- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Abramova, N. E.
- Articles by Lowry, C. V.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Abramova, N. E.
- Articles by Lowry, C. V.
Regulatory Mechanisms Controlling Expression of the DAN/TIR Mannoprotein Genes During Anaerobic Remodeling of the Cell Wall in Saccharomyces cerevisiae
Natalia E. Abramova1,a, Brian D. Cohen1,b, Odeniel Sertila, Rachna Kapoora, Kelvin J. A. Daviesc, and Charles V. Lowryaa Center for Immunology and Microbial Disease, Albany Medical College, Albany, New York 12203,
b Laboratory of Reproductive & Metabolic Disorders, Wadsworth Center, Albany, New York 12201-2002
c The Andrus Gerontology Center, University of Southern California, Los Angeles, California 90089-0191
Corresponding author: Charles V. Lowry, Center for Immunology and Microbial Disease, Albany Medical College MC-151, 47 New Scotland Ave., Albany, NY 12203., cvlowry{at}aol.com (E-mail)
Communicating editor: M. JOHNSTON
| ABSTRACT |
|---|
The DAN/TIR genes of Saccharomyces cerevisiae encode homologous mannoproteins, some of which are essential for anaerobic growth. Expression of these genes is induced during anaerobiosis and in some cases during cold shock. We show that several heme-responsive mechanisms combine to regulate DAN/TIR gene expression. The first mechanism employs two repression factors, Mox1 and Mox2, and an activation factor, Mox4 (for mannoprotein regulation by oxygen). The genes encoding these proteins were identified by selecting for recessive mutants with altered regulation of a dan1::ura3 fusion. MOX4 is identical to UPC2, encoding a binucleate zinc cluster protein controlling expression of an anaerobic sterol transport system. Mox4/Upc2 is required for expression of all the DAN/TIR genes. It appears to act through a consensus sequence termed the AR1 site, as does Mox2. The noninducible mox4
allele was epistatic to the constitutive mox1 and mox2 mutations, suggesting that Mox1 and Mox2 modulate activation by Mox4 in a heme-dependent fashion. Mutations in a putative repression domain in Mox4 caused constitutive expression of the DAN/TIR genes, indicating a role for this domain in heme repression. MOX4 expression is induced both in anaerobic and cold-shocked cells, so heme may also regulate DAN/TIR expression through inhibition of expression of MOX4. Indeed, ectopic expression of MOX4 in aerobic cells resulted in partially constitutive expression of DAN1. Heme also regulates expression of some of the DAN/TIR genes through the Rox7 repressor, which also controls expression of the hypoxic gene ANB1. In addition Rox1, another heme-responsive repressor, and the global repressors Tup1 and Ssn6 are also required for full aerobic repression of these genes.
SACCHAROMYCES cerevisiae cells adapt to anaerobic growth by inducing expression of a surprisingly large number of genes (called "anaerobic genes," ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We find that anaerobic expression of the DAN/TIR genes depends on a common transcriptional activator, Mox4 (for mannoprotein regulation by oxygen). We have found that MOX4 is identical to UPC2 (![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Plasmids and libraries:
YCpD/U was constructed by amplifying the URA3 gene using the primers AGACGGATCCCTCGAAAGCTACATATAAGGAACG and GAGAGAATTCACTAGTCCGTCATTATAAAAATCATTACGACC, which contain 5' BamHI and SpeI sites, respectively. The PCR product was digested with BamHI and SpeI and ligated to the same sites in YCpD/Z(22) (![]()
