Specific Genetic Interference With Behavioral Rhythms in Drosophila by Expression of Inverted Repeats

Corresponding author: Michael W. Young, Laboratory of Genetics, The Rockefeller University, 1230 York Ave., New York, NY 10021., young{at}rockvax.rockefeller.edu (E-mail)

Communicating editor: J. J. LOROS

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

We describe a new experimental technique that allows for a tissue-specific reduction of gene activity in the Drosophila nervous system. On the basis of the observation that certain gene functions can be ubiquitously blocked by injecting double-stranded RNA into Drosophila embryos, we employed a method to interfere with an individual gene function permanently in a predetermined cell type. This was achieved by the formation of an inverted-repeat RNA sequence in the tissue of interest under control of the GAL4/UAS binary expression system. As an example, we show that inverted-repeat-mediated interference with the period gene produces a hypomorphic period phenotype. A selective decrease of period RNA appears to be a component of the cellular response.

DROSOPHILA melanogaster is an attractive model organism for a wide variety of biological questions. Pioneering studies in many fields of biology were made possible in Drosophila by the development of genetic techniques such as EMS mutagenesis (ALDERSON 1965 ; LEWIS and BACHER 1968 ), P-element-mediated gene transfer (RUBIN and SPRADLING 1982 ; SPRADLING and RUBIN 1982 ; KARESS and RUBIN 1984 ), P-element-mediated mutagenesis (COOLEY et al. 1988 ), enhancer trapping (O'KANE and GEHRING 1987 ), targeted overexpression systems (BRAND and PERRIMON 1993 ; RORTH 1996 ), and the FLP/FRT system for the generation of genetic mosaics (GOLIC and LINDQUIST 1989 ). Functional characterization of new genes in most cases continues to depend on mutagenesis and a determination of mutant phenotypes.

With the complete sequencing of the Drosophila genome (Berkeley Drosophila Genome Project, www.fruitfly.org; European Drosophila Genome Project, www.edgp.ebi.ac.uk; Celera, www.celera.com) the identification of new genes based on sequence composition and comparison is likely to become an increasingly powerful tool. But if no mutation in the given gene exists, in vivo studies are often restricted to reverse genetics. P-element-mediated gene transfer allows gene interference by altering pattern, level, or timing of gene expression (for example, see PARKHURST et al. 1990 ; BRAND and PERRIMON 1993 ; RORTH 1996 ; HAY et al. 1997 ; BLAU and YOUNG 1999 ). In some instances, mobilization of a preexisting P element close to the locus of interest provides the needed mutation (LITTLETON et al. 1993 ; TOWER et al. 1993 ; ZINSMAIER et al. 1994 ). Related approaches have involved mobilization of the I factor retrotransposon (MILLIGAN and KAISER 1993 ). Yet another means of screening for altered gene function entails a search for lost antigens on immunoblots (for example, see DOLPH et al. 1993 ). However, the generation of alleles that reduce function by homologous recombination has been reported in flies only very recently (RONG and GOLIC 2000 ).

There are cases in which a reduction of gene function has been achieved through expression of antisense RNA (IZANT and WEINTRAUB 1984 ; ROSENBERG et al. 1985 ) or ribozymes (ZHAO and PICK 1993 ). But as demonstrated by FIRE et al. 1998 , double-stranded RNA is substantially more effective at blocking gene function than antisense RNA in Caenorhabditis elegans (FIRE et al. 1998 ). Subsequent studies established that double-stranded RNA (dsRNA) is also a potent and specific inhibitor of gene function in zebrafish (WARGELIUS et al. 1999 ), Trypanosoma brucei (NGO et al. 1998 ), planarians (SANCHEZ ALVARADO and NEWMARK 1999 ), and Drosophila (KENNERDELL and CARTHEW 1998 ). Although the mechanism of dsRNA is still controversial, a loss of the endogenous mRNA constitutes an important step (MONTGOMERY et al. 1998 ; for review, see FIRE 1999 ; SHARP 1999 ).

We were interested in applying dsRNA-mediated gene interference to the investigation of behavioral rhythms in adult Drosophila. Like most other organisms, Drosophila exhibits a daily pattern of activity (for review, see HARDIN 1998 ; YOUNG 1998 ; DUNLAP 1999 ). This pattern of activity is maintained under constant environmental conditions with a period of 24 hr and is therefore termed circadian.

In contrast to previous applications of dsRNA-mediated gene interference in Drosophila, where dsRNA had been injected into embryos (KENNERDELL and CARTHEW 1998 ; MISQUITTA and PATERSON 1999 ), we wished to apply this technique to adult animals. It seemed unlikely that dsRNA, once injected into embryos, would persist through several days of development and then still be effective in promoting gene interference for another 1–2 wk to allow adult behavioral analysis. Although MISQUITTA and PATERSON 1999 observed that injection of dsRNA of the white gene into embryos was effective at blocking white gene function in adult flies, the low penetrance obtained in those studies would make a behavioral analysis almost impossible (MISQUITTA and PATERSON 1999 ). To bypass this problem, we wished to produce dsRNA endogenously.

