- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Mahaffey, J. W.
- Articles by Cao, Q.-M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Mahaffey, J. W.
- Articles by Cao, Q.-M.
The Drosophila Genes disconnected and disco-related Are Redundant With Respect to Larval Head Development and Accumulation of mRNAs From Deformed Target Genes
James W. Mahaffeya, Charles M. Griswolda, and Quynh-Mai Caoaa Department of Genetics, North Carolina State University, Raleigh, North Carolina 27695-7614
Corresponding author: James W. Mahaffey, Department of Genetics, North Carolina State University, Campus Box 7614, Raleigh, NC 27695-7614., jim_mahaffey{at}ncsu.edu (E-mail)
Communicating editor: A. J. LOPEZ
| ABSTRACT |
|---|
HOM-C/hox genes specify body pattern by encoding regionally expressed transcription factors that activate the appropriate target genes necessary for differentiation of each body region. The current model of target gene activation suggests that interactions with cofactors influence DNA-binding ability and target gene activation by the HOM-C/hox proteins. Currently, little is known about the specifics of this process because few target genes and fewer cofactors have been identified. We undertook a deficiency screen in Drosophila melanogaster in an attempt to identify loci potentially encoding cofactors for the protein encoded by the HOM-C gene Deformed (Dfd). We identified a region of the X chromosome that, when absent, leads to loss of specific larval mouthpart structures producing a phenotype similar to that observed in Dfd mutants. The phenotype is correlated with reduced accumulation of mRNAs from Dfd target genes, though there appears to be no effect on Dfd protein accumulation. We show that these defects are due to the loss of two functionally redundant, neighboring genes encoding zinc finger transcription factors, disconnected and a gene we call disco-related. We discuss the role of these genes during differentiation of the gnathal segments and, in light of other recent findings, propose that regionally expressed zinc finger proteins may play a central role with the HOM-C proteins in establishing body pattern.
HOX genes encode homeodomain-containing transcription factors that specify body pattern during embryogenesis in all metazoans (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Recent data indicate that interactions with cofactors play an important role in target gene selection. For example, the Extradenticle/Pbx proteins (Exd) participate in cooperative binding with hox proteins, and the heterodimer has a more specific DNA recognition site than the HOM-C/hox protein alone (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In an attempt to identify potential cofactors functioning with the protein encoded by the HOM-C gene Deformed (Dfd), we carried out a genetic screen using deficiencies available from the Bloomington Drosophila Stock Center. We identified one region of the X chromosome that appears likely to encode such a factor. We show that embryos lacking this region have disruptions of the larval cephalopharyngeal skeleton similar to those seen in Dfd mutants. In addition, Dfd target gene expression is altered in these embryos, though there appears to be no effect on Dfd expression itself. We show that these defects are due to the loss of two functionally redundant, neighboring genes encoding zinc finger transcription factors. One gene, disconnected (disco), has been previously described as a gene necessary for neural connectivity (![]()
![]()
| MATERIALS AND METHODS |
|---|
Drosophila stocks and culture:
Dfd16, Df(1)4b18, Df(1)19, Dp(1Y)shi+1, Df(1)sd72b, and the flies in the deficiency kit were obtained from the Bloomington Indiana Drosophila Stock Center. Df(1)XR14 was a gift from G. Haddad (Yale University). Dp(1;4)81j6e was provided by S. Faulhaber and M. Tanouye (University of California, Berkeley). disco1 flies were provided by J. Hall (Brandeis University). Flies were reared on standard cornmeal-agar-molasses medium.