YIpD/Z:
An integrating plasmid carrying the dan1::lacZ fusion was derived from YCpD/Z(22) by excising the fusion fragment with EcoRI and HindIII and ligating to the EcoRI and HindIII sites of YIplac128 (![]()
A plasmid library containing 5- to 10-kb fragments of the yeast genome carried on a centromeric TRP1 vector was constructed in the pCL6 vector, which was derived from the plasmid YCpCYC1(2.4) (![]()
Plasmids (AR1)3/MEL1, AR2/MEL1, and D0-BST are described elsewhere (![]()
MOX4/UPC2 plasmids:
pCL6(MOX4), cloned from the plasmid library, contained YDR213w (MOX4/UPC2) and YDR214w; the cloned segment included only part of the MOX4 promoter (up to -259). The region from -259 to +2835 was excised with XbaI and NruI and ligated to the SmaI and XbaI sites in the polylinker of pUC19(HxSx) to generate pUC(MOX4); in this derivative of pUC19 the HindIII and SalI sites had been destroyed by end-filling. The same NruI-XbaI fragment of MOX4 was also cloned into the same sites in YCpLac22 to generate YCpMOX4
p. To clone the full promoter region a PCR fragment generated with primers homologous at -865 (CCAAAGAAGATCCGCACG) and at +174 (CCTTGGATCCTCTTCTTCTTTTACAGTTATCGC) was digested with PmlI (site at -694) and BamHI (site in primer) and ligated to YCpLac22, which had been digested with EcoRI, end-filled, and digested with BamHI; the resulting plasmid, YCppMOX4, contains the region from -694 to +174. The segment of MOX4 from +112 to +2835 was excised with AgeI and XbaI and ligated to the same sites in YCppMOX4, generating the centromeric expression plasmid YCpMOX4. To construct YCpmox4::lacZ a promoter fragment was amplified from genomic DNA with the -865 primer and another primer homologous at +3 (AGAGGGATCCATACTGCTGAACTGTAAATATTTGTAC) containing a BamHI site. The PmlI-BamHI fragment was inserted 5' to the lacZ open reading frame carried in YCpdan1::lacZ (![]()
AR1/lacZ the 5' portion of the promoter was amplified using the -865 primer and a primer homologous at -361 containing an AgeI site, GAGAACCGGTAGAAAAAAATAGCTTGGAAAAAAC. A 3' promoter fragment was amplified using a primer homologous at -349 containing an AgeI site, GAGAACCGGTCCTTGCACCTTAGCGGGATCG/ (homologous at -349), and the +3 primer. The following fragments were ligated together: the 5' fragment, digested with EcoRI and AgeI; the 3' fragment, digested with AgeI and BamHI; and YCpmox4::lacZ, digested with EcoR1 and BamHI. In the resulting construct the sequence beginning at -359 CTAAACGAGC (containing an inverted AR1 consensus sequence) is replaced by ACCGGTCCTT. To generate the G888D (upc2-1) (![]()
A substitution in the + strand (nt +2663) results in the G888D substitution and the C
G substitution in the - strand (nt +2663) results in a G888A substitution. Both alleles were recovered in segregating plasmids isolated from bacterial transformants; the mutant fragments were then excised with AgeI and XbaI and ligated to the same sites in YCpMOX4 to generate YCpMOX4(upc2-1) and YCpMOX4(G888A). To construct YCpgal1::mox4, the MOX4 ORF (-17 to +2765) was excised from pCL6(MOX4) with SspI and inserted into the end-filled Acc65I and BamHI sites of YCpGAL1/OLE1 (a fusion of the GAL1 promoter to the OLE1 ORF (S. MEHTA, N. E. ABRAMOVA, R. D. ANAND and C. V. LOWRY, unpublished data), placing the MOX4 ORF between -9 of GAL1 and +1379 of OLE1.
