Genetics, Vol. 155, 105-116, May 2000, Copyright © 2000

Regulatory Elements Required for Development of Caenorhabditis elegans Hermaphrodites Are Conserved in the tra-2 Homologue of C. remanei, a Male/Female Sister Species

Eric S. Haaga and Judith Kimblea,b
a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706
b Howard Hughes Medical Institute, University of Wisconsin, Madison, Wisconsin 53706

Corresponding author: Judith Kimble, HHMI/Department of Biochemistry, University of Wisconsin-Madison, 433 Babcock Dr., Madison, WI 53706., jekimble{at}facstaff.wisc.edu (E-mail)

Communicating editor: R. K. HERMAN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Caenorhabditis elegans hermaphrodite is essentially a female that produces sperm. In C. elegans, tra-2 promotes female fates and must be repressed to achieve hermaphrodite spermatogenesis. In an effort to learn how mating systems evolve, we have cloned tra-2 from C. remanei, the closest gonochoristic relative of C. elegans. We found its structure to be similar to that of Ce-tra-2 but its sequence to be divergent. RNA interference demonstrates that Cr-tra-2 promotes female fates. Two sites of tra-2 regulation are required for the onset of hermaphrodite spermatogenesis in C. elegans. One, the MX region of TRA-2, is as well conserved in C. remanei as it is in C. briggsae (another male/hermaphrodite species), suggesting that this control is not unique to hermaphrodites. Another, the DRE/TGE element of the tra-2 3' UTR, was not detected by sequence analysis. However, gel-shift assays demonstrate that a factor in C. remanei can bind specifically to the Cr-tra-2 3' UTR, suggesting that this translational control is also conserved. We propose that both controls are general and do not constitute a novel "switch" that enables sexual mosaicism in hermaphrodites. However, subtle quantitative or qualitative differences in their employment may underlie differences in mating system seen in Caenorhabditis.


A particularly fruitful way to study the mechanisms underlying the evolution of phenotypic diversity has been to compare a well-studied model taxon with a close relative that differs from it in a significant way. There are two main advantages to this approach. First is the minimization of phylogenetic "noise," or molecular divergence due to separation of lineages that are not relevant to the evolving character in question. Second, by choosing well-characterized model organisms one can select a phylogenetically variable trait that has already been dissected in detail. This basic approach has been applied successfully to discover mechanisms underlying variation in larval form in ascidians (SWALLA et al. 1993 Down) and sea urchins (RAFF 1992 Down); vulval patterning (EIZINGER et al. 1999 Down), gonadal shape (FELIX and STERNBERG 1996 Down), and male tail development (FITCH and EMMONS 1995 Down) in nematodes; and appendage patterning in insects (WEATHERBEE et al. 1999 Down), among others. Recent studies on the mechanisms underlying intraspecific variation in development can be viewed as extreme examples of this methodology (e.g., MACKAY 1995 Down; DOEBLEY et al. 1997 Down; DE BONO and BARGMANN 1998 Down).

The evolution of mating systems is a major topic of theoretical and experimental research in evolutionary biology (e.g., DARWIN 1877 Down; CHARLESWORTH 1984 Down; SASSAMAN 1989 Down; PANNELL 1997A Down, PANNELL 1997B Down), but little is known about the mechanisms that underlie transitions from one mating system to another. Species in the nematode genus Caenorhabditis produce either males and females (gonochorism or dioecy) or males and self-fertile hermaphrodites (androdioecy). Gonochorism is thought to be ancestral in the family Rhabditidae, with androdioecy evolving independently multiple times in different clades (FITCH 1997 Down). The widely studied model Caenorhabditis elegans is one of the few organisms for which detailed mechanisms of sex determination are known, and it is an androdioecious species. Closely related congeners, such as C. remanei, are gonochoristic, relying on males and females for reproduction. Caenorhabditis therefore offers a unique opportunity to study the genetic basis of variation in mating system. We have begun a comparison of sex determination mechanisms in C. elegans and C. remanei. Because C. elegans hermaphrodites are essentially females whose ovotestes first produce sperm, which are stored, and thereafter make only oocytes, the variable character distinguishing these two mating systems can be conceptually narrowed to the presence or absence of spermatogenesis by the egg-producing sex.