The rationale for our experiment is that an inverted-repeat sequence could, once transcribed, fold back and form a double-stranded RNA molecule. This idea was supported by the observation that inverted-repeat sequences could induce gene silencing in plants (WATERHOUSE et al. 1998 ) and in C. elegans (TAVERNARAKIS et al. 2000 ). In contrast to the ubiquitous expression of the inverted-repeat sequences in C. elegans under the control of a heat-shock-inducible promoter (TAVERNARAKIS et al. 2000 ), we employed the GAL4/UAS binary expression system (BRAND and PERRIMON 1993 ) to ensure tissue specificity. This should allow the analysis of functions of the adult nervous system, such as circadian behavior, by permanent interference with endogenous gene function. Furthermore, tissue-specific reduction of gene function potentially allows investigations not possible with ubiquitous gene interference or gene loss: (1) Genes that play an essential role not only in behavior but also in development may not be accessible to a behavioral analysis via traditional mutations. However, a tissue-specific reduction of gene function might yield viable, yet behaviorally abnormal flies. (2) Taking advantage of the large number of existing GAL4 driver lines (for example, see Yao YANG et al. 1995 ), this technique would allow the researcher to decide in which cells the gene product acts for a given aspect of behavior. In contrast to overexpression methods, reduced expression can elicit responses only in cell types in which the target gene is normally expressed.

To test this approach, we chose the circadian clock gene period as a model system (KONOPKA and BENZER 1971 ). The period gene is part of a cycling negative transcriptional feedback loop that keeps the circadian clock in Drosophila running (for review, see HARDIN 1998 ; YOUNG 1998 ; DUNLAP 1999 ; SCULLY and KAY 2000 ). Intriguingly, levels of the period mRNA and the PERIOD protein oscillate with circadian frequency (SIWICKI et al. 1988 ; HARDIN et al. 1990 ; EDERY et al. 1994 ). Two transcription factors, dCLOCK and CYCLE (ALLADA et al. 1998 ; BAE et al. 1998 ; DARLINGTON et al. 1998 ; GEKAKIS et al. 1998 ; RUTILA et al. 1998 ; LEE et al. 1999 ), activate the transcription of period. RNA abundance from the period gene reaches its highest level in the beginning of the night and PERIOD protein accumulates with a delay of 6 hr that is influenced by action of a kinase, DOUBLE-TIME (KLOSS et al. 1998 ; PRICE et al. 1998 ). Around midnight PERIOD enters the nucleus as a heterodimer with TIMELESS, another essential component of this molecular oscillator (SEHGAL et al. 1994 , SEHGAL et al. 1995 ; VOSSHALL et al. 1994 ; CURTIN et al. 1995 ; GEKAKIS et al. 1995 ; MYERS et al. 1995 ; SAEZ and YOUNG 1996 ). In the nucleus, PERIOD is involved in the deactivation of its own transcription and that of timeless (DARLINGTON et al. 1998 ). At the end of the night PERIOD is degraded, again under the influence of DOUBLE-TIME (DBT; PRICE et al. 1998 ), thereby releasing the inhibition of its own transcription, and the cycle starts anew. Under constant environmental conditions, proper functioning of this molecular oscillator manifests itself in an overt locomotor activity rhythm with a period length of 24 hr.

Mutations in the period open reading frame lengthen or shorten the period of the circadian rhythm and a complete loss of period function causes arrhythmicity (KONOPKA and BENZER 1971 ). Additionally, reduction of period dosage lengthens the period of Drosophila behavioral rhythms (SMITH and KONOPKA 1982 ; BAYLIES et al. 1987 ; for review, see YOUNG 1998 ). The dosage sensitivity of period can be explained by its crucial function in the oscillator: A reduction of period dosage delays production of PERIOD protein sufficient for interaction with TIMELESS and nuclear transport. Consequently, the deactivation of period and timeless transcription is delayed, resulting in an overall lengthening of this molecular cycle. The specificity of the phenotype, its dosage sensitivity, as well as the availability of a quantitative assay, made period an especially well-suited candidate for our study.

Here we demonstrate that the expression of inverted repeats of sequences composing the period gene results in a reduction of endogenous period RNA levels. As well, endogenous production of the same inverted repeats in cells that are important for the circadian locomotor activity of the fly produces a long-period behavioral phenotype.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

Molecular cloning of transgenes and transgenic fly strains:
For all cloning steps standard procedures were employed. For the construction of the inverted-repeat construct, PCR-amplified fragments of the period cDNA were cloned into the cloning vector pBluescript (Stratagene, La Jolla, CA). The following primers were used for perCt: perup1894-TGATAAGCTTAGATCTCCACATGTAAGCTGAAGATATCG and perdo2889-TAGGAATTCATTCGCATCTGTTCCCAGAGTTAG; and for perPAS, perup1065-TGATAAGCTTAGATCTAGCGGGTGAAGGAGGAC AG and perdo1887-TAGGAATTCATCCTCGAAGACGTTGCACTG. Using different restriction sites of the vector pBluescript the respective fragments were first cloned in antisense orientation into pUASt and subsequently in sense orientation 3' of the first insert. The constructs were injected into Drosophila embryos as described earlier.

RNAse protection assay:
Total RNA was isolated from heads as described in the manufacturer's manual (TEL-TEST, Inc., Friendswood, TX). The RNAse protection assay was performed as described in the manufacturer's manual for the RPAII kit (Ambion, Austin, TX). For each sample, 10 µg of total RNA was used. The riboprobes for period (SEHGAL et al. 1994 ), timeless, and tubulin (SEHGAL et al. 1995 ) have been described previously. As riboprobe for rhodopsin1, a reverse transcriptase (RT)-PCR fragment (608-878) was used. This fragment was amplified with the following primers: up608 ATGGAATTCACTTGGAACGCGACTGGAAC and do878 ATGAGATCTAGGTATGGTGTCCACGCCATGAAC.

Fly culture and locomotor analysis:
D. melanogaster were reared on standard medium at 25°. Monitoring and analysis of locomotor activity of individual flies were performed at 25° using the Drosophila Activity Monitoring System IV (TriKinetics, Waltham, MA).

