Genetics, Vol. 157, 1503-1512, April 2001, Copyright © 2001

The DNA Binding Protein Rfg1 Is a Repressor of Filamentation in Candida albicans

Roy A. Khalafa and Richard S. Zitomera
a Department of Biological Sciences, University at Albany/State University of New York, Albany, New York 12222

Corresponding author: Richard S. Zitomer, Department of Biological Sciences, University at Albany/SUNY, Albany, NY 12222., rz144{at}csc.albany.edu (E-mail)

Communicating editor: A. P. MITCHELL


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have identified a repressor of hyphal growth in the pathogenic yeast Candida albicans. The gene was originally cloned in an attempt to characterize the homologue of the Saccharomyces cerevisiae Rox1, a repressor of hypoxic genes. Rox1 is an HMG-domain, DNA binding protein with a repression domain that recruits the Tup1/Ssn6 general repression complex to achieve repression. The C. albicans clone also encoded an HMG protein that was capable of repression of a hypoxic gene in a S. cerevisiae rox1 deletion strain. Gel retardation experiments using the purified HMG domain of this protein demonstrated that it was capable of binding specifically to a S. cerevisiae hypoxic operator DNA sequence. These data seemed to indicate that this gene encoded a hypoxic repressor. However, surprisingly, when a homozygous deletion was generated in C. albicans, the cells became constitutive for hyphal growth. This phenotype was rescued by the reintroduction of the wild-type gene on a plasmid, proving that the hyphal growth phenotype was due to the deletion and not a secondary mutation. Furthermore, oxygen repression of the hypoxic HEM13 gene was not affected by the deletion nor was this putative ROX1 gene regulated positively by oxygen as is the case for the S. cerevisiae gene. All these data indicate that this gene, now designated RFG1 for Repressor of Filamentous Growth, is a repressor of genes required for hyphal growth and not a hypoxic repressor.


MANY yeast species have the capacity to grow under strongly hypoxic conditions. Cells adapt to hypoxia by inducing genes that encode functions that enable them to use limiting oxygen more efficiently. We have studied the regulation of these hypoxic genes extensively in one yeast, the model organism Saccharomyces cerevisiae (for review see ZITOMER and LOWRY 1992 Down; ZITOMER et al. 1997 Down; KASTANIOTIS and ZITOMER 2000 Down). Oxygen levels are sensed in the cell by the levels of heme; heme biosynthesis requires oxygen as substrate at two steps. Heme serves as a cofactor for the transcriptional activator Hap1, which activates the expression of aerobically induced genes. One of these genes is ROX1, which encodes a repressor of the hypoxic genes. Thus, under aerobic conditions, heme accumulates, the transcription of ROX1 is activated, and the hypoxic genes are repressed. Under hypoxic conditions, heme levels are reduced, ROX1 is not transcribed, and the hypoxic genes are derepressed.

Rox1 consists of 368 amino acids (BALASUBRAMANIAN et al. 1993 Down). The first fourth of the protein comprises an HMG domain, a DNA binding and bending motif (BALASUBRAMANIAN et al. 1993 Down; DECKERT et al. 1995B Down, DECKERT et al. 1999 Down). Through this domain, Rox1 binds to a specific DNA sequence located upstream of the hypoxic genes. The last two-thirds of the protein comprises the repression domain. This domain recruits the Tup1/Ssn6 general repression complex to the hypoxic genes to achieve repression (DECKERT et al. 1995B Down). The Tup1/Ssn6 complex is involved in the repression of a diverse set of regulons in S. cerevisiae (MUKAI et al. 1991 Down; WILLIAMS et al. 1991 Down; ZHANG et al. 1991 Down; KELEHER et al. 1992 Down; ELLEDGE et al. 1993 Down; TEUNISSEN et al. 1995 Down; FRIESEN et al. 1997 Down; MARQUEZ et al. 1998 Down; MIZUNO et al. 1998 Down). The complex has no intrinsic DNA binding activity, but is recruited to target genes by regulon-specific DNA binding repressor proteins (KELEHER et al. 1992 Down; TZAMARIAS and STRUHL 1994 Down, TZAMARIAS and STRUHL 1995 Down; TREITEL and CARLSON 1995 Down). It is the regulation of the synthesis or activity of each of these regulon-specific proteins that achieves the desired pattern of gene expression for each regulon.

In our genetic analysis of the Rox1 protein, we have isolated a large number of mutations in the HMG domain and characterized their effects on DNA binding and bending in vitro and repression in vivo (DECKERT et al. 1999 Down). However, the analysis of the repression domain has proved frustrating. This domain is functionally redundant; either half of this domain can support repression, and deletion analysis revealed no specific essential elements (DECKERT et al. 1995B Down). The amino acid sequence of this domain has no clear repeated elements and provides no clues to its functional redundancy. Also, it has been difficult to establish an assay for the association of Rox1 with the Tup1/Ssn6 complex in vitro, which would help define essential elements of the Rox1 protein. Therefore, we have turned to a comparative sequence analysis approach, anticipating that the residues required for the interaction with Tup1/Ssn6 would be conserved in the Rox1 homologues of other yeast species.

We report here our attempt to clone the ROX1 homologue from Candida albicans. We began with this yeast for several reasons. First, it can grow under hypoxic conditions and, therefore, is likely to have a hypoxic regulon. Second, this yeast is phylogenetically close enough to S. cerevisiae to expect conservation of general regulatory mechanisms. Indeed, this conservation has been extensively exploited in the study of filamentous growth in C. albicans (for reviews see CORNER and MAGEE 1997 Down; KOBAYASHI and CUTLER 1998 Down; MITCHELL 1998 Down; BROWN et al. 2000 Down). However, the two yeasts are sufficiently distantly related to expect divergence of amino acid residues that are not under strong selective pressure. Third, there is an ongoing sequence project for the C. albicans genome that proved helpful in identifying a putative ROX1 homologue and would be helpful in identifying hypoxic target genes. Finally, C. albicans is a human pathogen, a major killer of immune-compromised patients, and we suspected there might be a link between pathogenicity and hypoxia. Pathogenicity is strongly linked to filamentous growth, which may be important for tissue invasion. Hypoxia has been reported to be one of the many signals that triggers the transition to filamentous growth (ODDS 1985 Down), albeit a weak one. Also, as hyphae invade tissue, hypoxia may be one of the environmental changes incurred. Thus, we felt that an analysis of hypoxia in C. albicans may have some relevance to pathogenicity.