In the C. elegans hermaphrodite germline, gamete sex is controlled by regulatory genes that function throughout the animal, so-called global sex-determining genes, as well as genes that control sex determination specifically in the germline (reviewed by MEYER 1997 Down) (Fig 1). The onset of hermaphrodite spermatogenesis relies on the germline repression of the tra-2 gene, which promotes female development in all tissues, whereas the switch from spermatogenesis to oogenesis relies on the germline repression of the fem-3 gene, which promotes male development in all tissues (reviewed in PUOTI et al. 1997 Down). In addition to these negative controls on tra-2 and fem-3 mRNAs and protein, the TRA-2 protein may directly repress FEM-3 protein by binding (MEHRA et al. 1999 Down).



View larger version (11K):
In this window
In a new window
Download PPT slide
 
Figure 1. Simplified model for control of germline sex determination in C. elegans. The tra-2 gene promotes oogenesis by repressing fem-3, a negative regulation that may involve the direct binding of FEM-3 protein by TRA-2 protein. Genes or factors implicated in translational repression of the tra-2 mRNA include DRF/GLD-1 (JAN et al. 1999 Down), FOG-2 (SCHEDL and KIMBLE 1988 Down; T. SCHEDL, personal communication), and laf-1 (GOODWIN et al. 1997 Down). Factors that repress fem-3 translation include FBF (ZHANG et al. 1997 Down), NOS (KRAEMER et al. 1999 Down), and perhaps the MOG proteins (PUOTI and KIMBLE 1999 Down). Four other genes, fem-1, fem-2, fog-1, and fog-3, act at the same position in this pathway as fem-3 to promote spermatogenesis; these four were left out of the diagram because they are not known to be regulated to achieve the switch from spermatogenesis to oogenesis.

The repression of tra-2 that is responsible for the onset of hermaphrodite spermatogenesis in C. elegans occurs on at least two levels. One control element resides in the tra-2 3' untranslated region (UTR); this element, called the DRE for direct repeat element, inhibits translation of tra-2 mRNA (GOODWIN et al. 1993 Down). A second control element resides in the C terminus of the TRA-2 protein; this MX (mixed character of mutations in the element) regulatory region is proposed to downregulate activity of TRA-2 by an unknown mechanism (KUWABARA et al. 1998 Down). C. elegans tra-2 produces a transcript that encodes an integral membrane protein, called TRA-2A, and two smaller mRNAs encoding TRA-2B, which is essentially the cytoplasmic portion of TRA-2A (OKKEMA and KIMBLE 1991 Down; KUWABARA et al. 1992 Down). We use the general term tra-2 or TRA-2 when referring to features shared by both of these RNAs or proteins. Thus, the transcripts encoding TRA-2A and TRA-2B share the same 3' UTR and therefore are both controlled by DRE regulation. Similarly, the proteins TRA-2A and TRA-2B share the same C terminus and therefore are both controlled by MX regulation. Furthermore, both TRA-2A and TRA-2B share the FEM-binding site (MEHRA et al. 1999 Down).

Three germline-specific regulators have been identified that mediate DRE regulation by the tra-2 3' UTR. These include DRFQ2/GLD-1, a protein that specifically binds the DRE (GOODWIN et al. 1993 Down) and controls tra-2 translation (JAN et al. 1999 Down); FOG-2, a protein that binds GLD-1 and is required for the onset of hermaphrodite spermatogenesis (SCHEDL and KIMBLE 1988 Down; T. SCHEDL, personal communication); and laf-1, a gene that has not yet been identified at the molecular level (GOODWIN et al. 1997 Down) (Fig 1). The regulator acting through the MX region is not yet known.

