Genetics, Vol. 156, 1169-1173, November 2000, Copyright © 2000

Targeted Recovery of Mutations in Drosophila

Alyssa Bentleya, Bridget MacLennana, Jonathan Calvoa, and Charles R. Dearolfa
a Department of Pediatrics, Massachusetts General Hospital, Boston, Massachusetts 02114

Corresponding author: Charles R. Dearolf, Department of Pediatrics, Massachusetts General Hospital, Jackson 1402, 55 Fruit St., Boston, MA 02114., cdearolf{at}partners.org (E-mail)

Communicating editor: S. HENIKOFF


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Reverse genetic techniques will be necessary to take full advantage of the genomic sequence data for Drosophila and other experimental organisms. To develop a method for the targeted recovery of mutations, we combined an EMS chemical mutagenesis regimen with mutation detection by denaturing high performance liquid chromatography (DHPLC). We recovered mutant strains at the high rate of ~4.8 mutations/kb for every 1000 mutagenized chromosomes from a screen for new mutations in the Drosophila awd gene. Furthermore, we observed that the EMS mutational spectrum in Drosophila germ cells shows a strong preference for 5'-PuG-3' sites, and for G/C within a stretch of three or more G/C base pairs. Our method should prove useful for targeted mutagenesis screens in Drosophila and other genetically tractable organisms and for more precise studies of mutagenesis and DNA repair mechanisms.


THE fruit fly Drosophila melanogaster provides a powerful experimental system for the study of gene function, development, and disease mechanisms. In spite of the many powerful genetic tools available to the Drosophila community, there has not yet been a generally applicable method to generate mutant strains directly from DNA sequence data. This limitation is particularly relevant now, with the completion of the Drosophila genomic sequencing project (ADAMS et al. 2000 Down). There is a similar need for a reverse genetics method in a variety of other experimental organisms.

Furthermore, ethyl methanesulfonate (EMS) has been extensively used as a chemical mutagen in Drosophila and in other organisms. In excision repair-competent flies, EMS generates primarily GC-to-AT transitions, most likely a result of unrepaired O6-ethyl guanine adducts that mispair with thymine during replication (LOECHLER et al. 1984 Down; SNOW et al. 1984 Down; PASTINK et al. 1991 Down). However, both the in vivo EMS mutational spectrum and mutation rate in Drosophila have been determined from an examination of mutations that result in phenotypes, rather than from an examination of all mutations generated. The actual number and unbiased spectrum of mutations generated from EMS treatment is not known. Obtaining such information for EMS and for other chemical mutagens would be a significant advantage for optimizing the choice of mutagen for individual genes.

We addressed both of these issues by using denaturing high performance liquid chromatography (DHPLC) to assay for EMS-induced mutations in Drosophila. DHPLC has a reported sensitivity of 95–100% (UNDERHILL et al. 1996 Down; O'DONOVAN et al. 1998 Down) and is highly automated once column conditions have been optimized for the particular DNA fragment. In this assay, heteroduplexes of wild-type and mutant DNA fragments give different elution profiles than the corresponding homoduplexes and can be detected as distinct or broadened peaks (OEFNER and UNDERHILL 1998 Down).


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Chemical mutagenesis:
Flies were grown on a medium of cornmeal, molasses, yeast, and agar. Oregon-R males (isogenized for the third chromosome) were starved for 1 day, fed 50 mM EMS, premated for 1 day, then mated in bulk to TM3/TM6B females. */TM3 F1 nonvirgin females were recovered and mated to TM3/TM6B males, two females per vial. One F2 */TM3 male was obtained from each fertile F1 mating and mated to two virgin TM3/TM6B females. After 1 wk, the F2 males were recovered, and their DNA was tested for mutations. The TM3 chromosome contains a wild-type abnormal wing discs (awd) sequence, thereby allowing heteroduplexes to form when mutations were present. Strains lacking awd mutations were discarded, whereas positive strains were retested, sequenced, and kept for further analysis.

DNA isolation:
F2 males were individually frozen at -80°, then separately homogenized in 0.1 ml of a solution containing 1 mM EDTA, 25 mM NaCl, 10 mM Tris, pH 8.0. Proteinase K was added to a final concentration of 0.4 mg/ml, incubated at 37° for 15 min, and heat inactivated at 97° for 10 min. The solution was then phenol-chloroform and chloroform extracted.