Cuticle analysis:
Embryos were collected and prepared for cuticle examination following procedures described in ![]()
disco clones:
The disco subclones used in RNAi and whole embryo in situ were derived from a
clone of the 14B region (![]()
![]()
PCR amplification and cloning of disco-r:
The 5' and 3' coding domains of disco-r were amplified from genomic DNA using Taq DNA polymerase (QIAGEN, Valencia, CA). The 5' primers used were ATCAGCACCACCCACATTTGC and TCTCTGCAGATAATCCTGTCC. The 3' primers used were ATGAGATTGATAGCATGCCGC and ATCAGTGGATAACCAGCGTGG. Primers were obtained from Operon Technologies (Alameda, CA). Amplification was carried out using the following parameters: 95° for 40 sec, 55° for 1 min, 72° for 2 min for 40 cycles. The two reactions each yielded a product of 1.5 kb. PCR products were cloned into pCRII using a TA cloning kit (Invitrogen, San Diego, CA).
Isolation of disco-r cDNAs:
The disco-r cDNA clone CK00522 (Research Genetics, Huntsville, AL) was used to make a fluorescein-labeled probe for the screening of an embryonic cDNA library (![]()
Mapping of Df breakpoints:
DNAs from single mutant and wild-type embryos or larvae were prepared using the method of ![]()
RNAi:
Preparation of dsRNA and injection of embryos followed the procedure of ![]()
![]()
| RESULTS |
|---|
Screen for potential cofactors of Dfd:
To identify genomic regions potentially encoding cofactors, we screened chromosome deficiencies available from the Bloomington Drosophila Stock Center using three criteria: (1) disruption of maxillary and/or mandibular cephalopharyngeal components of the first instar larva, (2) normal expression of Dfd, and (3) alteration of Dfd target gene expression. We identified two deficiencies of the X chromosome that met these criteria. One, Df(1)sd72b, is known to remove the gene exd (![]()
![]()
![]()
The segmental origin of larval cephalopharyngeal structures has been well defined (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Half the male progeny from a cross of Df(1)4b18/FM7c to FM7c/Y lack a portion of the 14B region of the X chromosome. (In our descriptions below we refer to such embryos and larvae as hemizygous, for, though they lack the 14B region, they are hemizygous for the X chromosome.) Many of the structures missing or disrupted in unhatched larvae hemizygous for Df(1)4b18 are the same as those altered in embryos homozygous for mutations in Dfd (Fig 1). The terminal larvae lack the base of the mouth hooks and dental sclerites. The lateral process is truncated near the H-piece, which is also disrupted. The few remaining cirri are misshapen and disorganized. The maxillary portion of the maxillary sense organ does not fuse with the antennal portion. Overall, this phenotype is similar to that of embryos homozygous for strong hypomorphic mutations of Dfd (![]()
Loss or disruption of many Dfd-specific structures in Df(1)4b18 embryos coincides with reduced mRNA accumulation from at least some Dfd target genes. Though many genes are likely to be regulated by Dfd, currently only four genes have been identified as strong candidate target genes: Dfd (through autoactivation), Distal-less (Dll), 1.28, and perhaps Serrate (Ser; ![]()
![]()
![]()
![]()
![]()
Phenotype and mapping of deficiencies removing 14B:
We used other chromosomal aberrations with breaks near 14B to further map the position of the gene or genes responsible for the head defects. Fig 2 shows the larval head phenotype and the mapping data for these deficiencies. Note, since Df(1)sd72b and Df(1)19 delete exd (![]()
![]()
![]()
|
Larval mouthpart structures appear normal in hemizygous Df(1)4b18 embryos when Dp(1;4)81j6e also is present (data not shown). This indicates that the locus responsible for the head defect lies distal to the break of Dp(1;4)81j6e but within the region removed by Df(1)4b18. A slight larval head defect is observed in Df(1)sd72b/Dp(1Y)shi+1 embryos (Fig 2B). The bases of the mouth hooks are slightly reduced as are the H-piece and dental sclerites, but the cirri appear to be complete, and the lateral process is not truncated.