Gene disruptions:
ptup1
:URA3: The TUP1 gene was amplified by PCR using primers TGCACTAGTACACAAATAAATAAACCAGGAAAGC and TCGGTCGACTAGAGAACCAGCAGCGATG, digested with SpeI and SalI, and inserted into the corresponding sites in the plasmid pBluescriptSK+/- (Stratagene, La Jolla, CA), generating PBS-TUP1. The TUP1 disruption plasmid was created by inserting the URA3 gene as a BglII-SmaI fragment from pNK51 (![]()
pmox4
::ura3:
To generate a MOX4 disruption construct, the region between the BglII site of MOX4 (+2254) and the MunI site in the TRP1 gene was deleted from YCpMOX4 by digestion with those enzymes and end-filling the BglII site, leaving a 1.6-kb 3' fragment of MOX4 joined to the vector backbone; this was ligated to the URA3 gene, which had been excised from the plasmid pBS-URA3 as a MunI-SmaI fragment, generating pURA-MOX-3'. pBS-URA3 contains the URA3 gene (-939 to +2772) inserted into the EcoRI and SalI sites of pBS-SK as an EcoRI-SalI-digested PCR fragment generated with primers containing those sites. The region between -460 and +1 of MOX4 was amplified by PCR using primers homologous at those points containing AatII and MunI sites, respectively, digested with those enzymes, and ligated to the same sites in pURA-MOX-3'. The resulting construct contained the URA3 gene flanked by 5' and 3' segments of MOX4, and this segment was excised with AatII and XbaI for transformation.
Cell growth and analysis of gene expression:
For ß-galactosidase assays (![]()
-galactosidase assays, which were more reproducible than ß-galactosidase assays at low levels, cells were grown as described above and assayed as described (![]()
![]()
Strains and mutant isolation:
Yeast strains used were FY23 (![]()
![]()
![]()
Cloning of MOX4:
The MOX4 gene was cloned by complementation of the mox4 mutation with a plasmid library. For selection a construct containing a fusion of the DAN1 promoter to the HIS3 gene was integrated into the mox4-1 strain on YIpdan1::his3. Cells of this strain were transformed with the pCL6 library and selected for growth on -trp plates. Transformants were pooled and replated on SD-his plates containing Tween 80 and ergosterol and grown under anaerobic conditions. Plasmids recovered from his+ colonies were sequenced and found to contain ORFs YRD213W and YRD214W. The segment containing YRD213W was subcloned into YCplac22, generating YCpMOX4
p, and was found to complement the mox4 mutation.
| RESULTS |
|---|
A common activation factor defines the DAN/TIR regulon:
Expression of DAN1 is inhibited by heme, which is synthesized only in aerobic cells (![]()
|
Mox4 is Upc2, a zinc cluster transcriptional activator:
We cloned MOX4 from a genomic DNA library by complementation of the noninducible mox4 phenotype (see MATERIALS AND METHODS), using a dan1::his3 fusion to select for restoration of DAN1 expression. The complementing gene was localized to UPC2 (YDR213w), which encodes a factor regulating expression of a system that transports sterols during anaerobic growth (![]()
![]()
We confirmed the role of Mox4/Upc2 as a transcriptional activator of the DAN/TIR regulon by testing the phenotype of cells carrying a mox4
allele; loss of Mox4 caused drastically reduced anaerobic expression of the dan1::lacZ fusion as well as of DAN1 mRNA (Fig 2) and several other DAN/TIR mRNAs.
|
Identification of repression factors affecting aerobic expression of the DAN/TIR genes:
To identify repressors of anaerobic genes, we sought mutants constitutive for expression of DAN1. Such mutations were expected to cause defective aerobic repression of the dan1::ura3 fusion, permitting growth on SD-ura plates. Using this selection we obtained Ura+ isolates, which also showed elevated aerobic expression of the dan1::lacZ fusion, as well as increased levels of DAN1 mRNA in aerobic cells (Fig 3A). As expected, this group included heme-deficient mutants (see MATERIALS AND METHODS) and flocculent tup1 and ssn6 isolates, which were disregarded. Among the remaining isolates we identified three complementation groups, designated mox1, mox2, and rox7. All were recessive, apparently affecting repression factors, and all three mutations segregated 2:2 in backcrosses to wild type. Identification of Mox1, Mox2, and Rox7 confirmed that there are negative controls that counteract activation by Mox4. The mox1 and mox2 mutations caused increased aerobic expression of DAN1 and several other dan/tir genes, but not of hypoxic genes. In contrast rox7 mutations caused partially constitutive expression of some, but not all, members of both regulons (Fig 3A). The effect of the mox1 and mox2 mutations was much more pronounced on some genes in the regulon than on others (e.g., DAN4 vs. DAN1), suggesting that for some of these genes redundant repression mechanisms might be at work.