Immunohistochemistry:
Third instar larvae were dissected in PBS, collagenase treated, fixed in 4% paraformaldehyde, washed (PBS, 0.5% Triton X-100), and blocked in blocking solution (PBS, 0.5% Triton X-100, 10% donkey serum). Primary antibody incubation was done overnight at 4°, samples were subsequently washed, incubated for 1 hr at room temperature in secondary antibody (Jackson ImmunoResearch, West Grove, PA), washed, and mounted in 50% glycerol.

	RESULTS AND DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

Expression of inverted-repeat sequences of the period gene interferes with circadian clock function:
Sequences from two different regions of the period open reading frame were used for the generation of inverted repeats (Fig 1A). perCt contains a carboxy terminal fragment without any known homologies. perPAS contains a sequence encoding a putative protein dimerization domain, the PAS domain (HUANG et al. 1993 ). The PAS domain is found in several other genes (for review, see PONTING and ARAVIND 1997 ), but since the similarity on a nucleic acid level is weak, we did not expect cross-hybridization with other mRNAs. The length of a single repeat in both cases was close to 1 kb in accordance with the average size of dsRNA used in FIRE et al. 1998 . The location of the inverted-repeat sequence and the length of the gap between the repeats of 67 bp were chosen to facilitate cloning.

View larger version (16K): In this window In a new window Download PPT slide   Figure 1. Experimental strategy for the expression of the inverted-repeat sequences perCt-IR and perPAS-IR in clock-relevant tissues. (A) The DNA fragments perCt and perPAS were amplified by PCR from period cDNA. Subsequently, each PCR fragment was cloned as inverted repeat into the vector pUASt (BRAND and PERRIMON 1993 ). Nucleotide positions are indicated above the cDNA. (B) Schematic diagram of the GAL4/UAS binary expression system (BRAND and PERRIMON 1993 ). The timeless promoter region controls tissue-specific expression of the yeast transcription factor GAL4. GAL4 binds to its target sequence [GAL4 sites or upstream activating sequence (UAS)] and activates the transcription of downstream elements. (C) timeless-GAL4 is active in timeless-expressing cells in the larval brain. Larval brains expressing tau-lacZ under the control of timeless-GAL4 were stained with antibodies against ß-Gal (blue) and antibodies against TIMELESS (red) at ZT23. Note the nuclear localization of TIMELESS and the cytoplasmic localization of ß-Gal in the same neurons. (D) gmr-GAL4 is not active in timeless-expressing cells. Larval brains expressing tau-lacZ under the control of gmr-GAL4 were stained with antibodies against ß-Gal (blue) and antibodies against TIMELESS (red; arrow) at ZT23. The TIMELESS positive neurons are in the same position as those in Fig 3C. The blue signal shows the photoreceptor axons that grow from the developing retina into the brain.

We wished to express the inverted repeats using the GAL4/UAS binary expression system (BRAND and PERRIMON 1993 ) in cells relevant for rhythmic locomotor activity. To this end, a transgenic line that expresses GAL4 under the control of the timeless promoter, timeless-GAL4, was employed (Fig 1B and Fig C; EMERY et al. 1998 ). As described in the Introduction, the timeless gene is another essential clock component and therefore is expressed in all cells with a functioning clock (for review, see HARDIN 1998 ; YOUNG 1998 ; SCULLY and KAY 2000 ). These cells include the lateral neurons (LNs), which are believed to be the location of the regulator of rhythmic locomotor activity (EWER et al. 1992 ; FRISCH et al. 1994 ; RENN et al. 1999 ). As shown in Fig 1C timeless-GAL4 is active in cells expressing timeless.

Expression of perCt-inverted repeat (perCt-IR) and perPAS-inverted repeat (perPAS-IR) resulted in a lengthening of the average period of the circadian locomotor activity cycle by 2 hr compared to timeless-GAL4/+ (Fig 2, Table 1). Almost identical phenotypes were observed for several independent transgenic lines (Table 1). The phenotype is nearly fully penetrant. Only 10% of the flies expressing perCt-IR and only 3% of the flies expressing perPAS-IR showed a period of <25 hr compared to 9% of wild-type controls with periods of >24 hr.

View larger version (24K): In this window In a new window Download PPT slide   Figure 2. Expression of perCt-IR and perPAS-IR under the control of timeless-GAL4 lengthens periods of locomotor activity rhythms. Each histogram describes the locomotor activity of an individual fly over time. Adult flies were entrained in a 12-hr-light:12-hr-dark cycle and their locomotor activity was monitored subsequently in constant darkness. The phase of the previous light:dark regime is indicated by the bar above the locomotor record. Horizontal lines are 48-hr intervals, and the height of the solid vertical bars represents the quantity of locomotor activity. The period length () of the rhythm and the genotype are indicated on top of each record.

Since there is an inverse correlation between period dosage and period length (SMITH and KONOPKA 1982 ; BAYLIES et al. 1987 ), the described phenotype is in good agreement with a decrease in period RNA levels caused by expression of the inverted repeats. BAYLIES et al. 1987 also noted that very long period rhythms of >35 hr can be caused by an extremely strong reduction of period RNA abundance (20-fold). However, in our study the maximal increase in period length was 3 hr. This suggests that our experiments reduce, but do not eliminate, expression of period.

Neither sense nor antisense RNA expression is able to interfere with clock function:
To test whether a behavioral phenotype would be caused by the sense or antisense RNA alone, we generated transgenic lines that express either the sense RNA (perCt-sense) or the antisense RNA (perCt-antisense) of perCt. Independent expression of each construct under the control of timeless-GAL4 resulted in wild-type circadian behavior (Table 2). Therefore, expression of the entire inverted repeat sequence is responsible for the observed interference with period function.