The mouthparts of Df(1)XR14 and Df(1)19/Dp(1Y)shi+1 embryos (Fig 2D and Fig E) are more severely disrupted than are those of embryos hemizygous for Df(1)4b18. In these terminal larvae, the mouth hooks and cirri are absent, and the lateral process is reduced further than that in Df(1)4b18 larvae. In addition, the H-piece and the hypostomal sclerites (structures are derived from the labial segment) also are absent. In addition, the antennal sense organ is usually not observed. The phenotype of Df(1)19/Dp(1;Y)shi+1 embryos usually appears more severe than that of Df(1)XR14. For instance, though the cirri are usually absent in Df(1)XR14 hemizygous larvae, we occasionally observe what might be remnants of the cirri and small bits of partially sclerotized material that may be remnants of the mouth hooks.
We mapped the positions of the 14B breakpoints of these deficiencies using genomic Southern blotting and PCR analyses (see map in Fig 2). Having a molecular map of the region (![]()
![]()
![]()
![]()
![]()
![]()
Identification of disco-related:
Two groups have searched for transcribed regions in the 14B interval (![]()
![]()
![]()
![]()
![]()
![]()
|
disco and disco-r are redundant genes together responsible for the larval head defect:
That disco and disco-r encode related proteins and knowing the phenotypes and positions of the deficiency breakpoints in the 14B region indicate that one or both of these genes could be involved in morphogenesis of the larval head. However, since mutations in the disco gene are viable, we suspected that the genes might have redundant functions. Recently we and others have used double-stranded (ds) RNA interference (RNAi) to generate null phenocopies of specific genes in Drosophila (![]()
![]()
![]()
To remove the functions of both genes, we injected dsRNA synthesized from the disco-r cDNA into embryos homozygous for the mutation disco1. Homozygous disco1 embryos develop into normal larvae with an occasional, slight reduction in the mouth hook base (Fig 4A). However, injecting disco-r dsRNA into disco1 homozygous embryos caused the majority of these embryos to fail to hatch, and the mouthparts of the unhatched larvae were disrupted in a manner similar to those observed in the deficiencies described above (Fig 4C and Fig D). Of the 44 developed larvae from one experiment, 3 were similar to disco1, 34 resembled embryos hemizygous for the deficiencies, and 7 had general head defects not resembling the deficiency embryos. Of the 34 larvae appearing similar to the deficiencies, a few resembled larvae hemizygous for Df(1)4b18 (Fig 4C), while most had more severe head defects (Fig 4D). This indicates that the head defects associated with deficiencies of 14B are due to the loss of these two genes that have redundant functions during gnathal lobe development.
|
Comparison of disco and disco-r expression during embryogenesis:
The distributions of disco mRNA and protein have been described (![]()
![]()
|
In contrast to disco, disco-r mRNA is not detected until late stage 10 to early stage 11 when it accumulates in the proctodeum and the dorsal clypeolabrum (Fig 5F). disco-r mRNA is not detected in the gnathal region until after segmentation is apparent (stage 11, Fig 5J). From this point onward the distribution of disco-r is nearly indistinguishable from that of disco, though we have not examined expression in the nervous system in detail. By the end of stage 11 both genes are expressed in the mandibular, maxillary, and labial lobes and in primordia of the leg discs. Low levels of mRNA also accumulate in each of the abdominal segments, in a position analogous to the leg disc primordia, but this staining soon disappears (visible in Fig 5G and Fig J, but absent in H and K; see ![]()
disco-r expression in Df(1)4b18 embryos:
The results from our RNAi analyses indicate that both disco and disco-r functions must be removed to disrupt larval head development. Therefore, it is surprising that embryos hemizygous for Df(1)4b18 develop with mouthpart defects, because this deficiency removes only disco (see above). One possible explanation is that the deficiency alters expression of disco-r without removing the gene. To determine whether or not this was the case, we examined the accumulation of disco-r transcripts in embryos hemizygous for Df(1)4b18 (Fig 6). disco-r mRNA is first detected about stage 11 as in wild-type embryos; however, in the mutant embryos disco-r transcripts are not distributed throughout the gnathal lobes. Instead, mRNA accumulates in small clusters of cells in the ventral-posterior region of each lobe (Fig 6B and Fig D). In addition, where there is normally only a low level of transient disco-r mRNA in the abdominal segments, these regions stain more intensely, and staining persists for a longer period in Df(1)4b18 hemizygous embryos (Fig 6B). As germ band contraction continues, the abdominal staining subsides, but staining remains restricted to the small clusters of cells in the gnathal lobes. During later development, when labial and maxillary lobes have migrated to the edges of the stomodeum, the mRNA is no longer detectable in the gnathal lobes (Fig 6F). Accumulation in other areas appears to be unaffected by the deficiency. This altered distribution of disco-r mRNA is caused by the deletion and not by the loss of disco alone, as embryos homozygous for disco1 appear to have normal disco-r mRNA distribution (data not shown).