|
Mox factors act through the AR1 activation sequence:
We report elsewhere that all of the DAN/TIR genes contain at least one AR1 sequence (for "anaerobic response," TCGTTYAG) and that this site is sufficient to drive expression when fused to a reporter, e.g., in the (AR1)3/MEL1 construct (![]()
![]()
|
Since mox1 and mox2 mutations caused constitutive expression of several DAN/TIR genes, but not of the two hypoxic genes (Fig 3A), it seemed that Mox1 and Mox2 might only regulate genes with AR1 sites. To test this we compared expression from the (AR1)3/MEL1 plasmid in aerobically grown mox2 cells with that in wild-type cells. Aerobic expression was well above that in the control cells (Fig 4B), indicating that Mox2 is needed for repression of expression driven from the AR1 sites. At the same time the mox2 mutation caused no increase in aerobic expression from the AR2 reporter plasmid, showing that Mox2 repression is specific for activation from the AR1 site.
Mox4 acts downstream from Mox1 and Mox2:
Mox4 could be a transcriptional activator of DAN1, or it could activate anaerobic gene expression indirectly, by blocking expression or function of Mox1 and Mox2. The fact that a mox4 deletion is epistatic to mox1 and mox2 mutations (Table 1) rules out the latter possibility.
|
Evidence for a regulatory domain in Mox4/Upc2:
The UPC2-1 (MOX4-1) allele is a G888D substitution that causes a dominant sterol transport proficiency in aerobic cells (![]()
asp mutation appeared to pinpoint a regulatory region in Mox4/Upc2, presumably a domain that interacts with an inhibitory ligand or repression factor. To see if this domain participates in repression of the DAN/TIR genes we tested the effect of the G888D substitution and another more conservative one, G888A, on regulation of DAN1, DAN4, and TIR4 expression; both mutations caused increased aerobic expression of DAN1 (Fig 5). As had been observed for the UPC2-1 allele (![]()
|
Regulation of MOX4 expression:
We analyzed expression of the MOX4 gene in FY23 cells to determine whether expression of the DAN/TIR genes is controlled by modulation of Mox4 levels. MOX4 mRNA was 510 times more abundant in anaerobic cells than in aerobic cells and also in cells subjected to cold shock (Fig 6A), suggesting that induction of expression of the activator contributes to induction of the DAN/TIR genes under these conditions (see DISCUSSION). Expression was partially inhibited by addition of heme to an anaerobic culture of RZ53 cells, indicating that heme is a regulatory co-effector signaling the presence of oxygen, although there may be another signal involved as well (Fig 6B). (RZ53 cells were used in this experiment because they were more sensitive to exogenous heme than FY23 cells.) Expression from a mox4::lacZ promoter fusion was also induced to
10 times higher levels in anaerobic cells, indicating that the increase in MOX4 mRNA levels results from transcriptional activation (Table 2). The MOX4 promoter contains an AR1 site, ablation of which causes a threefold decrease in gene expression. This implies that transcription of MOX4 is positively autoregulated, but the limited effect suggests that other factors are involved in activation.
|
|
Ectopic expression of Mox4 under the control of the GAL1 promoter causes significant accumulation of DAN1 mRNA (Fig 6C); hence the presence of elevated levels of the activator are sufficient to partially overcome heme inhibition in aerobic cells.