We identified a C. albicans gene with extensive similarity to the S. cerevisiae ROX1 gene. We demonstrated that it bound specifically to the hypoxic target DNA sequence and that it served as a hypoxic repressor in S. cerevisiae. However, to our surprise, we found that deletion of the gene caused constitutive hyphal growth and that it did not regulate the HEM13 hypoxic gene of C. albicans. Therefore, this gene appears to encode a repressor of hyphal growth rather than a hypoxic repressor.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast strains and cell growth:
The C. albicans strain RM1000 was used in this study (NEGREDO et al. 1997 Down). The S. cerevisiae strain MZ22-4{Delta}r1::gK contains a deletion of the ROX1 gene and an integrated ANB1-lacZ fusion (DECKERT et al. 1999 Down). MZ22-4{Delta}r1{Delta}m3 is a derivative of MZ22-4{Delta}r1::gK containing a deletion of the MOT3 gene (KASTANIOTIS et al. 2000 Down). MZ22-4PC is a derivative of MZ22-4{Delta}r1::gK containing the tup1::TRP1 allele.

Cells were maintained and grown without selection on rich YPD medium (KAISER et al. 1994 Down). SC synthetic medium lacking specific nutrients was used for selective growth (KAISER et al. 1994 Down). For aerobic growth for RNA preparations, cells were grown on YPD with vigorous shaking at 30°. For short-term anaerobic growth for RNA preparations, ultrapure nitrogen (99.9%) was bubbled through cultures for 2 hr, vigorously at first, and then more slowly to maintain anaerobic conditions. For ß-galactosidase assays, cells were grown in SC selective media at 30° with vigorous shaking. For long-term anaerobic growth for ß-galactosidase assays, cells were grown in SC selective media supplemented with 20 µg/ml ergosterol and 0.2% Tween 80 overnight in flasks packed into anaerobic chambers with a GasPak kit (BBL). To induce filamentous growth in C. albicans, cells were grown in 10% fetal calf serum overnight with vigorous shaking at 30°. Cells were stained with calcofluor as described (ADAMS and PRINGLE 1991 Down).

Plasmids:
All plasmids were maintained in Escherichia coli strain HB101 as described (AUSUBEL et al. 2000 Down). Plasmid constructions and enzymatic manipulations were carried out using standard procedures (AUSUBEL et al. 2000 Down) and conditions recommended by the enzyme vendors. The sequences of synthetic oligonucleotides used for PCR and sequence analyses are available upon request.

The C. albicans library in pEMBLy23 was provided by P. T. Magee (University of Minnesota) and a second library was provided by G. R. Fink (MIT). The C. albicans transforming plasmid pABSK2 carrying the C. albicans URA3 selectable marker and the ARS2 replication origin was provided by H. Chibana (University of Minnesota). Plasmids pGEM-URA3 and pGEM-HIS1 containing the C. albicans URA3 and HIS1 genes, respectively, were obtained from Dr. A. P. Mitchell (Columbia) (WILSON et al. 1999 Down).

The plasmids below were constructed for this study. The sequences are numbered with the A of the ATG translational initiation codon as +1, and sequences 3' are numbered consecutively in positive integers and sequenced 5' in negative integers.

  • pBS-ROX1, the initial clone of the C. albicans ROX1 N-terminal coding region, was obtained by PCR using primers homologous to the ends of the sequence present in the C. albicans database (http://www.alces.med.umn.edu) at that time. It contains residues from +3 to +321 flanked by the restriction sites KpnI and HindIII.

  • pROX1-HMG was identified from the library of Dr. G. R. Fink by colony hybridization using the insert from pBS-ROX1. It contained the sequences from about -1000 to +600.

  • pROX1-C was obtained by amplification of cDNA prepared from C. albicans poly(A) RNA using an oligo(dT) primer and a ROX1 specific primer from +495 to +519. The PCR product was digested with HindIII and XbaI and ligated into the complementary sites of pBSK (Stratagene, La Jolla, CA).

  • YCp(22)CaROX1 contained a genomic copy of the ROX1 gene. The PCR fragment containing residues -574 to +1314 flanked by HindIII and BstEII restriction sites was ligated to the homologous sites of YCp(22)ROX1Hx (DECKERT et al. 1995A Down), replacing the S. cerevisiae ROX1 upstream and coding sequences but retaining the 3' sequences.

  • YCp(33)CaROX1 is identical to YCp(22)CaROX1 except that the CaROX1 gene is contained in the vector YCplac33 (GIETZ and SUGINO 1988 Down).

  • YCp(22)ROX1EKP contained the S. cerevisiae ROX1 on a 2.8-kb fragment with an EcoRI site at the 5' end, a KpnI site at codons 2 and 3, and a PstI site at the 3' end. It was constructed by two separate PCR reactions (EcoRI to KpnI and KpnI to PstI) followed by a three-way ligation into the EcoRI-PstI sites of YCplac22 (GIETZ and SUGINO 1988 Down).

  • YCp(22)CaR1-HMG1 contained a replacement of the sequences encoding the S. cerevisiae Rox1 HMG-domain (codons 2 to 123) with those of the C. albicans Rox1 HMG-domain (codons 38 to 119). It was constructed by PCR amplification of C. albicans ROX1 sequences from pROX1-HMG using primers that placed a KpnI site at the 5' end and an XhoI site at the 3' end of the coding sequences. The fragment was ligated with

  • YCp(22)ROX1EKP digested with PstI and KpnI plus the XhoI-PstI fragment from YCp(22)R1-100/123 (DECKERT et al. 1995B Down).

  • YCp(22)CaR1-HMG2 was similar to YCp(22)CaR1-HMG1 but contained the C. albicans ROX1 sequences from 38 to 199. It was constructed in the same fashion as above.

  • YCp(33)CaR1-C contained a replacement of the sequences encoding the S. cerevisiae Rox1 repression domain (codons 100 to 360) with those of the C. albicans Rox1 repression domain (codon 165 to 30 bp beyond the termination codon). It was constructed by PCR amplification from pROX1-C using primers that placed an XhoI site at the 5' end and a BstEII site at the 3' end. This fragment was ligated into plasmid

  • YCp(33)R1{Delta}100/245 (DECKERT et al. 1995B Down) digested with XhoI and BstEII.

  • pMAL-CaROX1(HMG) contained a fusion of the maltose binding protein gene malE to the HMG-domain encoding sequences of the C. albicans ROX1 gene from codons 38 to 174. It was constructed by PCR amplification of the ROX1 HMG domain from pBS-ROX1 using primers that placed KpnI and PstI restriction sites at the 5' and 3' ends of the PCR fragment, respectively. The fragment was ligated into pMAL-ROX1(HMG) (DECKERT et al. 1999 Down) digested with the same enzymes.