Generation of PCR products:
Two sets of oligonucleotides were used to generate awd DNA fragments because of differences in the melting temperatures of the awd DNA domains. The primer pair CGAACACATGAAGCTCCTGA (at -54 bp from the start of translation) and TGGAGGCCTGGTTA CAAAAC (+295) was used to PCR amplify the first exon and the majority of the intron. The primer pair TGCTTGGCAAAACATTGGTCC (+288) and CAGACAGTTAAAGTAGCCG (+641) was used to amplify the second exon. The awd gene is located at salivary gland chromosome position 100E, on the third chromosome. The awd sequence is given in BIGGS et al. 1988 Down and has the GenBank accession no. X13107.

A total of 8–10 µl of DNA solution was used for each PCR reaction. A mixture of Taq and Pfu Turbo DNA polymerases (20:1) was included. Following 32 cycles of PCR, the DNA fragments were denatured for 2 min at 98°, cooled to 25° at a ramp rate of 2°/min, and then sequentially assayed on the DHPLC. The DHPLC instrumentation used was the WAVE system of Transgenomic Inc. The awd exon 1 fragment was assayed at 63° and the exon 2 fragment at 65°. DNA elution was monitored by UV detection. Prior to beginning the de novo screen, we optimized the DHPLC column conditions for both DNA regions by using PCR fragments from known awd mutant strains (TIMMONS et al. 1995 Down).

Sex-linked recessive lethal assay:
Starved Oregon-R males were fed 50 mM EMS, premated for 1 day, and then mated in bulk to virgin Basc females. */Basc F1 female progeny were mated individually to Basc males. One F2 */Basc female was recovered from each fertile mating, crossed to Basc males, and the progeny were scored for the presence of non-Basc males.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Summary of the technique:
Adult male flies were fed a sucrose solution containing 50 mM EMS by the method of LEWIS and BACHER 1968 Down. Following several generations of crosses (Fig 1), F2 males carrying a mutagenized third chromosome were mated for 1 wk, then recovered and used for genomic DNA isolation and PCR reactions. PCR fragments were then assayed by DHPLC. Positive strains were retested and sequenced. We did not obtain any false positive results due to PCR-induced replication errors.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 1. Genetic scheme used in the mutagenesis. The asterisk represents a potentially mutagenized third chromosome.

We screened for new mutations in the abnormal wing discs (awd) gene (BIGGS et al. 1988 Down; DEAROLF et al. 1988 Down), which encodes a member of the Nm23 family of proteins (ROSENGARD et al. 1989 Down). The awd locus was chosen for several reasons. The locus is small, producing a single transcript of <1 kb, and encodes a protein of 153 amino acids. In addition, a collection of awd mutations having known nucleic acid substitutions was available (TIMMONS et al. 1995 Down) to serve as positive controls for optimizing DHPLC column conditions. We designed oligonucleotide pairs to generate two awd PCR fragments, enabling us to screen for new mutations in a 672-bp region of genomic awd DNA sequence. One fragment contained the first exon and most of the intron, while the other fragment contained the second exon (see MATERIALS AND METHODS).

New mutations recovered:
We obtained 16 independent awd mutations (Table 1) out of 4988 mutagenized chromosomes screened. The DHPLC column profiles for these mutations are shown in Fig 2. This rate of mutation recovery corresponds to one mutation being generated for every 209 kb of DNA. Extrapolating, this corresponds to ~570 mutations in the total genomic euchromatin, assuming 120 Mb of euchromatin (ADAMS et al. 2000 Down). On average, we generated several hundred mutations on each treated third chromosome.



View larger version (17K):
In this window
In a new window
Download PPT slide
 
Figure 2. Column profiles of the new awd mutations recovered. The wild-type Oregon-R pattern is noted as +. The mutant patterns were obtained from flies heterozygous for TM3, which is wild type for the awd region assayed. Each of the mutant patterns is designated as the nucleotide position relative to the startpoint of translation, corresponding to Fig 3. The identical mutation at nucleotide 114 was independently recovered twice, and both strains gave a similar column profile.