Rox7 regulates genes from both the hypoxic and DAN/TIR regulons:
Since the hypoxic and DAN/TIR regulons are controlled by distinct mechanisms it was interesting that rox7 mutations cause substantial constitutive expression of genes from both groups (Fig 3A). Rox1 was thought earlier to be solely responsible for repression of ANB1, assisted by the Tup1/Ssn6 corepressor complex. The isolation of several rox7 mutants with the same phenotype made it unlikely that the constitutive effects on both DAN1 and ANB1 expression resulted from mutations affecting more than one locus. To be certain we crossed the rox7 mutant with the nearly isogenic FY23 and scored segregants in 10 tetrads for constitutive expression of the two genes; each haploid isolate was constitutive for both ANB1 and DAN1 (data not shown). As reported elsewhere (O. SERTIL, R. KAPOOR, B. D. COHEN and C. V. LOWRY, unpublished results) we have found that ROX7 is identical to MOT3 (![]()
![]()
![]()
![]()
![]()
![]()
Combinatorial repression of individual DAN/TIR genes by at least six repression factors:
Several yeast genes are stringently controlled by a single repression mechanism, which in many cases is assisted by the Tup1/Ssn6 general repression complex (![]()
, ssn6
, and rox1
mutations. Each of these mutations caused defects in aerobic repression of some or all of the DAN/TIR genes (Fig 3); this indicated that the six repression factors involved, Mox1, Mox2, Rox7, Rox1, Tup1, and Ssn6, act in combinatorial fashion to maintain aerobic repression. However, the relative importance of each repression factor differed from gene to gene:
- The mox1 and mox2 mutations caused almost fully constitutive expression of TIR1, TIR3, TIR4, and DAN4; a slight effect on DAN1 and DAN3; and no detectable effect on DAN2. The effects of the two mutations varied in parallel, suggesting that Mox1 and Mox2 act together.
- The rox7 mutation caused varying degrees of constitutive expression of DAN1, DAN4, TIR1, TIR3, and TIR4, as well as constitutive expression of ANB1, but had no effect on expression of DAN2 or DAN3.
- The effects of tup1 and ssn6 mutations also varied greatly both from gene to gene and relative to each other; notably DAN3, TIR2, and TIR4 showed a particularly strong dependence on Tup1 for repression.
- Finally, the rox1 deletion caused a mild loss of repression of some of the dan/tir genes, contrasting with fully constitutive expression of the hypoxic genes, which are defined by their response to Rox1 (
LOWRY et al. 1990 ).
| DISCUSSION |
|---|
We have identified a set of factors that regulate and define the DAN/TIR regulon. Mox4 is an essential activator of this regulon, and Mox1 and Mox2 are repression factors. An epistasis test shows that Mox4 functions downstream of Mox1 and Mox2. Mox4, a zinc cluster protein homologous to known transcriptional activators, presumably activates transcription, subject to inhibition by Mox1, Mox2, and possibly other factors we haven't identified. A possible mechanism of regulation is suggested by mutations in a C-terminal domain of Mox4, which cause constitutive activation of the DAN/TIR genes, as well as of components of a sterol transport system (![]()
![]()
We obtained circumstantial evidence for a link between Mox2 and Mox4 by showing that mox2 and mox4 mutations affect expression of a MEL1 reporter driven by synthetic AR1 sites, but not of an AR2 site reporter or of anaerobic genes that do not contain an AR1 [ANB1, HEM13 (Fig 1), and OLE1 (not shown)]. The Mox2 and Mox4 regulators may function independently, even though they operate through the same segment. For example Mox1 and Mox2 could be repressors that bind to AR1 and prevent binding by Mox4. However, the presence of an inhibitory domain in the activator suggests that Mox2 (and presumably Mox1) interacts indirectly with AR1, via an interaction with Mox4. The simplest model for transcriptional regulation through the AR1 site is probably one in which an activator and a repressor (presumably Mox4, Mox1, and Mox2, or factors dependent upon them) form a heme-sensitive regulatory complex analogous to the galactose-sensitive Gal4:Gal80 heterodimer. Another way in which oxygen regulates through the Mox system is through regulation of MOX4 expression; this includes a modest effect of heme. Whether the induction of MOX4 plays a significant regulatory role during hypoxic and cold shock induction is not clear, since most of the DAN/TIR genes are induced simultaneously with MOX4 rather than after a lag; it may be that induction of MOX4 is a more important factor in the delayed expression of DAN2 and DAN3.