  • YCApROX1 contains the C. albicans ROX1 gene from -574 to +1314 inserted into the URA3-containing C. albicans transforming plasmid pABSK2. It was constructed by inserting the HindIII-KpnI fragment from YCp(22)CaROX1 into the homologous sites of pABSK2.

Sequence analysis:
The sequence of both strands of the C. albicans ROX1 gene was determined using the Sequenase kit (United States Biochemical, Cleveland) and synthetic primers.

Construction of deletion strains:
The deletions of the ROX1 gene in C. albicans were generated by transforming cells with PCR fragments. The URA3 deletion allele fragment was generated using one synthetic primer that contained the ROX1 sequences from +90 to +141 followed by URA3 sequences from -404 to -382 and a second primer containing the ROX1 sequences from +1314 to +1366 followed by URA3 sequences from +920 to +942. These primers were used to PCR amplify the URA3 gene from pGEM-URA3, resulting in a fragment containing the URA3 gene flanked by the ROX1 sequences of the primers. C. albicans strain RM1000 was transformed with this fragment as described (WILSON et al. 1999 Down).

The HIS1 deletion allele was generated in a similar fashion except that the primers contained HIS1 sequences (-337 to -317 for one primer and 900 to 916 for the other) at the 3' end following the ROX1 sequences. The HIS1 sequences were amplified from pGEM-HIS1.

The correct constructs were confirmed by PCR analyses of genomic DNA. The strategy involved the use of four sets of primers. The first set hybridized to sequences internal to the deleted ROX1 sequences such that only the wild-type allele would generate a PCR product. For the second set of primers, one hybridized outside the deleted ROX1 sequences and the other hybridized to one end of the URA3 sequences such that a PCR product would be generated only from the rox1::URA3 allele. The third set was similar to the second, except a HIS1 primer was used instead of the URA3 primer; this set was specific for the rox1::HIS1 allele. Finally, a set of primers that amplified the actin gene was used as a control for the quality of the DNA preparations. The data generated with these primers have been reviewed by the Communicating Editor.

Protein purification and DNA binding analysis:
The HMG domain of the C. albicans Rox1 protein was expressed from pMAL-CaROX1(HMG) in the E. coli strain PR745 (New England Biolabs, Beverly, MA) as a fusion to the maltose binding protein (MBP). The protein purification procedure was identical to that described for the S. cerevisiae MBP-Rox1(HMG) fusion (BALASUBRAMANIAN et al. 1993 Down). The gel retardation assay was carried out as described previously (BALASUBRAMANIAN et al. 1993 Down).

ß-Galactosidase assays:
The assays for ß-galactosidase expression in yeast were carried out as described (KAISER et al. 1994 Down). The activity is expressed as Miller units.

Preparation of RNA, reverse transcription, and RT-PCR:
RNA was prepared from yeast cells as described (LOWRY and ZITOMER 1984 Down). Where indicated, poly(A) RNA was prepared using oligo(dT) sepharose affinity chromatography (AUSUBEL et al. 2000 Down). cDNA was generated using reverse transcriptase as described (AUSUBEL et al. 2000 Down), and the RNA was removed by treatment with DNase free RNase (Roche Biochemicals). PCR was carried out using the primers indicated for varying numbers of cycles to ensure that product formation was within the linear range. For each RNA preparation, amplification without reverse transcription was carried out with each set of primers to ensure that there was no genomic DNA contamination.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Cloning and sequence of the C. albicans ROX1 gene:
The cloning of the C. albicans ROX1 gene was based upon the appearance of a 320-bp DNA sequence with similarity to the HMG-domain coding region of the S. cerevisiae ROX1 gene and annotated as a ROX1 homologue in the C. albicans database maintained at the University of Minnesota. PCR primers were generated to the ends of this sequence, and it was amplified, subcloned, and used as a probe in colony hybridization to two different libraries of C. albicans genomic DNA. Positive clones were sequenced and contained only the HMG domain and upstream sequences; the C-terminal coding sequence could not be found in either library. To obtain this region, RNA was prepared from C. albicans cells, and cDNA was generated to total poly(A) containing RNA. The ROX1 C-terminal coding region and the 3'-untranslated region was amplified from this cDNA pool using oligo(dT) and a ROX1-HMG specific primer. The PCR products were cloned and sequenced, and those containing the continuation of the ROX1 coding sequence were identified from the overlap with the previously sequenced regions. Finally, the genomic sequences from -547 through the 3'-untranslated region were cloned by PCR. For the purposes of this study, the C. albicans gene is referred to as ROX1 and the S. cerevisiae gene is referred to as ScROX1.

The complete DNA sequence from -547 to +1366, where the A of the first ATG initiation codon in the open reading frame is +1, has been deposited in the EMBL database. The protein coding sequence for the HMG domain from codon 1 to 189 is presented in Fig 1. The core amino acid sequence of the HMG domain from residues 30 to 119 is aligned with that of the ScRox1 HMG domain from residues 1 to 94. The two sequences are 50% identical and 74% conserved over this region. The most conserved region lies between the C. albicans residues 38 to 60, where 17 of the 23 residues are identical and the remainder are highly conserved substitutions. This region represents the first helix of the HMG domain that makes the majority of the specific contacts with DNA (WERNER et al. 1995 Down; DECKERT et al. 1999 Down). This region ends in a loop before the second helix which varies in length among the different HMG domain proteins (GROSSCHEDL et al. 1994 Down), and the ScRox1 protein has four additional residues in this region compared to the C. albicans Rox1. In the ScRox1, the HMG domain begins shortly after the initiation methionine and ends shortly before a run of glutamine residues, but the C. albicans protein has extensive additions at both ends. It is likely that these sequences are translated because (1) they appear in the cDNA and (2) the extension at the carboxyl end of this domain is required for Rox1 function in S. cerevisiae cells (see below).



View larger version (21K):
In this window
In a new window
Download PPT slide
 
Figure 1. Comparison of the C. albicans and S. cerevisiae Rox1-HMG domains. The C. albicans Rox1 protein sequence from residues 1 to 189 is shown in boldface type; the S. cerevisiae Rox1 sequence from residues 1 to 94 is indicated in lightface type. Identical residues are designated by a vertical line and conserved residues by a colon. The dashed lines represent four residues present in the S. cerevisiae sequence that are missing from the C. albicans protein.

The C-terminal region, which we presume contains the repression domain based upon complementation studies below, has little homology to the ScRox1 repression domain. This observation was not surprising because our previous genetic studies with the S. cerevisiae repression domain suggested that it did not require a highly conserved sequence. Rather, the region is redundant in function but not in sequence. Nonetheless, there are small pockets of sequence similarity between this region in the two Rox1 sequences, although their significance is unclear at this time.