Photoreceptor-specific expression of inverted repeat does not affect circadian rhythm:
We also wanted to know whether expression of the inverted repeat outside the LNs would result in behaviorally normal flies. To this end, expression of the inverted repeat was driven with gmr-GAL4, which expresses GAL4 under control of the glass-responsive element (FREEMAN 1997 ). As glass is expressed predominantly in photoreceptors (MOSES et al. 1989 ; MOSES and RUBIN 1991 ; ELLIS et al. 1993 ; VOSSHALL and YOUNG 1995 ), flies carrying gmr-GAL4 and perCt-IR or perPAS-IR should express the inverted repeat primarily in that cell type. Consistently, as shown in Fig 1D, timeless-expressing LNs in larval brains monitored at ZT23 to optimize TIMELESS expression failed to express glass. The circadian behavior of flies expressing the inverted repeats under the control of gmr-GAL4 was indistinguishable from wild type (Table 1).

It was previously reported that expression of period under control of the glass promoter can rescue behavioral arrhythmicity in a period loss-of-function mutant (VOSSHALL and YOUNG 1995 ). In that study glass expression was observed in cells of the brain other than the LNs. Thus, it seems likely that expression of period in such alternative cells can restore behavioral rhythmicity. Since period RNA interference in glass-expressing cells did not significantly alter behavioral rhythmicity in the current study but would not affect LNs, correct function of a clock in LNs may be sufficient to establish wild-type behavioral rhythmicity. Evidence for a dominant, but not exclusive, role for LNs in maintenance of behavioral rhythms was previously set forth by RENN et al. 1999 . Taken together, these data indicate that the expression of an inverted repeat can result in tissue-specific and permanent interference with gene function.

Specific reduction of period RNA by inverted repeat:
Furthermore, we wondered whether presence of the inverted repeat would result in a decrease of endogenous RNA levels as is the case for dsRNA (FIRE et al. 1998 ). Roughly 75% of the period RNA in the head is produced in the eye, and period RNA levels oscillate with a circadian rhythm in this tissue (ZENG et al. 1994 ). For this reason, we used gmr-GAL4 as driver to examine the effect that expression of perCt-inverted-repeat would have on period RNA abundance. Flies were entrained to a 24-hr light/dark cycle (LD; 12/12) and collected at times when period RNA abundance is usually at its trough (ZT2) and when it is at its peak (ZT14; ZT0 is lights on). Total RNA was isolated from heads and subjected to an RNAse protection assay. At ZT 14 abundance of period RNA was found to be reduced to 50% that of wild type in flies expressing perCt-IR (Fig 3). In addition, a subtle increase in period RNA levels at ZT2 was observed (Fig 3). This may be accounted for by the inhibiting effect PERIOD has on its own transcription. Due to the reduction of period RNA levels at ZT14 in the transformed flies, less PERIOD protein is translated. Consequently, less PERIOD should be available to inhibit its own transcription. This experiment was repeated for several independent transgenic lines (see error bars in Fig 3). A decrease of period message at ZT14 to 50% of that seen in wild type was also observed for perPAS-IR (Fig 3C and Fig E, Fig 4).

View larger version (41K): In this window In a new window Download PPT slide   Figure 3. RNA levels from the period gene are reduced in flies expressing perCt-IR. (A) RNAse protection assay on total head RNA from flies expressing perCt-IR under the control of gmr-GAL4 (lanes 3 and 4). As wild-type control, RNA from flies carrying gmr-GAL4 alone was used (lanes 1 and 2). Flies of the respective genotypes were entrained in a 12-hr-light:12-hr-dark cycle and collected on the third day at time points ZT2 and ZT14. (B) The histogram illustrates relative period RNA levels for perCt-IR/gmr-GAL4 at ZT2 and ZT14 compared to wild type (gmr-GAL4/+). For the quantification, the samples of the RNAse protection assay were analyzed by a phosphorimager (Molecular Dynamics, Sunnyvale, CA). RNA levels were assessed in reference to tubulin RNA and subsequently normalized to period RNA levels in gmr-GAL4 at ZT14. Each bar represents the average of two independent experiments. (C) RNAse protection assay as in A. Genotypes are indicated on top of the gel. The bar on top of the gel indicates the light (shaded) and the dark portion (solid) of the LD cycle. (D) The histogram illustrates the quantified and normalized data from the gel shown in C for perCt-IR B1 (solid boxes). gmr-GAL4/+ served as wild-type control (solid circles). Numbers below the graph represent time points in LD. (E) Quantified and normalized data from the RNAse protection assay in C are shown for perPAS-IR G2 (solid boxes). Solid circles represent the wild-type control.

View larger version (54K): In this window In a new window Download PPT slide   Figure 4. Specific inhibition of period RNA by perCt-IR and perPAS-IR. RNA abundance from the timeless gene is closer to its wild-type peak at ZT14 than period RNA abundance, and rhodopsin1 RNA levels are not affected in flies expressing perCt-IR or perPAS-IR under control of gmr-GAL4. (A) RNAse protection assay on total head RNA of flies expressing perCt-IR and perPAS-IR, respectively, under the control of gmr-GAL4. gmr-GAL4/+ flies served as wild-type control. Flies were collected at ZT14 after 3 days of entrainment. For each construct the result from one individual transgenic line is shown as an example. (B) Relative amounts of period and timeless RNA in flies expressing perCt-IR and perPAS-IR, respectively, at ZT14. RNAse protection analysis was done as in A. Subsequently, samples were quantified by a phosphorimager and period and timeless RNA levels were assessed in reference to tubulin and subsequently normalized to the respective RNA level in wild type (gmr-GAL4/+) at ZT14. Each bar represents the average of three different transgenic lines for each construct. (C) RNAse protection assay on total head RNA using rhodopsin1 RNA as a probe. gmr-GAL4/+ serves as wild-type control. Flies were entrained for 3 days and subsequently collected at ZT14. (D) Relative levels of rhodopsin1 RNA in flies expressing perCt-IR or perPAS-IR. The samples of the RNAse protection assay were quantified relative to tubulin RNA levels, and subsequently normalized to rhodopsin1 RNA levels in wild type (gmr-GAL4/+). Each bar represents the average from three independent transgenic lines.