The Mox factors are part of a complex regulatory mechanism. The DAN1 promoter is a mosaic of positive and negative regulatory elements (![]()
The fact that there are several independent mechanisms mediating regulation by heme may represent convergent evolution. From this viewpoint, at each step in the evolution of a complex promoter like that of DAN1, binding sites for one repressor or another appeared randomly, incrementally moving the gene toward optimal regulation; a similar process would have recruited the activation mechanisms acting through the AR1 and AR2 sites. However, it is possible that these regulatory mechanisms are not truly equivalent. For example, the aerobic repression mechanisms that control TIR1 and TIR4 give way when these genes are induced by cold shock (in aerobic cultures), and they may have been engineered to accommodate responses to stresses other than hypoxia.
| FOOTNOTES |
|---|
1 These authors contributed equally to this work. ![]()
| ACKNOWLEDGMENTS |
|---|
We are grateful to Pauline Carrico and Joan Curcio for valuable discussions. This work was supported by a grant from the National Science Foundation (MCB-9723565).
Manuscript received July 10, 2000; Accepted for publication December 7, 2000.
| LITERATURE CITED |
|---|
ALANI, E., L. CAO, and N. KLECKNER, 1987 A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116:541-545
CHOI, E., J. E. STUKEY, S. Y. HWANG, and C. E. MARTIN, 1996 Regulatory elements that control transcription activation and unsaturated fatty acid-mediated repression of the Saccharomyces cerevisiae OLE1 gene. J. Biol. Chem. 271:3581-3589
COHEN, B. D., O. SERTIL, N. E. ABRAMOVA, K. J. A. DAVIES and C. V. LOWRY, 2001 Induction and repression of DAN1 and the family of anaerobic mannoprotein genes in S. cerevisiae occurs through a complex array of regulatory sites. Nucleic Acids Res. (in press).
CROWLEY, J. H., F. W. LEAK, K. V. SHIANNA, S. TOVE, and L. W. PARKS, 1998 A mutation in a purported regulatory gene affects control of sterol uptake in Saccharomyces cerevisiae.. J. Bacteriol. 180:4177-4183
DECKERT, J., R. PERINI, B. BALASUBRAMANIAN, and R. S. ZITOMER, 1995 Multiple elements and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces cerevisiae.. Genetics 139:1149-1158[Abstract].
DONZEAU, M., J. P. BOURDINEAUD, and G. J. LAUQUIN, 1996 Regulation by low temperature and anaerobiosis of a yeast gene specifying a putative GPI-anchored plasma membrane protein. Mol. Microbiol. 20:449-459[Medline].
DRGON, T., L. SABOVA, N. NELSON, and J. KOLAROV, 1991 ADP/ATP translocator is essential only for anaerobic growth of yeast Saccharomyces cerevisiae.. FEBS Lett. 289:159-162[Medline].
EVANGELISTA, C. C., JR., A. M. RODRIGUEZ TORRES, M. P. LIMBACH, and R. S. ZITOMER, 1996 Rox3 and Rts1 function in the global stress response pathway in baker's yeast. Genetics 142:1083-1093[Abstract].
GIETZ, R. D. and A. SUGINO, 1988 New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534[Medline].
GRISHIN, A. V., M. ROTHENBERG, M. A. DOWNS, and K. J. BLUMER, 1998 Mot3, a Zn finger transcription factor that modulates gene expression and attenuates mating pheromone signaling in Saccharomyces cerevisiae.. Genetics 149:879-892
HODGE, M. R., G. KIM, K. SINGH, and M. G. CUMSKY, 1989 Inverse regulation of the yeast COX5 genes by oxygen and heme. Mol. Cell. Biol. 9:1958-1964
KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992 Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].
KENG, T., 1992 HAP1 and ROX1 form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:2616-2623
KONDO, K. and M. INOUYE, 1991 TIP1, a cold shock inducible gene of Saccharomyces cerevisiae.. J. Biol. Chem. 266:17537-17544
KOWALSKI, L. R. Z., K. KONDO, and M. INOUYE, 1995 Cold-shock induction of a family of TIP1-related proteins associated with the membrane in Saccharomyces cerevisiae.. Mol. Microbiol. 15:341-353[Medline].