The C. albicans ROX1 complements a rox1 deletion in S. cerevisiae:
To determine whether the cloned C. albicans gene functions as a DNA binding repressor protein, we determined its ability to complement a rox1 deletion allele in S. cerevisiae. Complementation was measured by the ability to repress the ANB1-lacZ fusion, a reporter hypoxic gene. We generated a number of constructs that tested the ability of the HMG domain, the repression domain, and the full-length protein to function in the heterologous species. As can be seen in Table 1, a construct consisting of the HMG domain from residues 38 to 199 fused to the ScRox1 repression domain and, driven by the ScROX1 promoter, was capable of repression of the reporter (line 3). However, surprisingly, a shorter region of the HMG domain, lacking residues 120 to 199 that are not present in the ScRox1 and not part of the basic HMG domain, was not capable of complementation (line 2), indicating that this region plays some important but unknown role in Rox1 DNA binding or protein stability that is not required in the ScRox1.


 
View this table:
In this window
In a new window

 
Table 1. Repression of S. cerevisiae Hypoxic genes by ScRox1-CaRox1 fusions

Also evident from Table 1, the C-terminal sequences of the C. albicans Rox1 contain a repression domain. The fusion protein containing this region joined to the ScRox1 HMG domain was able to repress the reporter gene (line 4). Therefore, despite the extensive sequence divergence, this region is still recognized as a functional repression domain in S. cerevisiae.

Finally, the intact ROX1 gene, including the regulatory sequences, complemented the rox1 deletion, demonstrating that the intact gene encodes an authentic DNA binding repressor protein (Table 1). Furthermore, the ROX1 gene did not repress anaerobic ANB1-lacZ expression. ScROX1 expression is regulated by oxygen, and constitutive expression results in both aerobic and anaerobic repression of the hypoxic genes (KENG 1992 Down). Although the anaerobic expression of the reporter gene suggested that the C. albicans promoter sequences are regulated by oxygen in S. cerevisiae, experiments detailed below demonstrate that such was not the case. The level of repression by all of the ROX1 constructs was threefold weaker than that observed for the native ScROX1 gene, and this effect was due to a second hypoxic regulator, Mot3 (see below).

The HMG domain binds to the Rox1 consensus sequence:
The cross-species complementation experiments indicated that the Rox1 HMG domain bound to the ScRox1 target site. To confirm this conclusion directly, the ability of the Rox1 HMG domain to bind the ScRox1 consensus sequence in vitro was determined. The ROX1 HMG-domain coding sequence from codons 38 to 174 was fused to the E. coli malE gene, encoding the MBP, and the fusion protein was expressed in and purified from bacterial cells. Gel retardation studies using this fusion protein indicated that the protein bound to the ScRox1 binding site (Fig 2, lanes 2, 3, and 4). Binding was specific for sequence containing the ScRox1 binding site as determined by competition with either a sequence containing two Rox1 sites of the ANB1 OpA (lane 5 and 6), which decreased the amount of labeled complex visible, or a similar sequence with a deletion of the ScRox1 binding sites (lane 7), which did not reduce the amount of labeled complex.



View larger version (35K):
In this window
In a new window
Download PPT slide
 
Figure 2. The C. albicans Rox1 HMG domain binds to the ScRox1 binding site. A gel retardation assay was performed with purified MBP-Rox1(HMG) protein. The labeled DNA fragment used was generated by annealing two complementary fragments, which left 5' single-stranded ends that were filled in with [32P]dATP(AUSUBEL et al. 2000 Down). When filled in, the sequence of the top strand was 5' GGGTTTTCAGCCCATTGTTCTCGAGCAAACC, where the sequence in boldface represents the Rox1 binding site (DECKERT et al. 1998 Down). Lane 1 contained no protein, and the nanograms of protein added to each sample are indicated above the lanes. Competitor DNAs were added to lanes 5 – 7 in the fold-excess of labeled DNA indicated. The top strand of the double-stranded specific DNA competitor sequence, OpA, was 5' TTTTTCCATTGTTCGTTGCTTGCCTGTTTTTTTGCCCTATTGTTCTCAAAA. This sequence contained two Rox1 binding sites (boldface). The nonspecific competitor, OpA{Delta}Rox1, contained the same sequence except that the underlined bases, composing the core of the Rox1 site, were deleted.

Deletion of ROX1 results in constitutive filamentous growth:
To determine whether the ROX1 gene regulates the hypoxic genes in C. albicans, it was necessary to generate a deletion strain. Since C. albicans is diploid with no known meiotic division, the deletion had to be constructed in each homologue. This was achieved by successive gene replacements using a ura3/ura3 his1/his1 strain. One copy of the gene was precisely deleted and replaced with the URA3 gene to generate the heterozygote, and then the second copy was precisely deleted and replaced with the HIS1 gene. Two independent homozygous deletion clones were obtained and, surprisingly, the colony morphology of both was quite irregular. Microscopic inspection revealed that the cells grew as hyphae in rich medium as opposed to the budding growth of the wild-type and heterozygote strains (Fig 4). Hyphal growth is normally triggered only under specific conditions, most strongly in serum (ODDS 1985 Down; Fig 3). These results suggest that ROX1 is a repressor of hyphal growth.



View larger version (78K):
In this window
In a new window
Download PPT slide
 
Figure 3. A ROX1 deletion causes hyphal growth. Cells were grown aerobically at 30°. The magnification was x400. (A) RM1000 (wild-type) cells were untransformed grown in SC medium (left), transformed with YCApROX1 and grown in SC-uracil (middle), or untransformed grown in 10% fetal calf serum (right). (B) RM1000 ROX1/rox1::URA3 heterozygotes were grown in SC medium. (C) RM1000 rox1::URA3/rox1::HIS1 mutants were grown in SC medium. (D) RM1000 rox1::HIS1/rox1::HIS1 were untransformed and grown in SC medium (left), transformed with YCApROX1 and grown in SC-uracil, and transformed with pABSK2 (Vector) and grown in SC-uracil.



View larger version (51K):
In this window
In a new window
Download PPT slide
 
Figure 4. ROX1 deletion cultures contain true hyphae. rox1::HIS1/rox1::HIS1 cells were stained with calcofluor (the right side of A and B) and photographed under the fluorescent microscope at x1000.