|
Dfd target gene expression in mutants lacking both disco and disco-r:
Since Df(1)XR14 removes both disco and disco-r, we looked at Dfd target gene expression in embryos hemizygous for this deficiency (Fig 7). As mentioned above, there are four potential target genes of Dfd: 1.28, Dll, Dfd, and perhaps Ser (![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
1.28 mRNA is not detected in the maxillary lobes of most Df(1)XR14 hemizygous embryos (Fig 7A and Fig B). Occasionally we note slight staining in a few cells, mainly along the posterior edge of the lobes, but this often approaches background levels (data not shown).
In wild-type embryos, Ser mRNA accumulates throughout the mandibular lobes and along the lateral anterior and posterior edges of the maxillary and labial lobes (Fig 7C). The proteins encoded by the HOM-C genes Dfd and Scr are necessary for this expression (![]()
We also examined Dll mRNA distribution in embryos hemizygous for Df(1)XR14. In wild-type embryos Dll mRNA accumulates in a large number of cells in the anterior-lateral portion of the maxillary lobe and in a smaller group of cells more ventrally located (Fig 7E). Dll mRNA accumulation in the ventral cells requires Dfd while expression in the anterior-lateral region does not (![]()
Dfd is also a target through autoactivation (![]()
![]()
![]()
disco and disco-r are not targets of Dfd:
Another possible cause of the larval head defect might be that disco and disco-r are themselves Dfd target genes that, once activated by Dfd, are necessary for further development of the gnathal lobes. If this is the case we would not expect to see disco and disco-r mRNAs accumulate in embryos lacking Dfd. We, therefore, collected embryos from a cross of Dfd16 heterozygous parents and detected disco and disco-r mRNA accumulation by in situ hybridization. Dfd16 has a nonsense mutation before the homeobox (![]()
![]()
| DISCUSSION |
|---|
The two genes, disco and disco-r, appear to have redundant functions during development of the Drosophila larval head. Presence of either gene product is sufficient for normal development of the mandibular, maxillary, and labial lobes, but absence of both gene products disrupts development in these regions. The phenotype of terminal larvae lacking these two genes is strikingly similar to that of larvae lacking the HOM-C genes Dfd and Scr. disco was identified earlier as encoding a protein required for the formation of certain neural connections during embryonic and adult development of Drosophila (![]()
![]()
disco and disco-r encode proteins containing paired zinc finger domains, Disco with one pair while Disco-r has two pairs. The near identity of the Disco zinc finger pair and the first pair in Disco-r indicates that these proteins may bind to the same DNA sequence. This, along with overlapping distribution of mRNAs, likely explains the redundancy. However, the putative Disco-r protein contains a second pair of zinc fingers, and it is possible that these also influence DNA binding. If so, there may be some differences in the recognition site of these two proteins and, possibly, differences in their roles during development. It is worth noting that a mammalian gene, basonuclin, has been identified that encodes a protein with zinc finger domains similar to those in Disco (![]()
basonuclin mRNA and protein accumulate in some cells that have the potential to divide, leading to the prediction that the protein is involved in regulation of cell proliferation (![]()
![]()
Other redundant gene pairs have been identified in Drosophila. Of particular note are the head gap gene buttonhead (btd) and the gene D-Sp1 (![]()
![]()
![]()
![]()