KWAST, K., Y. P. R. BURKE, B. T. STAAHL, and R. O. POYTON, 1999 Oxygen sensing in yeast: evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes. Proc. Natl. Acad. Sci. USA 96:5446-5451
LEWIS, T. L., G. A. KEESLER, G. P. FENNER, and L. W. PARKS, 1988 Pleiotropic mutations in Saccharomyces cerevisiae affecting sterol uptake and metabolism. Yeast 4:93-106[Medline].
LOWRY, C. V. and R. H. LIEBER, 1986 Negative regulation of the Saccharomyces cerevisiae ANB1 gene by heme, as mediated by the ROX1 gene product. Mol. Cell. Biol. 6:4145-4148
LOWRY, C. V. and R. S. ZITOMER, 1984 Oxygen regulation of anaerobic and aerobic genes mediated by a common factor in yeast. Proc. Natl. Acad. Sci. USA 81:6129-6133
LOWRY, C. V. and R. S. ZITOMER, 1988 ROX1 encodes a heme-induced repression factor regulating ANB1 and CYC7 of Saccharomyces cerevisiae.. Mol. Cell. Biol. 8:4651-4658
LOWRY, C. V., J. L. WEISS, D. A. WALTHALL, and R. S. ZITOMER, 1983 Modulator sequences mediate the oxygen regulation of CYC1 and a neighboring gene in yeast. Proc. Natl. Acad. Sci. USA 80:151-155
LOWRY, C. V., M. E. CERDAN, and R. S. ZITOMER, 1990 A hypoxic consensus operator and a constitutive activation region regulate the ANB1 gene of Saccharomyces cerevisiae.. Mol. Cell. Biol. 10:5921-5926
LUSSIER, M., A. M. WHITE, J. SHERATON, T. DI PAOLO, and J. TREADWELL et al., 1997 Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae.. Genetics 147:435-450[Abstract].
MADISON, J. M., A. M. DUDLEY, and F. WINSTON, 1998 Identification and analysis of Mot3, a zinc finger protein that binds to the retrotransposon Ty long terminal repeat (delta) in Saccharomyces cerevisiae.. Mol. Cell. Biol. 18:1879-1890
ROSE, A. H., F. WINSTON and P. HETIER, 1990 Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
RYAN, M. P., R. JONES, and R. H. MORSE, 1998 SWI-SNF complex participation in transcriptional activation at a step subsequent to activator binding. Mol. Cell. Biol. 18:1774-1782
SERTIL, O., B. D. COHEN, K. J. D. DAVIES, and C. V. LOWRY, 1997 The DAN1 gene of S. cerevisiae is regulated in parallel with the hypoxic genes, but by a different mechanism. Gene 192:199-205[Medline].
TER LINDE, J. J., H. LIANG, R. W. DAVIS, H. Y. STEENSMA, and J. P. VAN DIJKEN et al., 1999 Genome-wide transcriptional analysis of aerobic and anaerobic chemostat cultures of Saccharomyces cerevisiae.. J. Bacteriol. 181:7409-7413
THORSNESS, M., W. SCHAFER, L. D'ARI, and J. RINE, 1989 Positive and negative transcriptional control by heme of genes encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase in Saccharomyces cerevisiae.. Mol. Cell. Biol. 9:5702-5712
TURI, T. G. and J. C. LOPER, 1992 Multiple regulatory elements control expression of the gene encoding the Saccharomyces cerevisiae cytochrome P450, lanosterol 14 alpha-demethylase (ERG11). J. Biol. Chem. 267:2046-2056
WINSTON, F., C. DOLLARD, and S. L. RICUPERO-HOVASSE, 1995 Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C. Yeast 11:53-55[Medline].