The DRE and MX control elements were identified genetically by the isolation of dominant feminizing tra-2 regulatory mutations that abrogate repression and eliminate hermaphrodite spermatogenesis (DONIACH 1986 Down; SCHEDL and KIMBLE 1988 Down). The DRE and MX mutations are known as tra-2(gf) and tra-2(mx) mutations, respectively. The fog-2 gene was identified genetically by the isolation of recessive feminizing mutations (SCHEDL and KIMBLE 1988 Down). Of particular interest to our thinking about transitions between mating systems in evolution, we note that tra-2(mx), tra-2(gf), and fog-2(null) mutants with two XX chromosomes develop as females rather than as hermaphrodites and can be maintained with their XO counterparts as male/female strains (DONIACH 1986 Down; SCHEDL and KIMBLE 1988 Down). It is therefore possible that hermaphroditism may have evolved from gonochorism by the creation or modification of these elements, and, conversely, that male/female strains may have evolved by regression from androdioecious strains via the loss of one or more of the elements.

We have begun our dissection of germline controls of sexual fate in C. remanei by analysis of its tra-2 homologue, Cr-tra-2. Our choice of tra-2 as a starting point in this study was based on the idea that the initiation of hermaphrodite spermatogenesis might be more primary in the evolution of hermaphroditism than the switch to oogenesis. However, we presume that the mechanisms controlling the initiation of spermatogenesis as well as its termination must have evolved in concert to allow continuous fertility of the ancestral form. We imagine, for example, that the fem male-promoting genes might have been repressed in the germline of the common female ancestor, but that a transient repression of tra-2 might have released the fem genes to permit the transient production of sperm. In addition, our choice of tra-2 was based on the practical consideration that a tra-2 homologue had been obtained from the sister gonochoristic species C. briggsae (KUWABARA 1996A Down), but efforts to isolate a fem-3 homologue from C. briggsae have been futile to date.

In this article we present evidence that Cr-tra-2 promotes female fates in both germline and soma, as was previously shown for Ce-tra-2 (HODGKIN and BRENNER 1977 Down) and Cb-tra-2 (KUWABARA 1996A Down). By sequence analysis, the MX domain appears to be conserved in Cr-tra-2. Although no DRE element is detectable by sequence analysis of the Ce-tra-2 3' UTR, DRF (direct repeat factor)/GLD-1 binding does appear to occur, suggesting that the regulatory site is present but not recognizable. Finally, the FEM-3-binding region differs substantially between Cr-tra-2 on the one hand and the Ce and Cb-tra-2 homologs on the other. We discuss these findings with respect to the potential role of tra-2 in the evolution of hermaphroditism.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Nematode strains and culture:
C. remanei strain SB146 was obtained from the Caenorhabditis Genetic Center (CGC; Univ. of Minnesota, St. Paul). C. elegans strain N2 was also obtained from the CGC. C. remanei culture conditions are essentially identical to those for C. elegans (WOOD 1988 Down), with the exception that growth on plates is facilitated by use of 3% agar to prevent burrowing. A note on taxonomy: the taxonomy of two strains relevant to this work has been revised recently. Strain EM464, now considered a subspecies of C. remanei (SUDHAUS and KIONTKE 1996 Down), was initially described as C. vulgaris (BAIRD et al. 1994 Down; FITCH et al. 1995 Down). Strain CB5161, formerly regarded by the Caenorhabditis Genetics Center as C. remanei, is now known to be a distinct species and an outgroup to the elegans/briggsae/remanei clade (THOMAS and WILSON 1991 Down; FITCH et al. 1995 Down; BALDWIN et al. 1997 Down).