With this in mind, one may wonder whether the disco and disco-r are also head gap genes. The early distribution of disco mRNA may be suggestive, but we think that it is unlikely for the following reasons. Loss of disco and disco-r does not appear to cause a gap phenotype. We observe no loss of segments; the gnathal lobes form as expected. In addition, we do not observe a change in the distribution of the engrailed protein in the gnathal cells until head involution is underway, and then the changes appear to be due to improper migration of the gnathal lobes in the mutant embryos (data not shown). Further, disco-r function is sufficient for normal gnathal development, yet accumulation of disco-r mRNA in gnathal cells occurs well after segmentation. Finally, the process of segmentation in the gnathal region follows that of the trunk, relying on the gap, pair rule, and segment polarity functions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
However, we suggest that disco/disco-r and btd may have similar roles. Recently, ![]()
![]()
![]()
![]()
Though repression of phenotypic suppression may occur, we propose that there is a more fundamental role for the proteins encoded by btd and disco/disco-r. We propose that these zinc finger-containing proteins are required along with the HOM-C proteins to activate the appropriate target genes necessary to establish segment identity. In the case of disco and disco-r, this is with Dfd and Scr during differentiation of the gnathal lobes. disco and disco-r have a lot in common with the HOM-C genes. They encode spatially restricted transcription factors. Absence of these genes causes a similar phenotype to loss of Dfd and Scr, suggesting a loss of segment identity. We suggest that, as with the HOM-C genes, disco and disco-r are needed to establish the appropriate transcriptional environment for gnathal segment identity. In an analogous manner, Btd and Ems are required for intercalary identity. Further, since Btd interacts directly with Ems, it seems possible that similar interactions may occur between other HOM-C proteins and zinc finger cofactors. It is tempting to speculate that this occurs with Disco/Disco-r and Dfd and Scr, but this may be a bit premature. Additional studies are necessary to determine if this model is correct, but the similarity of larvae lacking these genes to those lacking Dfd and Scr implies that the disco and disco-r function is crucial for normal pattern formation in the gnathal lobes.
With regard to general HOM-C/hox gene specification of body pattern, perhaps similar systems are in operation in other regions of the embryo that have gone undetected due to redundancy. There are numerous zinc finger encoding genes within the Drosophila genome (![]()
| ACKNOWLEDGMENTS |
|---|
The authors acknowledge the generosity of the many individuals who kindly supplied reagents for this study: The Bloomington Indiana Drosophila Stock Center for many stocks including the deficiency kit stocks, G. Haddad (Yale University) for Df(1)XR14, S. Faulhaber and M. Tanouye (UC Berkeley) for Dp(1;4)81j6e, J. Hall (Brandeis University) for disco1 flies, and R. Miassod (Lab. Genet. Biol. Cell. CNRS Marseille, France) for the lambda walk clones of the 14B region. We also thank Dr. Dipak Mahato and Mary C. Clark for help with this deficiency screen. We also thank Dr. G. Gibson for critical reading and helpful comments about the manuscript. This work was supported by National Science Foundation Grant IBN-9514246 to J.W.M.
Manuscript received June 23, 2000; Accepted for publication September 12, 2000.
| LITERATURE CITED |
|---|
ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000 The genome sequence of Drosophila melanogaster.. Science 287:2185-2195.
AFFOLTER, M., A. PERCIVAL-SMITH, M. MULLER, W. LEUPIN, and W. J. GEHRING, 1990 DNA binding properties of the purified Antennapedia homeodomain. Proc. Natl. Acad. Sci. USA 87:4093-4097.
ANDREW, D. J. and M. P. SCOTT, 1992 Downstream of the homeotic genes. New Biol. 4:5-15.