Given that we isolated only two homozygous deletion strains and that it had an unexpected phenotype, we attempted to reisolate the double deletion, but this time first generating the HIS1 replacement. By extraordinary luck, often better than careful experimental design, one His+ transformant had the irregular colony morphology and, when analyzed by PCR, was found to be homozygous for the HIS1 replacement. Again, these cells grew as hyphae (Fig 3). Since these cells were still ura3 auxotrophs, we transformed them with a URA3 vector carrying the wild-type ROX1 gene. These transformants reverted back to a budding growth pattern (Fig 3), although there were many cells that appeared to be initiating hyphal growth, probably due to the unstable nature of the plasmid. (Since cell growth was maintained under selective conditions, growth of those cells that lost the plasmid could not continue and give rise to hyphae.) The double deletant transformed with the vector alone remained filamentous (Fig 3). Given that independent isolates of the homozygous deletion yielded the same hyphal growth phenotype and that this phenotype could be suppressed by transforming cells with a wild-type copy of the gene, we conclude that ROX1 encodes a repressor of hyphal growth.

To determine whether the homozygous rox1 deletant formed pseudo- or true hyphae, we stained cells with calcofluor, a chitin-specific fluorescent dye that reveals the septum between true hyphal cells. As can be seen in Fig 4, the deletant culture grown on rich medium contained a mixture of cells; single budded cells, pseudohyphae (Fig 4A), and true hyphae (Fig 4A and Fig B) were all visible. The (morphological index) value for the filamentous cells shown in Fig 4B averages 3.4–3.9 with an average of 3.7, close to the value expected for true hyphae (MERSON-DAVIES and ODDS 1989 Down). It was difficult to obtain an accurate assessment of the percentages of cell types because the hyphal mat was too thick and too difficult to break apart to allow an accurate, unbiased count. The cells shown in Fig 4 represent a combination of free cells and those that broke off from the mat after vigorous mixing. Nonetheless, it was obvious that most cells were true hyphae. It is unclear why the cell type was not uniform; clearly the homozygous deletion does not display complete penetrance.

The hypoxic HEM13 gene is not regulated by Rox1, and the ROX1 gene is not regulated by oxygen or serum:
The repression of hyphal growth by Rox1 could be direct, through repression of specific genes controlling filamentation, or indirect through repression of one or more hypoxic genes that regulate hyphal growth. To test whether Rox1 represses hypoxic genes in C. albicans, we analyzed the regulation of the HEM13 gene by RT-PCR. HEM13 encodes coproporphyrinogen III oxidase and its S. cerevisiae homologue is strongly repressed by the ScRox1 (ZAGOREC et al. 1988 Down; KENG 1992 Down; AMILLET et al. 1996 Down). In addition, the C. albicans HEM13 gene contains several Rox1 binding sites in its upstream region suggesting that it may be repressed by Rox1. Cells were grown aerobically or anaerobically, RNA was prepared, cDNA generated, and the HEM13 sequences were amplified using specific probes. As a control for the efficiency of cDNA synthesis, primers that amplified a segment of the actin gene, ACT1, were included in the same reaction. The products of the two PCR reactions were different sizes, allowing the distinction between them. The results are presented in Fig 5A. While the accumulation of the HEM13 mRNA was clearly repressed in the presence of oxygen (compare lane 1 with 6), no derepression occurred aerobically in the rox1 deletion strain (compare lanes 3 and 4 with 8 and 9) as would be expected if Rox1 repressed HEM13 transcription. These results strongly suggest that Rox1 is not the hypoxic repressor in C. albicans.



View larger version (46K):
In this window
In a new window
Download PPT slide
 
Figure 5. Rox1 does not regulate the hypoxic HEM13 gene nor are ROX1 mRNA levels regulated by oxygen or serum. (A) RNA was prepared from wild-type cells (lanes 1 and 6), ROX1/rox1::URA3 heterozygotes (R1/r1-U, lanes 2 and 7), rox1::URA3/rox1::HIS1 double deletants (r1-U/r1-H, lanes 3 and 8), and rox1::HIS1/rox1::HIS1 double deletants (r1-H/r1-H, lanes 4 and 9) grown either aerobically (lanes 1–4) or anaerobically (lanes 6–9). RT-PCR was carried out to determine the levels of HEM13 and ACT1 mRNA. The gene specific primers used resulted in fragments of different sizes for the two mRNAs. Lane 5 (M) contained a 100-bp ladder as length markers. (B) RNA was prepared from wild-type cells grown either aerobically (lanes 1, 3, and 4) or anaerobically (lane 2) in YPD (lanes 1–3) or in 10% serum (lane 4). RT-PCR was carried out amplifying ACT1 mRNA and ROX1 mRNA.

The hypoxic response in S. cerevisiae cells is regulated by the transcriptional regulation of the ScROX1 gene; the gene is transcriptionally activated in the presence of oxygen and repressed in its absence. Although the C. albicans gene appeared not to be the repressor of the hypoxic genes, we determined whether its transcription was regulated by oxygen using ROX1-specific probes for RT-PCR analyses. As seen in Fig 5B, the levels of the ROX1 product were similar in the samples prepared from aerobic and anaerobic RNA indicating that ROX1 expression is not regulated by oxygen.

If Rox1 were directly involved in repressing hyphal growth, its expression might be regulated by the signals that activate filamentation. One of the most potent activators is serum as seen in Fig 3. Therefore, we analyzed the accumulation of ROX1 mRNA in cells grown with and without fetal calf serum by RT-PCR. As is evident from the results presented in Fig 5B, there was no effect of serum on ROX1 RNA levels, suggesting that repressor function may be regulated at the level of translational or protein stability, activity, or compartmentalization.

The oxygen regulation of Rox1 hypoxic gene repression in S. cerevisiae is mediated by Mot3 and is Tup1dependent:
The results above presented the paradox that the C. albicans Rox1 expressed from its own promoter appeared to regulate the hypoxic genes in S. cerevisiae, implying that the gene was regulated by oxygen as is the ScROX1, but it was not regulated by oxygen in its native cell. It seemed unlikely that the whole heme-dependent regulatory scheme that operates in S. cerevisiae was bent to an alternative use in C. albicans, especially since the C. albicans HEM13 gene was regulated by oxygen. Therefore, we sought an alternative explanation.