 
View this table:
In this window
In a new window

 
Table 1. Summary of awd mutations recovered

All 16 mutations were GC-to-AT transitions. One chromosome contained two separate mutations (at nucleotides 21 and 593), and one base pair substitution (at nucleotide 114) was independently recovered twice in the screen. As expected, some nucleotide substitutions did not alter the encoded amino acid, others resulted in a conservative amino acid substitution, and still others led to a more dramatic alteration (Table 1). One of the mutations (Pro97Ser) causes a conditional dominant lethal phenotype (STURTEVANT 1956 Down; BIGGS et al. 1988 Down).

The mutations we recovered are distributed throughout the DNA region assayed, but display some bias. A total of 81% (13/16) of the mutations occurred in a 5'-PuG-3' motif, and 56% (9/16) of the mutations involve a middle G/C base pair in a stretch of three to four consecutive G/C nucleotides. Furthermore, 44% (7/16) of the mutations map to nucleotide positions that are adjacent or identical to another nucleotide that was mutated during the screen (Table 1). Hence, both the context of a given nucleotide pair, as well as the identity of the pair, influence the likelihood of an EMS-induced nucleotide substitution in Drosophila germ cells.

Sex-linked recessive lethal assay:
To provide a reference for comparing our mutation rates with those of previous mutagenesis screens, we next carried out a sex-linked recessive lethal (SLRL) assay, again using a 50-mM concentration of EMS. The mating scheme and results are shown in Fig 3. A total of 39.4% of the mutagenized X chromosomes we tested carried a recessive lethal mutation. Assuming a Poisson distibution, this corresponds to a mean rate of 0.50 lethal mutations per X chromosome. This SLRL rate is within the range obtained with EMS concentrations frequently used in mutagenesis screens (ASHBURNER 1989 Down; GREENSPAN 1997 Down).



View larger version (21K):
In this window
In a new window
Download PPT slide
 
Figure 3. Sex-linked recessive lethal assay. The asterisk represents a potentially mutagenized X chromosome.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

There are several noteworthy aspects to our results. First, we found that the DHPLC screening method worked very well for the targeted recovery of mutant Drosophila strains. We recovered mutations in the awd gene at a high rate, ~4.8 mutations/kb for every 1000 mutagenized chromosomes. We predict that similarly high mutation rates will be obtained for other genes, as there is no evidence to indicate that the awd locus is an unusual mutational hotspot. If anything, the screen of TIMMONS et al. 1995 Down suggests that the awd gene may be relatively resistant to the recovery of strong EMS-induced mutations. Since the genetic crosses can be readily modified to recover mutations on other chromosomes, the DHPLC method should be useful for recovering mutations in any Drosophila DNA regions that can be mutagenized chemically.

The DHPLC method should also prove useful for the targeted recovery of mutations in a variety of experimental organisms. Indeed, MCCALLUM et al. 2000 Down have recently taken a similar approach to recover EMS-induced mutations in Arabidopsis. Furthermore, CHEN et al. 2000 Down used a direct sequencing approach to identify N-ethyl-N-nitrosourea-induced mutations in mouse embryonic stem cells. DHPLC offers a cost-effective alternative to using sequencing as the primary screening assay.

The DHPLC method offers the significant advantages that mutations can be recovered independently of preselected phenotypes; that an entire allelic series of mutations can, in principle, be obtained; and that there is flexibility as to the choice of mutagen employed. The DHPLC assay will detect most classes of mutation (OEFNER and UNDERHILL 1998 Down). It will fail primarily for the subset of mutations that interfere with the generation of the PCR product, such as deletions of the DNA recognized by the oligonucleotide primers.

In general, how many of the recovered mutations will be informative for the study of protein function? In the case of EMS mutagenesis, with its strong preference for GC-to-AT transitions, we calculate that approximately two-thirds of these mutations in coding regions will result in an amino acid substitution or stop codon. The percentage of such changes that sufficiently alter protein function to cause a mutant phenotype will likely be gene specific.

Second, our data indicate that routine EMS mutagenesis in Drosophila generates a large number of chromosomal lesions. There are many variables that could influence the rate and type of mutation generated. These factors include the mutagen and concentration used, the stage of the sperm when mutagenized, the genetic background of the stocks, which generation of progeny are assayed, and whether the parental females are forced to store sperm (reviewed in ASHBURNER 1989 Down). Nevertheless, using the SLRL assay as an approximate guide, our results suggest that EMS can induce up to hundreds of mutations per chromosome under conditions similar to those often employed. While many of these mutations will be silent, it cannot be ignored that some might contribute to mutant phenotypes if not removed.