Preparation of genomic DNA:
For preparation of genomic DNA, worms from densely grown plates were used to seed a 500-ml liquid culture as described in WOOD 1988 Down. As C. remanei animals must mate to reproduce, the liquid culture was allowed to sit without shaking for 2 hr per day until the culture was near saturation (300 worms/ml). Worms were harvested by centrifugation and washed with M9 salts (WOOD 1988 Down). Clean, concentrated whole worms were washed once with disruption buffer (DB: 200 mM NaCl, 50 mM EDTA, 100 mM Tris, pH 8.5) and then resuspended in five volumes of DB with the addition of sodium dodecyl sulfate to 0.5% and proteinase K to 200 µg/ml. After incubation with intermittent mixing at 65° for 1 hr, the solution was diluted in DB, extracted with phenol/chloroform, and precipitated with isopropanol. The DNA was gently resuspended in 10 mM Tris, pH 8.0, 1 mM EDTA (TE) and treated with RNAse A. Genomic DNA was precipitated with ammonium acetate and isopropanol, followed by centrifugation at room temperature. Pelleted DNA was resuspended in TE overnight at 4°.

Construction of a C. remanei genomic library:
Insert DNA was prepared by partial digestion of C. remanei genomic DNA with Sau3A, followed by size selection on an agarose gel. The gel section was frozen and spun through a spin filter (Costar, Corning, NY). The resulting DNA solution was extracted with phenol/chloroform and precipitated with sodium acetate and ethanol. The 5' overhang resulting from Sau3A digestion was partially filled in with dGTP, dATP, and Klenow fragment according to a scaled-down version of the vector kit's protocol (Lambda Fix II phage vector, Stratagene, La Jolla, CA). After phenol/chloroform extraction and precipitation, the insert DNA was quantified and then ligated to phage vector that had been prepared by the vendor via digestion with XhoI and partial fill-in. Ligation was performed according to manufacturer's instructions, and the resulting products were packaged with Gigapack III extracts (Stratagene). A total of 167,000 independent clones were amplified.

Library screening:
Basic solutions and procedures for hybridizations are described in SAMBROOK et al. 1989 Down. A 1.1-kb C. elegans ppp-1 genomic fragment was amplified by PCR from cosmid ZK513 (kindly provided by Dr. Alan Coulson) using the forward primer pppF (5' TCAGCGATGCCAGTCTCATTC 3') and reverse primer pppR (5' GGTGACGTCAGCATTCTCTCCG 3'). This product was random-prime labeled with 32P and used first to optimize the signal with a genomic Southern blot of digested C. remanei DNA. The conditions were determined to be hybridization overnight at 45° in 5x SSPE 1% SDS, 10x Denhardt's reagent and 100 µg/ml yeast RNA, followed by washes whose maximal stringency was at 50° in 2x SSC with 0.1% SDS. Library screening was carried out with duplicate lifts on 160,000 pfu. Clone {lambda}CRP3 was verified by Southern blotting to contain the same ppp-1-positive restriction fragment seen in the preliminary genomic blot analysis and was chosen for extensive analysis. Clone {lambda}CRT5 was obtained by a second high-stringency screen of the genomic library with 160,000 pfu of the genomic library with an EcoRI subclone of {lambda}CRP3 encoding the interval from the 3' end of exon 7 to the 5' end of intron 15 of Cr-tra-2. To obtain Cr-tra-2 cDNA clones, 320,000 pfu from a C. remanei cDNA library (courtesy of David Rudel, Kimble Lab) were screened at high stringency using as probe the 3.1-kb XbaI fragment of {lambda}CRP3, which includes the 3' end of the clone, in the above hybridization solution.

Sequencing and computer analysis:
Sequencing of {lambda}CRP3 was accomplished by combining subcloning and vector priming with primer walking to fill gaps and resolve ambiguities. All cycle sequencing reactions used the ABI Prism FS Terminator or Big-Dye Terminator Ready Reaction Mix (PE/Applied BioSystems, Foster City, CA) and were run by the Blattner Lab sequencing service, Department of Genetics, UW-Madison. Sequence traces were inspected with the SeqMan program of the Lasergene software package (DNAstar, Madison, WI) to cull reliable data, which was then imported into a Unix workstation running the Wisconsin Package, v.9 or v.10 (Genetics Computer Group, Madison, WI) for further analysis.