The described reduction of period RNA levels at ZT14 might be due to an effect of the inverted repeat on the phase of period oscillation. To test this possibility, period RNA levels were measured at 12 time points during an LD cycle (Fig 3, C–E). Although period RNA abundance stays at its peak in the inverted-repeat overexpressing flies from ZT14–ZT18 it never exceeds 50% of wild-type peak levels. In contrast, period RNA at its trough is slightly increased in the mutant compared to wild type. The observed damping of the period RNA oscillation is in accordance with an inhibiting effect of the inverted repeats on period RNA accumulation. This indicates that expression of an inverted repeat might indeed follow a mechanism similar to that reported for dsRNA.

Consistent with our results, BAYLIES et al. 1987 observed that a threefold decrease in period RNA levels led to periods of 27 hr. Although this former study did not take period RNA oscillation into account, the pooled RNA of an unsynchronized population should nevertheless reflect differences in period RNA levels between genotypes. The current study extends that of BAYLIES et al. 1987 by clarifying the role of period RNA level in determining the amplitude of the RNA oscillation and in setting the period length of the molecular and behavioral rhythm.

We also investigated timeless RNA levels, which normally oscillate in synchrony with period. As shown in Fig 4, in flies expressing perCt-IR or perPAS-IR, timeless RNA abundance at ZT14 is at 75% of the wild-type control. This observation supports the idea that the reduction of period RNA by expression of an inverted repeat is the primary cause of the lengthening of the circadian cycle. Since oscillations of period and timeless expression are coupled to each other (for review, see DUNLAP 1999 ), a change in the abundance of one gene's product might be expected to affect the other gene's activity. For example, a long period mutation of double-time (dbt^L) affects the period and amplitude of both period and timeless RNA cycles, even though PERIOD protein appears to be the primary target of the altered DBT kinase (PRICE et al. 1998 ). We suggest that the modest change in timeless RNA abundance observed in this study may be a secondary consequence of the change in period function in the transformed flies.

A very remarkable feature of gene interference by dsRNA is its specificity. Since we did not observe any morphological defects in the eyes of flies that expressed the inverted repeats under the control of gmr-GAL4 or eyeless-GAL4 (data not shown), it seemed unlikely that the expression of the inverted repeats causes a general reduction of RNA levels. To further test this notion, we examined the RNA levels of rhodopsin1 (O'TOUSA et al. 1985 ; ZUKER et al. 1985 ; MISMER and RUBIN 1987 ) in flies that express the period inverted repeats under control of gmr-GAL4. As shown in Fig 4C, expression of the inverted repeats does not affect rhodopsin1 RNA levels. This result argues also in favor of a specific interference of the inverted repeats with period gene function in the same cells.

Whereas in most cases of injected dsRNA loss-of-function phenotypes were observed (e.g., FIRE et al. 1998 ; KENNERDELL and CARTHEW 1998 ), in our study a hypomorphic phenotype was usually obtained. Several factors may be responsible for this difference. Since KENNERDELL and CARTHEW 1998 injected early embryos, it is possible that additional factors, which are present more abundantly in the germline and early embryos than they are in adults, are required for efficient gene interference by dsRNA. This idea is supported by the observation that the progeny of injected worms showed a stronger phenotype than the injected animal itself (FIRE et al. 1998 ). Alternatively, nuclear RNA binding proteins might prevent the majority of the synthesized inverted-repeat RNA molecules from forming a hairpin loop or from being transported into the cytoplasm. Consequently, the number of double-stranded RNA molecules per cell would be lower and the interference weaker. Since it was reported that very low concentrations of dsRNA are effective at interfering with gene function (FIRE et al. 1998 ), the latter possibility seems less likely.

In this study we were able to lower period gene function specifically through the expression of inverted-repeat sequences. We achieved permanent and tissue-specific gene interference in Drosophila. Although the example we have explored involved modification of gene expression in the adult nervous system, in principle this approach should be applicable to the study of previously uncharacterized gene function within any tissue and at any stage of development.

	ACKNOWLEDGMENTS

We thank Toby Lieber and Lino Saez for help with generation of transgenic flies, Jeff Hall for the timeless-GAL4 fly stock, and Ulrike Gaul for the gmr-GAL4 fly stock. We also thank Justin Blau, Simon Kidd, Toby Lieber, Adrian Rothenfluh, Cedric Wesley, and Richard Carthew for discussions and invaluable suggestions during this work. S.M. is supported by a Beckman Fellowship. This work was supported by National Institutes of Health grant GM-54339 (M.W.Y.).

Manuscript received March 7, 2000; Accepted for publication July 28, 2000.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

ALDERSON, T., 1965  Chemically induced delayed germinal mutation in Drosophila.. Nature 207:164-167[Medline].

ALLADA, R., N. E. WHITE, W. V. SO, J. C. HALL, and M. ROSBASH, 1998  A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timeless.. Cell 93:791-804[Medline].

BAE, K., C. LEE, D. SIDOTE, K.-Y. CHUANG, and I. EDERY, 1998  Circadian regulation of a Drosophila homolog of the mammalian Clock gene: PER and TIM function as positive regulators. Mol. Cell. Biol. 18:6142-6151[Abstract/Free Full Text].

BAYLIES, M. K., T. A. BARGIELLO, F. R. JACKSON, and M. W. YOUNG, 1987  Changes in abundance or structure of the per gene product can alter periodicity of the Drosophila clock. Nature 326:390-392[Medline].