Third, we observed a level of specificity for EMS mutagenesis not reported previously in Drosophila. While the preference for GC-to-AT transitions was expected (PASTINK et al. 1991 Down), our results indicate a strong bias for 5'-PuG-3' sites and for G within a stretch of three or more G bases. This EMS mutational spectrum in Drosophila germ cells is distinct from that observed in yeast (KUNZ et al. 1992 Down), but is consistent with that observed in mammalian tissue culture cells (KLUNGLAND et al. 1995 Down; BELOUCHI et al. 1996 Down; BRANDA et al. 1999 Down) and in bacteria at some concentrations of EMS (BURNS et al. 1986 Down; GLICKMAN et al. 1987 Down; but also see VIDAL et al. 1995 Down). This result supports the utility of Drosophila as a model system for studying DNA repair mechanisms.

Finally, we foresee several modifications that will ultimately improve the efficiency of the technique. The pooling of flies, prior to DNA isolation, will increase the speed and cost effectiveness of the method. For the experiments described here, we assayed each heterozygous male individually by DHPLC to decrease the likelihood of missing new mutations. We later tested each mutation recovered and found that all mutations could still be detected when heterozygous flies were pooled with two Oregon-R flies (data not shown). At higher dilutions of the mutant chromosomes, a subset of mutations was not detected reliably.

Additionally, the DHPLC method can be used to more precisely identify the in vivo Drosophila mutational spectra of other chemical mutagens, under various experimental conditions. This information should make it possible to correlate specific mutagens and conditions with sequence-specific mutational hotspots. Combined with knowledge of the genomic sequence of the target genes, these data will allow for a better optimization of chemical mutagenesis screens.


*  ACKNOWLEDGMENTS

Timothy Parke and Kasia Lipska provided technical assistance during the early phases of this research. We thank Evie Hersperger and Allen Shearn for supplying mutant awd stocks, and Kathy Mathews and Kevin Cook of the Indiana University Drosophila Stock Center for additional strains. We also thank William Lee and members of our laboratory and department for helpful discussions. Work in the Dearolf laboratory was supported by funds from the Massachusetts General Hospital Department of Pediatrics and from the National Institutes of Health.

Manuscript received May 5, 2000; Accepted for publication July 13, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000  The genome sequence of Drosophila melanogaster.. Science 287:2185-2195[Abstract/Free Full Text].

ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BELOUCHI, A., M. OUIMET, P. DION, N. GAUDREAULT, and W. E. C. BRADLEY, 1996  Influence of alkyltransferase activity and chromosomal locus on mutational hotspots in Chinese hamster ovary cells. Proc. Natl. Acad. Sci. USA 93:121-125[Abstract/Free Full Text].

BIGGS, J., N. TRIPOULAS, E. HERSPERGER, C. DEAROLF, and A. SHEARN, 1988  Analysis of the lethal interaction between the prune and Killer of prune mutations of Drosophila.. Genes Dev. 2:1333-1343[Abstract/Free Full Text].

BRANDA, R. F., A. R. LAFAYETTE, J. P. O'NEILL, and J. A. NICKLAS, 1999  The effect of folate deficiency on the hprt mutational spectrum in Chinese hamster ovary cells treated with monofunctional alkylating agents. Mutat. Res. 427:79-87[Medline].

BURNS, P. A., F. L. ALLEN, and B. W. GLICKMAN, 1986  DNA sequence analysis of mutagenicity and site specificity of ethyl methanesulfonate in Uvr+ and UvrB- strains of Escherichia coli.. Genetics 113:811-819[Abstract/Free Full Text].

CHEN, Y., D. YEE, K. DAINS, A. CHATTERJEE, and J. CAVALCOLI et al., 2000  Genotype-based screen for ENU-induced mutations in mouse embryonic stem cells. Nat. Genet. 24:314-317[Medline].

DEAROLF, C. R., E. HERSPERGER, and A. SHEARN, 1988  Developmental consequences of awdb3, a cell-autonomous lethal mutation of Drosophila induced by hybrid dysgenesis. Dev. Biol. 129:159-168[Medline].