Operator A, which is responsible for the bulk of the repression of the hypoxic S. cerevisiae ANB1 gene, contains two binding sites for Rox1 and a site for a second protein, Mot3 (KASTANIOTIS et al. 2000 Down). While ScRox1 is absolutely required for repression, Mot3 contributes only weakly. Mot3 and Rox1 do not bind cooperatively, but rather Mot3 appears to help in a downstream step in repression. MOT3, like ScROX1, is regulated by oxygen (C. LOWRY, personal communication; A. KASTANIOTIS and R. ZITOMER, unpublished results). We speculated that since the C. albicans Rox1 was a weak repressor in the heterologous host, perhaps it is much more dependent on Mot3. In that case, oxygen regulation of ANB1 would be observed even if the C. albicans gene was expressed constitutively, since Mot3 concentrations are lower in aerobically grown cells. To test this possibility, we determined the ability of the intact C. albicans ROX1 gene to repress ANB1-lacZ expression in a rox1, mot3 double deletion strain (MZ22-4{Delta}r1{Delta}m3). In this strain transformed with the S. cerevisiae ROX1 plasmid (YCp(22)ROX1H) the aerobic ANB1-lacZ expression resulted in 10.8 units of ß-galactosidase compared to 126 units in the same strain transformed with the vector (YCplac22). However, when transformed with the C. albicans gene (YCp(22)Ca-ROX1), the double deletant expressed only 103 units of ß-galactosidase. Thus, unlike the ScRox1, the C. albicans Rox1 required Mot3 for repression. Furthermore, RT-PCR analysis indicated that the C. albicans ROX1 mRNA levels were not regulated by oxygen in S. cerevisiae (results not shown). Thus results demonstrate that oxygen regulation of ANB1-lacZ by the heterologous ROX1 gene does not require oxygen regulation of the C. albicans gene in S. cerevisiae.

Finally, to determine whether repression by the C. albicans Rox1 was dependent on the general repressor Tup1 in S. cerevisiae, we measured the expression of the ANB1-lacZ fusion in the rox1{Delta} tup1{Delta} strain MZ22-4PC transformed with YCp(33)CaROX1 or the empty vector. The presence of CaROX1 resulted in only a 1.7-fold repression in this strain compared to the 5.5-fold repression in the congenic TUP1 wild-type strain (Table 1). Therefore, repression by the C. albicans Rox1 is Tup1 dependent.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We report here the identification of a gene encoding an HMG-containing DNA binding repressor of hyphal growth from C. albicans. The evidence for these conclusions is as follows. The protein sequence is very similar within its HMG domain to that of the Rox1 repressor of S. cerevisiae and, when expressed in and purified from bacterial cells, this C. albicans HMG domain was capable of specific binding to DNA. The gene complemented a S. cerevisiae ROX1 deletion to repress the expression of an hypoxic reporter gene, indicating that the protein has repressor activity. Finally, the deletion of the gene in C. albicans results in constitutive hyphal growth. Given this last finding, combined with the lack of effect of the deletion on the regulation of the C. albicans HEM13 hypoxic gene, it appears inappropriate to continue to refer to this gene as ROX1, the homologue of the S. cerevisiae hypoxic repressor gene. We propose the name RFG1, Repressor of Filamentous Growth.

The transition from budding growth to the invasive, hyphal growth in C. albicans is believed to be an important aspect of the organism's pathogenicity, and a great deal of research has focused on how this transition is regulated (reviewed in CORNER and MAGEE 1997 Down; KOBAYASHI and CUTLER 1998 Down; MITCHELL 1998 Down; BROWN et al. 2000 Down). There appear to be two parallel signal transduction pathways that positively regulate the expression of genes required for filamentation. A mitogen-activated protein kinase cascade activates the transcriptional activator Cph1, and a cAMP-Ras pathway activates the transcriptional activator Efg1. A mutation in either results in a loss of hyphal growth induced by some stimuli, but not by others. Only the double deletion results in an almost complete loss of hyphal growth (LO et al. 1997 Down). In addition to this positive regulation, the ability of cells to undergo hyphal growth is under negative regulation. Deletion of the TUP1 gene results in constitutive hyphal growth, perhaps in response to a third pathway (BRAUN and JOHNSON 1997 Down, BRAUN and JOHNSON 2000 Down). The role of the S. cerevisiae Tup1 protein in repression has been extensively studied. It associates with Ssn6 to form a general repression complex that is required for the repression of genes in a number of diverse regulons. The complex has no intrinsic DNA binding activity, but rather is recruited to target genes by a regulon-specific DNA binding protein. The activity or expression of each regulon-specific repressor is regulated to determine under what conditions repression occurs. Thus, for example, the hypoxic genes are repressed under aerobic conditions only because Rox1 is synthesized only when oxygen is present, and, therefore, Tup1/Ssn6 can be recruited to the hypoxic genes only under aerobic conditions. The role of Tup1 in C. albicans is likely to be similar; the C. albicans TUP1 gene can complement a TUP1 deletion in S. cerevisiae, and the expression of a number of genes in C. albicans is induced upon deletion of TUP1 consistent with a role of a transcriptional repressor (BRAUN et al. 2000 Down; BRAUN and JOHNSON 1997 Down).

By analogy to S. cerevisiae then, we propose that Rfg1 is the regulon-specific DNA binding protein that recruits Tup1 to the filamentation genes for the following reasons. First, deletion of RFG1 results in a similar filamentous growth phenotype as reported for the deletion of TUP1. However, it should be mentioned that the tup1 double deletant grows mostly as pseudohyphal cells on rich media (BRAUN and JOHNSON 1997 Down), while the rfg1 double deletant contained a great deal of true hyphae. This difference may mirror the incomplete derepression of hypoxic genes seen in a TUP1 deletion compared to a ROX1 deletion in S. cerevisiae (BALASUBRAMANIAN et al. 1993 Down; DECKERT et al. 1995B Down). Second, Rfg1 is a sequence-specific DNA binding protein. Third, Rfg1 repressed the hypoxic genes in S. cerevisiae and this repression required Tup1, indicating that Rfg1 can interact with a Tup1-like general repressor. Also, we demonstrated that Rfg1 function required Mot3. Mot3's role in enhancing repression by Rox1 does not involve cooperative binding, but rather helps in either the recruitment or function of the Tup1/Ssn6 complex. Mot3 is not capable of repression in the absence of Rox1, indicating that it is not capable of Tup1/Ssn6 recruitment (or function) on its own. Therefore, since Rfg1 repression of the hypoxic reporter gene in S. cerevisiae was Mot3 dependent, it is likely that repression was also Tup1 dependent. Thus, Rfg1 appears to fulfill many of the criteria that would be predicted for the regulon-specific DNA binding protein that recruits Tup1 to the hyphal growth genes.

It is not clear at this point how Rfg1 activity is regulated. We found that RFG1 mRNA accumulated during hyphal growth in serum, indicating that transcription is not regulated. Regulation might occur at any subsequent step, including translation or protein function or localization. The HMG domain of Rfg1 contains extensive sequences at both the amino and carboxyl ends that are not present in ScRox1, and either of these regions could be targets of control, as could the repression domain. Alternatively, there may be other proteins involved in the repression of the filamentation genes whose synthesis or activity is regulated. Further studies are required to resolve this question.