BLAU, J. and M. W. YOUNG, 1999  Cycling vrille expression is required for a functional Drosophila clock. Cell 99:661-671[Medline].

BRAND, A. H. and N. PERRIMON, 1993  Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415[Abstract].

COOLEY, L., R. KELLEY, and A. SPRADLING, 1988  Insertional mutagenesis of the Drosophila genome with single P elements. Science 239:1121-1128[Abstract/Free Full Text].

CURTIN, K. D., Z. J. HUANG, and M. ROSBASH, 1995  Temporally regulated nuclear entry of the Drosophila PERIOD protein contributes to the circadian clock. Neuron 14:365-372[Medline].

DARLINGTON, T. K., K. WAGER-SMITH, M. FERNANDA CERIANI, D. STAKNIS, and N. GEKAKIS et al., 1998  Closing the circadian loop: CLOCK induced transcription of its own inhibitors, period and timeless.. Science 280:1599-1603[Abstract/Free Full Text].

DOLPH, P. J., R. RANGANATHAN, N. J. COLLEY, R. W. HARDY, and M. SOCOLICH et al., 1993  Arrestin function in inactivation of G protein-coupled receptor rhodopsin in vivo.. Science 260:1910-1916[Abstract/Free Full Text].

DUNLAP, J. C., 1999  Molecular bases for circadian clocks. Cell 96:271-290[Medline].

EDERY, I., L. J. ZWIEBEL, M. E. DEMBINSKA, and M. ROSBASH, 1994  Temporal phosphorylation of the Drosophila period protein. Proc. Natl. Acad. Sci. USA 91:2260-2264[Abstract/Free Full Text].

ELLIS, M. C., E. M. O'NEILL, and G. M. RUBIN, 1993  Expression of Drosophila GLASS protein and evidence for negative regulation of its activity in non-neuronal cells by another DNA-binding protein. Development 119:855-865[Abstract].

EMERY, P., W. V. SO, M. KANEKO, J. C. HALL, and M. ROSBASH, 1998  CRY, a Drosophila clock and light-regulated cryptochrome, is a major contributor to circadian rhythm resetting and photosensitivity. Cell 95:669-679[Medline].

EWER, J., B. FRISCH, M. J. HAMBLEN-COYLE, M. ROSBASH, and J. C. HALL, 1992  Expression of the period clock gene within different cell types in the brain of Drosophila adults and mosaic analysis of these cells' influence on circadian behavioral rhythms. J. Neurosci. 12:3321-3349[Abstract].

FIRE, A., 1999  RNA-triggered gene silencing. Trends Genet. 15:358-363[Medline].

FIRE, A., S. XU, M. K. MONTGOMERY, S. A. KOSTAS, and S. E. DRIVER et al., 1998  Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.. Nature 391:806-811[Medline].

FREEMAN, M., 1997 Personal communication to FlyBase available from http://flybase.bio.indiana.edu/.bin/fbpcq.html?FBrf0091569

FRISCH, B., P. E. HARDIN, M. J. HAMBLEN-COYLE, M. ROSBASH, and J. C. HALL, 1994  A promoterless period gene mediates behavioral rhythmicity and cyclical per expression in a restricted subset of the Drosophila nervous system. Neuron 12:555-570[Medline].

GEKAKIS, N., L. SAEZ, A.-M. DELAHAYE-BROWN, M. P. MYERS, and A. SEHGAL et al., 1995  Isolation of timeless by PER protein interaction: defective interaction between TIMELESS protein and long-period mutant PER^L. Science 270:811-815[Abstract/Free Full Text].

GEKAKIS, N., D. STAKNIS, H. B. NGUYEN, F. C. DAVIS, and L. D. WILSBACHER et al., 1998  Role of the CLOCK protein in the mammalian circadian mechanism. Science 280:1564-1569[Abstract/Free Full Text].

GOLIC, K. G. and S. LINDQUIST, 1989  The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell 59:499-509[Medline].

HARDIN, P. E., 1998  Activating inhibitors and inhibiting activators: a day in the life of a fly. Curr. Opin. Neurobiol. 8:642-647[Medline].

HARDIN, P. E., J. C. HALL, and M. ROSBASH, 1990  Feedback of the Drosophila period gene product on circadian cycling of its messenger RNA levels. Nature 343:536-540[Medline].

HAY, B. A., R. MAILE, and G. M. RUBIN, 1997  P element insertion-dependent gene activation in the Drosophila eye. Proc. Natl. Acad. Sci. USA 94:5195-5200[Abstract/Free Full Text].

HUANG, Z. J., I. EDERY, and M. ROSBASH, 1993  PAS is a dimerization domain common to Drosophila Period and several transcription factors. Nature 364:259-262[Medline].

IZANT, J. G. and H. WEINTRAUB, 1984  Inhibition of thymidine kinase gene expression by anti-sense RNA: a molecular approach to genetic analysis. Cell 36:1007-1015[Medline].

KARESS, R. E. and G. M. RUBIN, 1984  Analysis of P transposable element functions in Drosophila.. Cell 38:135-146[Medline].

KENNERDELL, J. R. and R. W. CARTHEW, 1998  Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95:1017-1026[Medline].

KLOSS, B., J. L. PRICE, L. SAEZ, J. BLAU, and A. ROTHENFLUH et al., 1998  The Drosophila clock gene double-time encodes a protein closely related to human casein kinase I epsilon. Cell 94:97-107[Medline].

KONOPKA, R. J. and S. BENZER, 1971  Clock mutants of Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 68:2112-2116[Abstract/Free Full Text].

LEE, C., K. BAE, and I. EDERY, 1999  PER and TIM inhibit the DNA binding activity of a Drosophila CLOCK-CYC/dBMAL1 heterodimer without disrupting formation of the heterodimer: a basis for circadian transcription. Mol. Cell. Biol. 19:5316-5325[Abstract/Free Full Text].