BIGGIN, M. D. and W. MCGINNIS, 1997 Regulation of segmentation and segmental identity by Drosophila homeoproteins: the role of DNA binding in functional activity and specificity. Development 124:4425-4433.
BROWN, S. J., J. P. MAHAFFEY, M. D. LORENZEN, R. E. DENELL, and J. W. MAHAFFEY, 1999 Using RNAi to investigate orthologous homeotic gene function during development of distantly related insects. Evol. Dev. 1:11-15.
CAMPOS-ORTEGA, J. A., and V. HARTENSTEIN, 1997 The Embryonic Development of Drosophila melanogaster, Ed. 2. Springer Verlag, Berlin.
CHAN, S.-K. and R. S. MANN, 1996 A structural model for a homeotic protein-extradenticle-DNA complex accounts for the choice of HOX protein in the heterodimer. Proc. Natl. Acad. Sci. USA 93:5223-5228.
CHAN, S. K., L. JAFFE, M. CAPOVILLA, J. BOTAS, and R. S. MANN, 1994 The DNA binding specificity of Ultrabithorax is modulated by cooperative interactions with extradenticle, another homeoprotein. Cell 78:603-615.
CHAN, S.-K., H.-D. RYOO, A. GOULD, R. KRUMLAUF, and R. S. MANN, 1997 Switching the in vivo specificity of a minimal Hox-responsive element. Development 124:2007-2014.
COHEN, B., E. A. WIMMER, and S. M. COHEN, 1991 Early development of leg and wing primordia in the Drosophila embryo. Mech. Dev. 33:229-240.
DESSAIN, S., C. T. GROSS, M. A. KUZIORA, and W. MCGINNIS, 1992 Antp-type homeodomains have distinct DNA binding specificities that correlate with their different regulatory functions in embryos. EMBO J. 11:991-1002.
EKKER, S. C., D. G. JACKSON, D. P. VON KESSLER, B. I. SUN, and K. E. YOUNG et al., 1994 The degree of variation in DNA sequence recognition among four Drosophila homeotic proteins. EMBO J. 13:3551-3560.
FALK, D. R., L. ROSELLI, S. CURTISS, D. HALLADAY, and C. KLUFAS, 1984 The characterization of chromosome breaks in Drosophila melanogaster. I. Mass isolation of deficiencies which have an end point in the 14A-15A region. Mutat. Res. 126:25-34.
FLORENCE, B., R. HANDROW, and A. LAUGHON, 1991 DNA-binding specificity of the fushi tarazu homeodomain. Mol. Cell. Biol. 11:3613-3623.
GALLITANO-MENDEL, A. and R. FINKELSTEIN, 1998 Ectopic orthodenticle expression alters Segment polarity gene expression but not head segment identity in the Drosophila embryo. Dev. Biol. 199:125-137.
GARCIA-BELLIDO, A., 1977 Homoeotic and atavic mutations in insects. Am. Zool. 17:613-629.
GLOOR, G. B., C. R. PRESTON, D. M. JOHNSON-SCHLITZ, N. A. NASSIF, and R. W. PHILLIS et al., 1993 Type I repressors of P element mobility. Genetics 135:81-95.
HEILIG, J. S., M. FREEMAN, T. LAVERTY, K. J. LEE, and A. R. CAMPOS et al., 1991 Isolation and characterization of the disconnected gene of Drosophila melanogaster.. EMBO J. 10:809-815.
HOEY, T. and M. LEVINE, 1988 Divergent homeo box proteins recognize similar DNA sequences in Drosophila. Nature 332:858-861.
JÜRGENS, G., R. LEHMANN, M. SCHARDIN, and C. NUSSLEIN-VOLHARD, 1986 Segmental organization of the head in the embryo of Drosophila melanogaster. A blastoderm fate map of the cuticle structures of the larval head. Roux's Arch. Dev. Biol. 195:359-377.
