme in human inherited disorders. Annu. Rev. Med. 47:201-209[Medline].
HANAHAN, D., 1983 Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline].
HENRICKSEN, L. A., S. TOM, Y. LIU, and R. A. BAMBARA, 2000 Inhibition of flap endonuclease 1 by flap secondary structure and relevance to repeat sequence expansion. J. Biol. Chem. 275:16420-16427
HIRST, M. C. and P. J. WHITE, 1998 Cloned human FMR1 trinucleotide repeats exhibit a length- and orientation-dependent instability suggestive of in vivo lagging strand secondary structure. Nucleic Acids Res. 26:2353-2358
JAKUPCIAK, J. P. and R. D. WELLS, 1999 Genetic instabilities in (CTG-CAG) repeats occur by recombination. J. Biol. Chem. 274:23468-23479
JANKOWSKI, C., F. NASAR, and D. K. NAG, 2000 Meiotic instability of CAG repeat tracts occurs by double-strand break repair in yeast. Proc. Natl. Acad. Sci. USA 97:2134-2139
KANG, S., A. JAWORSKI, K. OHSHIMA, and R. D. WELLS, 1995 Expansion and deletion of CTG repeats from human disease genes are determined by the direction of replication in E. coli.. Nat. Genet. 10:213-218[Medline].
KANG, S., K. OHSHIMA, A. JAWORSKI, and R. D. WELLS, 1996 CTG triplet repeats from the myotonic dystrophy gene are expanded in Escherichia coli distal to the replication origin as a single large event. J. Mol. Biol. 258:543-547[Medline].
KRAMER, B., W. KRAMER, M. S. WILLIAMSON, and S. FOGEL, 1989 Heteroduplex DNA correction in Saccharomyces cerevisiae is mismatch specific and requires functional PMS genes. Mol. Cell. Biol. 9:4432-4440
KUNST, C. B., E. P. LEEFLANG, J. C. IBER, N. ARNHEIM, and S. T. WARREN, 1997 The effect of FMR1 CGG repeat interruptions on mutation frequency as measured by sperm typing. J. Med. Genet. 34:627-631
LEA, D. E. and C. A. COULSON, 1948 The distribution of the number of mutants in bacterial populations. J. Genet. 49:264-284.
LEEFLANG, E. P., L. ZHANG, S. TAVARE, R. HUBERT, and J. SRINIDHI et al., 1995 Single sperm analysis of the trinucleotide repeats in the Huntington's disease gene: quantification of the mutation frequency spectrum. Hum. Mol. Genet. 4:1519-1526
LEEFLANG, E. P., S. TAVARE, P. MARJORAM, C. O. S. NEAL, and J. SRINIDHI et al., 1999 Analysis of germline mutation spectra at the Huntington's disease locus supports a mitotic mutation mechanism. Hum. Mol. Genet. 8:173-183
MAURER, D. J., B. L. O'CALLAGHAN, and D. M. LIVINGSTON, 1996 Orientation dependence of trinucleotide CAG repeat instability in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:6617-6622[Abstract].
MCMURRAY, C. T., 1995 Mechanisms of DNA expansion. Chromosoma 104:2-13[Medline].
MCMURRAY, C. T., 1999 DNA secondary structure: a common and causative factor for expansion in human disease. Proc. Natl. Acad. Sci. USA 96:1823-1825
MIRET, J. J., L. PESSOA-BRANDÃO, and R. S. LAHUE, 1997 Instability of CAG and CTG trinucleotide repeats in Saccharomyces cerevisiae.. Mol. Cell. Biol. 17:3382-3387[Abstract].
MIRET, J. J., L. PESSOA-BRANDÃO, and R. S. LAHUE, 1998 Orientation-dependent and sequence-specific expansions of CTG/CAG trinucleotide repeats in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 95:12438-12443
MITAS, M., 1997 Trinucleotide repeats associated with human disease. Nucleic Acids Res. 25:2245-2253
MITAS, M., A. YU, J. DILL, T. J. KAMP, and E. J. CHAMBERS et al., 1995 Hairpin properties of single-stranded DNA containing a GC-rich triplet repeat: (CTG)15. Nucleic Acids Res. 23:1050-1059
MONCKTON, D. G., M. L. CAYUELA, F. I. GOULD, G. J. R. BROCK, and R. DE SILVA et al., 1999 Very large (CAG)n DNA repeat expansions in the sperm of two spinocerebellar ataxia type 7 males. Hum. Mol. Genet. 8:2473-2478
MOORE, H., P. W. GREENWELL, C.-P. LIU, N. ARNHEIM, and T. D. PETES, 1999 Triplet repeats form secondary structures that escape DNA repair in yeast. Proc. Natl. Acad. Sci. USA 96:1504-1509
MORNET, E., C. CHATEAU, M. C. HIRST, F. THEPOT, and A. TAILLANDIER et al., 1996 Analysis of germline variation at the FMR1 CGG repeat shows variation in the normal-premutated borderline range. Hum. Mol. Genet. 5:821-825