RNA blot analysis:
A total of 10 µg of mixed-stage C. remanei poly(A)+ RNA (a gift of David Rudel) was electrophoresed, along with an RNA size standard, in a formaldehyde agarose gel using standard techniques (SAMBROOK et al. 1989 Down) and blotted to Nytran (Schleicher and Schuell, Keene, NH). A 32P-labeled DNA probe was prepared by random priming using the entire 1.5-kb insert of Cr-tra-2 cDNA clone RTC8. Hybridization and washing were performed under high-stringency conditions.

RNA interference:
Sense and antisense RNAs corresponding to exons 4–7B of Cr-tra-2 were synthesized with the MEGAscript kit (Ambion, Austin, TX) from linearized templates prepared from a 1.1-kb EcoRI fragment of {lambda}CRP3 subcloned in the pBluescript II plasmid vector (Stratagene). Equal amounts of each RNA were mixed, denatured, and annealed by slow cooling. The resulting dsRNA was injected into the distal gonad arm or gut of C. remanei females using standard C. elegans procedures (FIRE et al. 1998 Down). Injectees were returned to plates with two males, allowed to lay embryos, and transferred with their mates each day to new plates to stage the progeny.

RNA gel-shift assay:
PCR was used to amplify the Cr-tra-2 3' UTR from cDNA clones RTC7 and RTC8, which were then cloned via terminal restriction sites in pBluescript II. C. elegans wild-type (N2) and tra-2(e2020) templates were a generous gift of Eric Jan and Elizabeth Goodwin. 32P-labeled probes were synthesized by in vitro transcription of linearized templates and gel purified. Cold N2 3' UTR competitor RNA was produced using the MEGAscript kit. Extracts from C. elegans and C. remanei worms, as well as all other reagents, were made according to the method of GOODWIN et al. 1993 Down with the exception that no magnesium was added to the extracts. Binding reactions and native polyacrylamide gel electrophoresis were also carried out according to GOODWIN et al. 1993 Down.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Cloning Cr-tra-2:
In both C. elegans and C. briggsae, tra-2 is transcribed as the downstream gene in an operon; in both cases, its upstream neighbor is ppp-1, which encodes pyrophosphorylase. KUWABARA 1996A Down; KUWABARA and SHAH 1994 Down showed that the C. elegans and C. briggsae ppp-1 genes were conserved enough to allow cross-hybridization, even though their corresponding tra-2 homologues were divergent. Furthermore, the coding sequences from C. elegans, C. remanei, and C. briggsae are in general conserved similarly in all pairwise combinations (THOMAS and WILSON 1991 Down; FITCH et al. 1995 Down; D. RUDEL, unpublished data). Therefore, we screened a C. remanei genomic library at low stringency with a C. elegans ppp-1 probe (see MATERIALS AND METHODS). We initially recovered a single clone, {lambda}CRP3, containing both a C. remanei ppp-1 homologue (Cr ppp-1) and nearly all of Cr-tra-2, lacking only the last 115 codons and 3' UTR. To extend this, the genomic library was again screened at high stringency with a subclone of {lambda}CRP3. This screen yielded one clone, {lambda}CRT5, that extended further 3' than {lambda}CRP3, but it was also truncated prematurely at the stop codon. The 3' UTR of Cr-tra-2 was obtained by screening a C. remanei cDNA library (courtesy of D. Rudel) at high stringency, which yielded three overlapping clones, RTC7 (2.2 kb), RTC8 (1.5 kb), and RTC11 (1.7 kb). The three cDNAs also contain two slightly different 3' UTR sequences (see below and in Fig 6). As C. remanei is an obligately outcrossing species, this may represent allelic variation that has persisted despite the frequent inbreeding imposed by routine laboratory propagation. Southern blots indicate that only one copy of the ppp-1/tra-2 gene pair is present in the C. remanei genome (not shown).