LEWIS, E. B. and F. BACHER, 1968  Methods of feeding ethyl methane sulfonate (EMS) to Drosophila males. Dros. Inf. Serv. 43:193.

LITTLETON, J. T., M. STERN, K. SCHULZE, M. PERIN, and H. J. BELLEN, 1993  Mutational analysis of Drosophila synaptotagmin demonstrates its essential role in Ca²⁺-activated neurotransmitter release. Cell 74:1125-1134[Medline].

MILLIGAN, C. D. and K. KAISER, 1993  Site-selected' mutagensis of a Drosophila gene using the I factor retrotransposon. Nucleic Acids Res. 21:1323-1324[Free Full Text].

MISMER, D. and G. M. RUBIN, 1987  Analysis of the promoter of the ninaE opsin gene in Drosophila melanogaster.. Genetics 116:565-578[Abstract/Free Full Text].

MISQUITTA, L. and B. M. PATERSON, 1999  Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): a role for nautilus in embryonic somatic muscle formation. Proc. Natl. Acad. Sci. USA 96:1451-1456[Abstract/Free Full Text].

MONTGOMERY, M. K., S. XU, and A. FIRE, 1998  RNA as a target of double-stranded RNA-mediated genetic interference in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 95:15502-15507[Abstract/Free Full Text].

MOSES, K. and G. M. RUBIN, 1991  glass encodes a site-specific DNA-binding protein that is regulated in response to positional signals in the developing Drosophila eye. Genes Dev. 5:583-593[Abstract/Free Full Text].

MOSES, K., M. C. ELLIS, and G. M. RUBIN, 1989  The glass gene encodes a zinc-finger protein required by Drosophila photoreceptor cells. Nature 340:531-536[Medline].

MYERS, M. P., K. WAGER-SMITH, C. S. WESLEY, M. W. YOUNG, and A. SEHGAL, 1995  Positional cloning and sequence analysis of the Drosophila clock gene, timeless.. Science 270:805-808[Abstract/Free Full Text].

NGÔ, H., C. TSCHUDI, K. GULL, and E. ULLU, 1998  Double-stranded RNA induces mRNA degradation in Trypanosoma brucei.. Proc. Natl. Acad. Sci. USA 95:14687-14692[Abstract/Free Full Text].

O'KANE, C. J. and W. J. GEHRING, 1987  Detection in situ of genomic regulatory elements in Drosophila.. Proc. Natl. Acad. Sci. USA 84:9123-9127[Abstract/Free Full Text].

O'TOUSA, J. E., W. BAEHR, R. L. MARTIN, J. HIRSH, and W. L. PAK et al., 1985  The Drosophila ninaE gene encodes an opsin. Cell 40:839-850[Medline].

PARKHURST, S. M., D. BOPP, and D. ISH-HOROWICZ, 1990  X:A ratio, the primary sex-determining signal in Drosophila, is transduced by helix-loop-helix proteins. Cell 63:1179-1191[Medline].

PONTING, C. P. and L. ARAVIND, 1997  PAS: a multifunctional domain family comes to light. Curr. Biol. 7:R674-R677[Medline].

PRICE, J. L., J. BLAU, A. ROTHENFLUH, M. ABODEELY, and B. KLOSS et al., 1998  double-time is a novel Drosophila clock gene that regulates PERIOD protein accumulation. Cell 94:83-95[Medline].

RENN, S. C. P., J. H. PARK, M. ROSBASH, J. C. HALL, and P. H. TAGHERT, 1999  A pdf neuropeptide gene mutation and ablation of PDF neurons each cause severe abnormalities of behavioral circadian rhythms in Drosophila.. Cell 99:791-802[Medline].

RONG, Y. S. and K. G. GOLIC, 2000  Gene targeting by homologous recombination in Drosophila.. Science 288:2013-2018[Abstract/Free Full Text].

RØRTH, P., 1996  A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc. Natl. Acad. Sci. USA 93:12418-12422[Abstract/Free Full Text].

ROSENBERG, U. B., A. PREISS, E. SEIFERT, H. JÄCKLE, and D. C. KNIPPLE, 1985  Production of phenocopies by Krüppel antisense RNA injection into Drosophila embryos. Nature 313:703-706[Medline].

RUBIN, G. M. and A. C. SPRADLING, 1982  Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353[Abstract/Free Full Text].

RUTILA, J. E., V. SURI, M. LE, W. V. SO, and M. ROSBASH et al., 1998  CLOCK is a second bHLH-PAS clock protein essential for circadian rhythmicity and transcription of Drosophila period and timeless.. Cell 93:805-814[Medline].

SAEZ, L. and M. W. YOUNG, 1996  Regulation of nuclear entry of the Drosophila clock proteins PERIOD and TIMELESS. Neuron 17:911-920[Medline].

SÁNCHEZ ALVARADO, A. and P. A. NEWMARK, 1999  Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc. Natl. Acad. Sci. USA 96:5049-5054[Abstract/Free Full Text].

SCULLY, A. L. and S. A. KAY, 2000  Time flies for Drosophila.. Cell 100:297-300[Medline].

SEHGAL, A., J. L. PRICE, B. MAN, and M. W. YOUNG, 1994  Loss of circadian behavioral rhythms and per RNA oscillations in the Drosophila mutant timeless.. Science 263:1603-1606[Abstract/Free Full Text].

SEHGAL, A., A. ROTHENFLUH-HILFIKER, M. HUNTER-ENSOR, Y. CHEN, and M. P. MYERS et al., 1995  Rhythmic expression of timeless: a basis for promoting circadian cycles in period gene autoregulation. Science 270:808-810[Abstract/Free Full Text].