Finally the question remains as to how the hypoxic genes of C. albicans are regulated. We demonstrated that HEM13 is repressed by oxygen, strongly suggesting that a hypoxic regulon exists in this yeast. However, we have also clearly demonstrated that the Rfg1 protein is not the hypoxic repressor despite its similarity to the S. cerevisiae Rox1 protein, at least in the HMG domain. We cannot rule out the existence of a second gene encoding an HMG-domain repressor protein in the C. albicans genome, although it has not been revealed by the sequence data yet. Alternatively, these genes may be regulated by Mot3 or a novel DNA binding protein.


*  ACKNOWLEDGMENTS

We thank Drs. G. R. Fink and P. T. Magee for the C. albicans libraries and Drs. H. Chibana and A. Mitchell for the plasmids and strains. Many of the findings reported here have also been discovered by Drs. D. Kadosh and A. Johnson, and their results have been prepared for publication. We thank them for sharing their results with us. They originally proposed the name RFG1, and we have adopted it to avoid needless confusion in the literature. These studies were supported by grant GM-26061 from the National Institutes of Health.

Manuscript received November 6, 2000; Accepted for publication January 8, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAMS, A. E. and J. R. PRINGLE, 1991  Staining of actin with fluorochrome-conjugated phalloidin. Methods Enzymol. 194:729-731[Medline].

AMILLET, J. M., N. BUISSON, and R. LABBE-BOIS, 1996  Characterization of an upstream activation sequence and two Rox1p-responsive sites controlling the induction of the yeast HEM13 gene by oxygen and heme deficiency. J. Biol. Chem. 271:24425-24432[Abstract/Free Full Text].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 2000 Current Protocols in Molecular Biology. John Wiley & Sons, New York.

BALASUBRAMANIAN, B., C. V. LOWRY, and R. S. ZITOMER, 1993  The Rox1 repressor of the Saccharomyces cerevisiae hypoxic genes is a specific DNA-binding protein with a high-mobility-group motif. Mol. Cell. Biol. 13:6071-6078[Abstract/Free Full Text].

BRAUN, B. R. and A. D. JOHNSON, 1997  Control of filament formation in Candida albicans by the transcriptional repressor TUP1. Science 277:105-109[Abstract/Free Full Text].

BRAUN, B. R. and A. D. JOHNSON, 2000  TUP1, CPH1 and EFG1 make independent contributions to filamentation in Candida albicans. Genetics 155:57-67[Abstract/Free Full Text].

BRAUN, B. R., W. S. HEAD, M. X. WANG, and A. D. JOHNSON, 2000  Identification and characterization of TUP1-regulated genes in Candida albicans. Genetics 156:31-44[Abstract/Free Full Text].

BROWN, A. J., C. J. BARELLE, S. BUDGE, J. DUNCAN, and S. HARRIS et al., 2000  Gene regulation during morphogenesis in Candida albicans. Contrib. Microbiol. 5:112-125[Medline].

CORNER, B. E. and P. T. MAGEE, 1997  Candida pathogenesis: unravelling the threads of infection. Curr. Biol. 7:R691-R694[Medline].

DECKERT, J., R. PERINI, B. BALASUBRAMANIAN, and R. S. ZITOMER, 1995a  Multiple elements and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces cerevisiae. Genetics 139:1149-1158[Abstract].

DECKERT, J., A. M. RODRIGUEZ TORRES, J. T. SIMON, and R. S. ZITOMER, 1995b  Mutational analysis of Rox1, a DNA-bending repressor of hypoxic genes in Saccharomyces cerevisiae. Mol. Cell Biol. 15:6109-6117[Abstract].

DECKERT, J., A. M. TORRES, S. M. HWANG, A. J. KASTANIOTIS, and R. S. ZITOMER, 1998  The anatomy of a hypoxic operator in Saccharomyces cerevisiae. Genetics 150:1429-1441[Abstract/Free Full Text].

DECKERT, J., R. A. KHALAF, S. M. HWANG, and R. S. ZITOMER, 1999  Characterization of the DNA binding and bending HMG domain of the yeast hypoxic repressor Rox1. Nucleic Acids Res. 27:3518-3526[Abstract/Free Full Text].

ELLEDGE, S. J., Z. ZHOU, J. B. ALLEN, and T. A. NAVAS, 1993  DNA damage and cell cycle regulation of ribonucleotide reductase. Bioessays 15:333-339[Medline].

FRIESEN, H., S. R. HEPWORTH, and J. SEGALL, 1997  An Ssn6-Tup1-dependent negative regulatory element controls sporulation-specific expression of DIT1 and DIT2 in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:123-134[Abstract].

GIETZ, R. D. and A. SUGINO, 1988  New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534[Medline].

GROSSCHEDL, R., K. GIESE, and J. PAGEL, 1994  HMG domain proteins: architectural elements in the assembly of nucleoprotein structures. Trends Genet. 10:94-100[Medline].

KAISER, C., S. MICHAELIS and A. MITCHELL, 1994 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

KASTANIOTIS, A. J. and R. S. ZITOMER, 2000  Rox1 mediated repression: oxygen dependent repression in yeast. Adv. Exp. Med. Biol. 475:185-195[Medline].

KASTANIOTIS, A. J., T. A. MENNELLA, C. KONRAD, A. M. TORRES, and R. S. ZITOMER, 2000  Roles of transcription factor Mot3 and chromatin in repression of the hypoxic gene ANB1 in yeast. Mol. Cell Biol. 20:7088-7098[Abstract/Free Full Text].

KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992  Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].

KENG, T., 1992  HAP1 and ROX1 form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 12:2616-2623[Abstract/Free Full Text].

KOBAYASHI, S. D. and J. E. CUTLER, 1998  Candida albicans hyphal formation and virulence: Is there a clearly defined role? Trends Microbiol. 6:92-94[Medline].

LO, H. J., J. R. KOHLER, B. DIDOMENICO, D. LOEBENBERG, and A. CACCIAPUOTI et al., 1997  Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949[Medline].

LOWRY, C. V. and R. S. ZITOMER, 1984  Oxygen regulation of anaerobic and aerobic genes mediated by a common factor in yeast. Proc. Natl. Acad. Sci. USA 81:6129-6133[Abstract/Free Full Text].