ZAGOREC, M. and R. LABBE-BOIS, 1986 Negative control of yeast coproporphyrinogen oxidase synthesis by heme and oxygen. J. Biol. Chem. 261:2506-2509
ZITOMER, R. S. and C. V. LOWRY, 1992 Regulation of gene expression by oxygen in Saccharomyces cerevisiae.. Microbiol. Rev. 56:1-11
ZITOMER, R. S., J. W. SELLERS, D. W. MCCARTER, G. A. HASTINGS, and P. WICK et al., 1987 Elements involved in oxygen regulation of the Saccharomyces cerevisiae CYC7 gene. Mol. Cell. Biol. 7:2212-2220
This article has been cited by other articles:
![]() |
S. J. Hoot, B. G. Oliver, and T. C. White Candida albicans UPC2 is transcriptionally induced in response to antifungal drugs and anaerobicity through Upc2p-dependent and -independent mechanisms Microbiology, September 1, 2008; 154(9): 2748 - 2756. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Protchenko, M. Shakoury-Elizeh, P. Keane, J. Storey, R. Androphy, and C. C. Philpott Role of PUG1 in Inducible Porphyrin and Heme Transport in Saccharomyces cerevisiae Eukaryot. Cell, May 1, 2008; 7(5): 859 - 871. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Znaidi, S. Weber, O. Zin Al-Abdin, P. Bomme, S. Saidane, S. Drouin, S. Lemieux, X. De Deken, F. Robert, and M. Raymond Genomewide Location Analysis of Candida albicans Upc2p, a Regulator of Sterol Metabolism and Azole Drug Resistance Eukaryot. Cell, May 1, 2008; 7(5): 836 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ikeda, A. Kihara, A. Denpoh, and Y. Igarashi The Rim101 Pathway Is Involved in Rsb1 Expression Induced by Altered Lipid Asymmetry Mol. Biol. Cell, May 1, 2008; 19(5): 1922 - 1931. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Almeida, M. Marques, D. Mojzita, M. A. Amorim, R. D. Silva, B. Almeida, P. Rodrigues, P. Ludovico, S. Hohmann, P. Moradas-Ferreira, et al. Isc1p Plays a Key Role in Hydrogen Peroxide Resistance and Chronological Lifespan through Modulation of Iron Levels and Apoptosis Mol. Biol. Cell, March 1, 2008; 19(3): 865 - 876. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Agarwal, T. Xu, M. R. Jacob, Q. Feng, M. C. Lorenz, L. A. Walker, and A. M. Clark Role of Heme in the Antifungal Activity of the Azaoxoaporphine Alkaloid Sampangine Eukaryot. Cell, February 1, 2008; 7(2): 387 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Abe and H. Minegishi Global Screening of Genes Essential for Growth in High-Pressure and Cold Environments: Searching for Basic Adaptive Strategies Using a Yeast Deletion Library Genetics, February 1, 2008; 178(2): 851 - 872. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Hickman and F. Winston Heme Levels Switch the Function of Hap1 of Saccharomyces cerevisiae between Transcriptional Activator and Transcriptional Repressor Mol. Cell. Biol., November 1, 2007; 27(21): 7414 - 7424. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Sertil, A. Vemula, S. L. Salmon, R. H. Morse, and C. V. Lowry Direct Role for the Rpd3 Complex in Transcriptional Induction of the Anaerobic DAN/TIR Genes in Yeast Mol. Cell. Biol., March 15, 2007; 27(6): 2037 - 2047. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wu, X. Zheng, Y. Araki, H. Sahara, H. Takagi, and H. Shimoi Global Gene Expression Analysis of Yeast Cells during Sake Brewing Appl. Envir. Microbiol., November 1, 2006; 72(11): 7353 - 7358. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. MacPherson, M. Larochelle, and B. Turcotte A Fungal Family of Transcriptional Regulators: the Zinc Cluster Proteins Microbiol. Mol. Biol. Rev., September 1, 2006; 70(3): 583 - 604. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. J. Davies and J. Rine A Role for Sterol Levels in Oxygen Sensing in Saccharomyces cerevisiae Genetics, September 1, 2006; 174(1): 191 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Reynolds The Opi1p Transcription Factor Affects Expression of FLO11, Mat Formation, and Invasive Growth in Saccharomyces cerevisiae. Eukaryot. Cell, August 1, 2006; 5(8): 1266 - 1275. |