KENNERDELL, J. R. and R. W. CARTHEW, 1998 Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95:1017-1026.
KRAUT, R. and M. LEVINE, 1991 Spatial regulation of the gap gene giant during Drosophila development. Development 111:601-609.
KRUMLAUF, R., 1994 Hox genes in vertebrate development. Cell 78:191-201.
KUZIORA, M. A. and W. MCGINNIS, 1988 Autoregulation of a Drosophila homeotic selector gene. Cell 55:477-485.
LEE, K. J., M. FREEMAN, and H. STELLER, 1991 Expression of the disconnected gene during development of Drosophila melanogaster.. EMBO J. 10:817-826.
LEHMANN, R. and C. NUSSLEIN-VOLHARD, 1987 hunchback, a gene required for segmentation of an anterior and posterior region of the Drosophila embryo. Dev. Biol. 119:402-417.
LEWIS, E. B., 1978 A gene complex controlling segmentation in Drosophila. Nature 276:565-570.
LI, X., A. VERAKSA, and W. MCGINNIS, 1999 A sequence motif distinct from Hox binding sites controls the specificity of a Hox response element. Development 126:5581-5589.
MACIAS, A. and G. MORATA, 1996 Functional hierarchy and phenotypic suppression among Drosophila homeotic genes: the labial and empty spiracles genes. EMBO J. 15:334-343.
MAHAFFEY, J. W., R. J. DIEDERICH, and T. C. KAUFMAN, 1989 Novel patterns of homeotic protein accumulation in the head of the Drosophila embryo. Development 105:167-174.
MAHAFFEY, J. W., D. F. JONES, J. A. HICKEL, and C. M. GRISWOLD, 1993 Identification and characterization of a gene activated by the deformed homeoprotein. Development 118:203-214.
MANAK, J. R. and M. P. SCOTT, 1994 A class act: conservation of homeodomain protein functions. Development 120S:61-77.
MANN, R. S. and S. K. CHAN, 1996 Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet. 12:258-262.
MCGINNIS, W. and R. KRUMLAUF, 1992 Homeobox genes and axial patterning. Cell 68:283-302.
MCGINNIS, W., C. P. HART, W. J. GEHRING, and F. H. RUDDLE, 1984 Molecular cloning and chromosome mapping of a mouse DNA sequence homologous to homeotic genes of Drosophila. Cell 38:675-680.
MERRILL, V. K., F. R. TURNER, and T. C. KAUFMAN, 1987 A genetic and developmental analysis of mutations in the Deformed locus in Drosophila melanogaster.. Dev. Biol. 122:379-395.
MERRILL, V. K., R. J. DIEDERICH, F. R. TURNER, and T. C. KAUFMAN, 1989 A genetic and developmental analysis of mutations in labial, a gene necessary for proper head formation in Drosophila melanogaster.. Dev. Biol. 135:376-391.
MISQUITTA, L. and B. M. PATERSON, 1999 Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): a role for nautilus in embryonic somatic muscle formation. Proc. Natl. Acad. Sci. USA 96:1451-1456.
MOHLER, J., E. D. ELDON, and V. PIRROTTA, 1989 A novel spatial transcription pattern associated with the segmentation gene, giant, of Drosophila. EMBO J. 8:1539-1548.
O'HARA, E., B. COHEN, S. M. COHEN, and W. MCGINNIS, 1993 Distal-less is a downstream gene of Deformed required for ventral maxillary identity. Development 117:847-856.
PATTATUCCI, A. M., D. C. OTTESON, and T. C. KAUFMAN, 1991 A functional and structural analysis of the Sex combs reduced locus of Drosophila melanogaster.. Genetics 129:423-441.
PAVLIDIS, P., M. RAMASWAMI, and M. A. TANOUYE, 1994 The Drosophila easily shocked gene: a mutation in a phospholipid synthetic pathway causes seizure, neuronal failure, and paralysis. Cell 79:23-33.