MARQUEZ, J. A., A. PASCUAL-AHUIR, M. PROFT, and R. SERRANO, 1998  The Ssn6-Tup1 repressor complex of Saccharomyces cerevisiae is involved in the osmotic induction of HOG-dependent and -independent genes. EMBO J. 17:2543-2553[Medline].

MERSON-DAVIES, L. A. and F. C. ODDS, 1989  A morphology index for the characterization of cell shape in Candida albicans. J. Gen. Microbiol. 135:3143-3152[Medline].

MITCHELL, A. P., 1998  Dimorphism and virulence in Candida albicans. Curr. Opin. Microbiol. 1:687-692[Medline].

MIZUNO, T., N. NAKAZAWA, P. REMGSAMRARN, T. KUNOH, and Y. OSHIMA et al., 1998  The Tup1-Ssn6 general repressor is involved in repression of IME1 encoding a transcriptional activator of meiosis in Saccharomyces cerevisiae. Curr. Genet. 33:239-247[Medline].

MUKAI, Y., S. HARASHIMA, and Y. OSHIMA, 1991  AAR1/TUP1 protein, with a structure similar to that of the beta subunit of G proteins, is required for a1-alpha 2 and alpha 2 repression in cell type control of Saccharomyces cerevisiae. Mol. Cell Biol. 11:3773-3779[Abstract/Free Full Text].

NEGREDO, A., L. MONTEOLIVA, C. GIL, J. PLA, and C. NOMBELA, 1997  Cloning, analysis and one-step disruption of the ARG5,6 gene of Candida albicans. Microbiology 143(2):297-302[Medline].

ODDS, F. C., 1985  Morphogenesis in Candida albicans. Crit Rev. Microbiol. 12:45-93[Medline].

TEUNISSEN, A. W., J. A. VAN DEN BERG, and H. Y. STEENSMA, 1995  Transcriptional regulation of flocculation genes in Saccharomyces cerevisiae. Yeast 11:435-446[Medline].

TREITEL, M. A. and M. CARLSON, 1995  Repression by SSN6–TUP1 is directed by MIG1, a repressor/activator protein. Proc. Natl. Acad. Sci. USA 92:3132-3136[Abstract/Free Full Text].

TZAMARIAS, D. and K. STRUHL, 1994  Functional dissection of the yeast Cyc8-Tup1 transcriptional co-repressor complex. Nature 369:758-761[Medline].

TZAMARIAS, D. and K. STRUHL, 1995  Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. Genes Dev. 9:821-831[Abstract/Free Full Text].

WERNER, M. H., J. R. HUTH, A. M. GRONENBORN, and G. M. CLORE, 1995  Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell 81:705-714[Medline].

WILLIAMS, F. E., U. VARANASI, and R. J. TRUMBLY, 1991  The CYC8 and TUP1 proteins involved in glucose repression in Saccharomyces cerevisiae are associated in a protein complex. Mol. Cell. Biol. 11:3307-3316[Abstract/Free Full Text].

WILSON, R. B., D. DAVIS, and A. P. MITCHELL, 1999  Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181:1868-1874[Abstract/Free Full Text].

ZAGOREC, M., J. M. BUHLER, I. TREICH, T. KENG, and L. GUARENTE et al., 1988  Isolation, sequence, and regulation by oxygen of the yeast HEM13 gene coding for coproporphyrinogen oxidase. J. Biol. Chem. 263:9718-9724[Abstract/Free Full Text].

ZHANG, M., L. S. ROSENBLUM-VOS, C. V. LOWRY, K. A. BOAKYE, and R. S. ZITOMER, 1991  A yeast protein with homology to the beta-subunit of G proteins is involved in control of heme-regulated and catabolite-repressed genes. Gene 97:153-161[Medline].

ZITOMER, R. S. and C. V. LOWRY, 1992  Regulation of gene expression by oxygen in Saccharomyces cerevisiae. Microbiol. Rev. 56:1-11[Abstract/Free Full Text].

ZITOMER, R. S., P. CARRICO, and J. DECKERT, 1997  Regulation of hypoxic gene expression in yeast. Kidney Int. 51:507-513[Medline].




This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
J. M. Rauceo, J. R. Blankenship, S. Fanning, J. J. Hamaker, J.-S. Deneault, F. J. Smith, A. Nantel, and A. P. Mitchell
Regulation of the Candida albicans Cell Wall Damage Response by Transcription Factor Sko1 and PAS Kinase Psk1
Mol. Biol. Cell, July 1, 2008; 19(7): 2741 - 2751.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
B. W. Kebaara, M. L. Langford, D. H. M. L. P. Navarathna, R. Dumitru, K. W. Nickerson, and A. L. Atkin
Candida albicans Tup1 Is Involved in Farnesol-Mediated Inhibition of Filamentous-Growth Induction
Eukaryot. Cell, June 1, 2008; 7(6): 980 - 987.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Banerjee, D. S. Thompson, A. Lazzell, P. L. Carlisle, C. Pierce, C. Monteagudo, J. L. Lopez-Ribot, and D. Kadosh
UME6, a Novel Filament-specific Regulator of Candida albicans Hyphal Extension and Virulence
Mol. Biol. Cell, April 1, 2008; 19(4): 1354 - 1365.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
Y. Li, C. Su, X. Mao, F. Cao, and J. Chen
Roles of Candida albicans Sfl1 in Hyphal Development
Eukaryot. Cell, November 1, 2007; 6(11): 2112 - 2121.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
S. Biswas, P. Van Dijck, and A. Datta
Environmental Sensing and Signal Transduction Pathways Regulating Morphopathogenic Determinants of Candida albicans
Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 348 - 376.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
S. M. Mulhern, M. E. Logue, and G. Butler
Candida albicans Transcription Factor Ace2 Regulates Metabolism and Is Required for Filamentation in Hypoxic Conditions
Eukaryot. Cell, December 1, 2006; 5(12): 2001 - 2013.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
D. Kadosh and A. D. Johnson
Induction of the Candida albicans Filamentous Growth Program by Relief of Transcriptional Repression: A Genome-wide Analysis
Mol. Biol. Cell, June 1, 2005; 16(6): 2903 - 2912.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
L. G. Klinkenberg, T. A. Mennella, K. Luetkenhaus, and R. S. Zitomer
Combinatorial Repression of the Hypoxic Genes of Saccharomyces cerevisiae by DNA Binding Proteins Rox1 and Mot3
Eukaryot. Cell, April 1, 2005; 4(4): 649 - 660.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
M. Bassilana, J. Hopkins, and R. A. Arkowitz
Regulation of the Cdc42/Cdc24 GTPase Module during Candida albicans Hyphal Growth
Eukaryot. Cell,