GLICKMAN, B. W., M. J. HORSFALL, A. J. GORDON, and P. A. BURNS, 1987  Nearest neighbor affects G:C to A:T transitions induced by alkylating agents. Environ. Health Perspect. 76:29-32[Medline].

GREENSPAN, R. J., 1997 Fly Pushing. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

KLUNGLAND, A., K. LAAKE, E. HOFF, and E. SEEBERG, 1995  Spectrum of mutations induced by methyl and ethyl methanesulfonate at the hprt locus of normal and tag expressing Chinese hamster fibroblasts. Carcinogenesis 16:1281-1285[Abstract/Free Full Text].

KUNZ, B. A., M. GABRIEL, X. KANG, S. E. KOHALMI, and K. A. TERRICK, 1992  DNA repair modifies the site and strand specificity of ethyl methanesulfonate mutagenesis in yeast. Mutagenesis 7:461-469[Abstract/Free Full Text].

LEWIS, E. B. and F. BACHER, 1968  Methods of feeding ethyl methane sulfonate (EMS) to Drosophila males. Dros. Inf. Serv. 43:193.

LOECHLER, E. L., C. L. GREEN, and J. M. ESSIGMANN, 1984  In vivo mutagenesis by O6-methylguanine built into a unique site in a viral genome. Proc. Natl. Acad. Sci. USA 81:6271-6275[Abstract/Free Full Text].

MCCALLUM, C. M., L. COMAI, E. A. GREENE, and S. HENIKOFF, 2000  Targeted screening for induced mutations. Nat. Biotechnol. 18:455-457[Medline].

O'DONOVAN, M. C., P. J. OEFNER, S. ROBERTS, J. AUSTIN, and C. GUY et al., 1998  Blind analysis of denaturing high performance liquid chromatography as a tool for mutation detection. Genomics 52:44-49[Medline].

OEFNER, P. J., and P. A. UNDERHILL, 1998 DNA mutation detection using denaturing high-performance liquid chromatography (DHPLC), in Current Protocols in Human Genetics. Wiley & Sons, New York. Suppl. 19, 7.10.1–7.10.12.

PASTINK, A., E. HEEMSKERK, M. J. M. NIVARD, C. J. VAN VLIET, and E. W. VOGEL, 1991  Mutational specificity of ethyl methanesulfonate in excision-repair-proficient and deficient strains of Drosophila melanogaster.. Mol. Gen. Genet. 229:213-218[Medline].

ROSENGARD, A., H. KRUTZSCH, A. SHEARN, J. BIGGS, and E. BARKER et al., 1989  Reduced Nm23/Awd protein in tumour metastasis and aberrant Drosophila development. Nature 342:177-180[Medline].

SNOW, E. T., R. S. FOOTE, and S. MITRA, 1984  Base-pairing properties of O6-methylguanine in template DNA during in vitro DNA replication. J. Biol. Chem. 259:8095-8100[Abstract/Free Full Text].

STURTEVANT, A. H., 1956  A highly specific complementary lethal system in Drosophila melanogaster.. Genetics 41:118-123[Free Full Text].

TIMMONS, L., J. XU, G. HERSPERGER, X.-F. DENG, and A. SHEARN, 1995  Point mutations in awdK-pn which revert the prune/Killer of prune lethal interaction affect conserved residues that are involved in nucleoside diphosphate kinase substrate binding and catalysis. J. Biol. Chem. 270:23021-23030[Abstract/Free Full Text].

UNDERHILL, P. A., L. JIN, R. ZEMANS, P. J. OEFNER, and L. L. CAVALLI-SFORZA, 1996  A pre-Columbian human Y chromosome-specific C to T transition and its implications for human evolution. Proc. Natl. Acad. Sci. USA 93:196-200[Abstract/Free Full Text].