PEDERSON, J. A., J. W. LAFOLLETTE, JR., C. GROSS, A. VERAKSA, and W. MCGINNIS et al., 2000 Regulation by homeoproteins: a comparison of Deformed-responsive elements. Genetics 156:677-686.
PEDERSON, J. D., D. P. KIEHART, and J. W. MAHAFFEY, 1996 The role of HOM-C genes in segmental transformations: reexamination of the Drosophila Sex combs reduced embryonic phenotype. Dev. Biol. 180:131-142.
PEIFER, M. and E. WIESCHAUS, 1990 Mutations in the Drosophila gene extradenticle affect the way specific homeo domain proteins regulate segmental identity. Genes Dev. 4:1209-1223.
PINSONNEAULT, J., B. FLORENCE, H. VAESSIN, and W. MCGINNIS, 1997 A model for extradenticle function as a switch that changes HOX proteins from repressors to activators. EMBO J. 16:2032-2042.
RAUSKOLB, C., M. PEIFER, and E. WIESCHAUS, 1993 extradenticle, a regulator of homeotic gene activity, is a homolog of the homeobox-containing human proto-oncogene pbx1.. Cell 74:1101-1112.
REGULSKI, M., N. MCGINNIS, R. CHADWICK, and W. MCGINNIS, 1987 Developmental and molecular analysis of Deformed; a homeotic gene controlling Drosophila head development. EMBO J. 6:767-777.
RUBIN, G. M., M. D. YANDELL, J. R. WORTMAN, G. L. GABOR MIKLOS, and C. R. NELSON et al., 2000 Comparative genomics of the eukaryotes. Science 287:2204-2215.
RYOO, H. D., T. MARTY, F. CASARES, M. AFFOLTER, and R. S. MANN, 1999 Regulation of Hox target genes by a DNA bound Homothorax/Hox/Extradenticle complex. Development 126:5137-5148.
SCHÖCK, F., B. A. PURNELL, E. A. WIMMER, and H. JÄCKLE, 1999 Common and diverged functions of the Drosophila gene pair D-Sp1 and buttonhead.. Mech. Dev. 89:125-132.
SCHÖCK, F., J. REISCHL, E. WIMMER, H. TAUBERT, and B. A. PURNELL et al., 2000 Phenotypic suppression of empty spiracles is prevented by buttonhead. Nature 405:351-354.
SCOTT, M. P. and A. J. WEINER, 1984 Structural relationships among genes that control development: sequence homology between the Antennapedia, Ultrabithorax, and fushi tarazu loci of Drosophila. Proc. Natl. Acad. Sci. USA 81:4115-4119.
SCOTT, M. P., J. W. TAMKUN, and G. W. HARTZELL, III, 1989 The structure and function of the homeodomain. Biochim. Biophys. Acta. 989:25-48.
STANEWSKY, R., K. G. RENDAHL, M. DILL, and H. SAUMWEBER, 1993 Genetic and molecular analysis of the X chromosomal region 14B17-14C4 in Drosophila melanogaster: loss of function in NONA, a nuclear protein common to many cell types, results in specific physiological and behavioral defects. Genetics 135:419-442.
STELLER, H., K. F. FISCHBACH, and G. M. RUBIN, 1987 Disconnected: a locus required for neuronal pathway formation in the visual system of Drosophila. Cell 50:1139-1153.
SURDEJ, P., C. GOT, and R. MIASSOD, 1990 Developmental expression pattern of a 800-kb DNA continuum cloned from the Drosophila X chromosome 14B-15B region. Biol. Cell 68:105-118.
TAUTZ, D. and C. PFEIFLE, 1989 A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback.. Chromosoma 98:81-85.
TSENG, H. and H. GREEN, 1992 Basonuclin: a keratinocyte protein with multiple paired zinc fingers. Proc. Natl. Acad. Sci. USA <