SHARP, P. A., 1999  RNAi and double-strand RNA. Genes Dev. 13:139-141[Free Full Text].

SIWICKI, K. K., C. EASTMAN, G. PETERSEN, M. ROSBASH, and J. C. HALL, 1988  Antibodies to the period gene product of Drosophila reveal diverse tissue distribution and rhythmic changes in the visual system. Neuron 1:141-150[Medline].

SMITH, R. F. and R. J. KONOPKA, 1982  Effects of dosage alterations at the per locus on the period of the circadian clock of Drosophila.. Mol. Gen. Genet. 185:30-36.

SPRADLING, A. C. and G. M. RUBIN, 1982  Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218:341-347[Abstract/Free Full Text].

TAVERNARAKIS, N., S. L. WANG, M. DOROVKOV, A. RYAZANOV, and M. DRISCOLL, 2000  Heritable and inducible genetic interference by double-stranded RNA encoded by transgenes. Nat. Genet. 24:180-183[Medline].

TOWER, J., G. H. KARPEN, N. CRAIG, and A. C. SPRADLING, 1993  Preferential transposition of Drosophila P-elements to nearby chromosomal sites. Genetics 133:347-359[Abstract].

VOSSHALL, L. B. and M. W. YOUNG, 1995  Circadian rhythms in Drosophila can be driven by period expression in a restricted group of central brain cells. Neuron 15:345-360[Medline].

VOSSHALL, L. B., J. L. PRICE, A. SEHGAL, L. SAEZ, and M. W. YOUNG, 1994  Block in nuclear localization of PERIOD protein by a second clock mutation, timeless.. Science 263:1606-1609[Abstract/Free Full Text].

WARGELIUS, A., S. ELLINGSEN, and A. FJOSE, 1999  Double-stranded RNA induces specific developmental defects in zebrafish embryos. Biochem. Biophys. Res. Commun. 263:156-161[Medline].

WATERHOUSE, P. M., M. W. GRAHAM, and M.-B. WANG, 1998  Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proc. Natl. Acad. Sci. USA 95:13959-13964[Abstract/Free Full Text].

YANG, Y. M., J. D. ARMSTRONG, I. VILINSKY, N. J. STRAUSFELD, and K. KAISER, 1995  Subdivision of the Drosophila mushroom bodies by enhancer-trap expression patterns. Neuron 15:45-54[Medline].

YOUNG, M. W., 1998  The molecular control of circadian behavioral rhythms and their entrainment in Drosophila.. Annu. Rev. Biochem. 67:135-152[Medline].

ZENG, H., P. E. HARDIN, and M. ROSBASH, 1994  Constitutive overexpression of the Drosophila period protein inhibits period mRNA cycling. EMBO J. 13:3590-3598[Medline].

ZHAO, J. J. and L. PICK, 1993  Generating loss-of-function phenotypes of the fushi tarazu gene with a targeted ribozyme in Drosophila.. Nature 365:448-451[Medline].

ZINSMAIER, K. E., K. K. EBERLE, E. BUCHNER, N. WALTER, and S. BENZER, 1994  Paralysis and early death in cysteine string protein mutants of Drosophila.. Science 263:977-980[Abstract/Free Full Text].

ZUKER, C. S., A. F. COWMAN, and G. M. RUBIN, 1985  Isolation and structure of a rhodopsin gene from Drosophila melanogaster.. Cell 40:851-858[Medline].

This article has been cited by other articles:

				Y. Moriyama, T. Sakamoto, S. G. Karpova, A. Matsumoto, S. Noji, and K. Tomioka RNA Interference of the Clock Gene period Disrupts Circadian Rhythms in the Cricket Gryllus bimaculatus J Biol Rhythms, August 1, 2008; 23(4): 308 - 318. [Abstract] [PDF]

				A. Matsumoto, M. Ukai-Tadenuma, R. G. Yamada, J. Houl, K. D. Uno, T. Kasukawa, B. Dauwalder, T. Q. Itoh, K. Takahashi, R. Ueda, et al. A functional genomics strategy reveals clockwork orange as a transcriptional regulator in the Drosophila circadian clock Genes & Dev., July 1, 2007; 21(13): 1687 - 1700. [Abstract] [Full Text] [PDF]

				S. Bao and R. Cagan Fast cloning inverted repeats for RNA interference RNA, November 1, 2006; 12(11): 2020 - 2024. [Abstract] [Full Text] [PDF]

				A. E. Brown, L. Bugeon, A. Crisanti, and F. Catteruccia Stable and heritable gene silencing in the malaria vector Anopheles stephensi Nucleic Acids Res., August 1, 2003; 31(15): e85 - e85. [Abstract] [Full Text] [PDF]

				J.-Y. ROIGNANT, C. CARRE, B. MUGAT, D. SZYMCZAK, J.-A. LEPESANT, and C. ANTONIEWSKI Absence of transitive and systemic pathways allows cell-specific and isoform-specific RNAi in Drosophila RNA, March 1, 2003; 9(3): 299 - 308. [Abstract] [Full Text] [PDF]

				M. J. Butler, T. L. Jacobsen, D. M. Cain, M. G. Jarman, M. Hubank, J. R. S. Whittle, R. Phillips, and A. Simcox Discovery of genes with highly restricted expression patterns in the Drosophila wing disc using DNA oligonucleotide microarrays Development, February 15, 2003; 130(4): 659 - 670. [Abstract] [Full Text] [PDF]

				E. Giordano, R. Rendina, I. Peluso, and M. Furia RNAi Triggered by Symmetrically Transcribed Transgenes in Drosophila melanogaster Genetics, February 1, 2002; 160(2): 637 - 648. [Abstract] [Full Text] [PDF]