VIDAL, A., N. ABRIL, and C. PUEYO, 1995  DNA repair by Ogt alkyltransferase influences EMS mutational specificity. Carcinogenesis 16:817-821[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
GeneticsHome page
J. L. Cooper, E. A. Greene, B. J. Till, C. A. Codomo, B. T. Wakimoto, and S. Henikoff
Retention of Induced Mutations in a Drosophila Reverse-Genetic Resource
Genetics, September 1, 2008; 180(1): 661 - 667.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. Cuppen, E. Gort, E. Hazendonk, J. Mudde, J. van de Belt, I. J. Nijman, V. Guryev, and R. H.A. Plasterk
Efficient target-selected mutagenesis in Caenorhabditis elegans: Toward a knockout for every gene
Genome Res., May 1, 2007; 17(5): 649 - 658.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
S. Winkler, A. Schwabedissen, D. Backasch, C. Bokel, C. Seidel, S. Bonisch, M. Furthauer, A. Kuhrs, L. Cobreros, M. Brand, et al.
Target-selected mutant screen by TILLING in Drosophila
Genome Res., May 1, 2005; 15(5): 718 - 723.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
C. J. Pozniak, I. T. Birk, L. S. O'Donoughue, C. Menard, P. J. Hucl, and B. K. Singh
Physiological and Molecular Characterization of Mutation-Derived Imidazolinone Resistance in Spring Wheat
Crop Sci., July 1, 2004; 44(4): 1434 - 1443.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Henikoff, B. J. Till, and L. Comai
TILLING. Traditional Mutagenesis Meets Functional Genomics
Plant Physiology, June 1, 2004; 135(2): 630 - 636.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. J. Koundakjian, D. M. Cowan, R. W. Hardy, and A. H. Becker
The Zuker Collection: A Resource for the Analysis of Autosomal Gene Function in Drosophila melanogaster
Genetics, May 1, 2004; 167(1): 203 - 206.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. Wienholds, F. van Eeden, M. Kosters, J. Mudde, R. H.A. Plasterk, and E. Cuppen
Efficient Target-Selected Mutagenesis in Zebrafish
Genome Res., December 1, 2003; 13(12): 2700 - 2707.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. A. Greene, C. A. Codomo, N. E. Taylor, J. G. Henikoff, B. J. Till, S. H. Reynolds, L. C. Enns, C. Burtner, J. E. Johnson, A. R. Odden, et al.
Spectrum of Chemically Induced Mutations From a Large-Scale Reverse-Genetic Screen in Arabidopsis
Genetics, June 1, 2003; 164(2): 731 - 740.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Nairz, H. Stocker, B. Schindelholz, and E. Hafen
High-resolution SNP mapping by denaturing HPLC
PNAS, August 6, 2002; 99(16): 10575 - 10580.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
E. Wienholds, S. Schulte-Merker, B. Walderich, and R. H. A. Plasterk
Target-Selected Inactivation of the Zebrafish rag1 Gene
Science, July 5, 2002; 297(5578): 99 - 102.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
Y. S. Rong, S. W. Titen, H. B. Xie, M. M. Golic, M. Bastiani, P. Bandyopadhyay, B. M. Olivera, M. Brodsky, G. M. Rubin, and K. G. Golic
Targeted mutagenesis by homologous recombination in D. melanogaster
Genes & Dev., June 15, 2002; 16(12): 1568 - 1581.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
A. Premstaller, W. Xiao, H. Oberacher, M. O'Keefe, D. Stern, T. Willis, C. G. Huber, and P. J. Oefner
Temperature-Modulated Array High-Performance Liquid Chromatography
Genome Res., November 1, 2001; 11(11): 1944 - 1951.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
T. Colbert, B. J. Till, R. Tompa, S. Reynolds, M. N. Steine, A. T. Yeung, C. M. McCallum, L. Comai, and S. Henikoff
High-Throughput Screening for Induced Point Mutations
Plant Physiology, June 1, 2001; 126(2): 480 - 484.
[Full Text] [PDF]


Home page
Genome ResHome page
P. C. Ng and S. Henikoff
Predicting Deleterious Amino Acid Substitutions
Genome Res., May 1, 2001; 11(5): 863 - 874.
[Abstract] [Full Text]


Home page
Genome ResHome page
R. A. Hoskins, A. C. Phan, M. Naeemuddin, F. A. Mapa, D. A. Ruddy, J. J. Ryan, L. M. Young, T. Wells, C. Kopczynski, and M. C. Ellis
Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster
Genome Res., June 1, 2001; 11(6): 1100 - 1113.
[Abstract] [Full Text] [PDF]