View larger version (22K):
In this window
In a new window
Download PPT slide
 
Figure 2. Exon-intron structure of C. remanei tra-2 compared with that of C. elegans tra-2. Exons, solid rectangles; introns, joining lines. Cr-tra-2 exons and introns (A) are numbered to be consistent with their homologues in Ce-tra-2 (B). The full-length Cr 4.7-kb mRNA, which encodes TRA-2A, may be trans-spliced at its 5' end as is the case for Ce-tra-2, but no evidence for such trans-splicing yet exists. Alternate exon 20A is found in the Cr 1.6-kb mRNA, which encodes TRA-2B, where it is predicted to serve as its 5' untranslated region. Introns with noteworthy length differences are indicated with brackets and the size in nucleotides. The genomic sequence of Cr-tra-2 has been submitted to GenBank under accession no. AF187965.



View larger version (101K):
In this window
In a new window
Download PPT slide
 
Figure 3. Alignment of TRA-2A homologues from C. elegans, C. remanei, and C. briggsae. Black boxes indicate amino acid identity; gray boxes indicate similarity, and unshaded residues are divergent. The conserved signal peptide (SP) is indicated at the N terminus; the inverted triangle denotes the EG amino acid at position 177 of Ce-tra-2A, which is thought to be required for negative regulation of TRA-2A by HER-1 (KUWABARA 1996B Down). Numbered solid overlines delineate the nine hydrophobic regions predicted to encode membrane-spanning domains by KUWABARA et al. 1992 Down. Their model of TRA-2A structure proposed that the hydrophobic amino acids 496–516 of Ce-tra-2A are not a transmembrane domain, and the alignment supports this proposal: Cb-tra-2 and Cr-tra-2 have two and three fewer hydrophobic residues, respectively, in this region. The arrow at position 1089 of the C. elegans sequence indicates the initiating methionine for TRA-2B, the cytoplasmic protein product of the smaller transcripts produced by both Ce-tra-2 and Cr-tra-2 (see text for details). The heavy dashed line overline denotes the FEM-3-binding region (MEHRA et al. 1999 Down). Asterisks near the C terminus indicate amino acids required for the MX domain (KUWABARA et al. 1998 Down).



View larger version (36K):
In this window
In a new window
Download PPT slide
 
Figure 4. Cr-tra-2(RNAi) masculinizes both somatic and germline tissues. Mildly affected animals lacked a vulva, had an armless gonad containing sperm, and were of normal size. Moderately affected worms had a single-armed testis, a nearly normal female whip-like tail, and were smaller than normal. Severely affected animals had a well-formed testis, an imperfectly masculinized tail, and were very small. Data combine totals from 13 different RNAi and 8 mock-injected control injectees. All RNAi progeny that were not wild-type males were assumed to be genetically female (see text for rationale) and are grouped together. The numbers above each column indicate the total number of animals scored for each presumed genetic sex. The trends of decreasing brood size and viability among RNAi progeny seen in the two collection windows shown here continued until all injected animals were sterile by day 4 (not shown).



View larger version (58K):
In this window
In a new window
Download PPT slide
 
Figure 5. Sexual transformation of Cr-tra-2(RNAi) progeny. Nomarski differential interference contrast optics. (A) Pseudomale has a well-formed testis, sperm (outlined arrowhead), and an imperfectly transformed tail (white arrowhead). This animal is 5 days postpartum, but pseudomales never reached normal size. (B) Adult wild-type male (roughly 4 days postpartum). This male is ~50% larger in volume than the pseudomale in A. Both A and B are shown at identical magnification. Outlined arrowhead, sperm; white arrowhead, male tail.



View larger version (51K):
In this window
In a new window
Download PPT slide
 
Figure 6. Aligned sequences of two putative allelic variants of the Cr-tra-2 3' UTR. The sequences are from cDNA clones RTC7 and RTC11 (RTC8 is identical to RTC11). They differ at 6 positions out of 237 and are thus 97.5% identical. The consensus TGE sequence for DRF binding proposed by JAN et al. 1997 Down is 5' CUCA [n] CC/AA UUUC C/U U [n] UUUCU 3'. The two occurrences of CUCA in Cr-tra-2 are indicated in bold. Neither is associated with the complete consensus, although the sequence UUUCUU occurs immediately 3' from the CUCA at position 103. The putative polyadenylation sequence AAUAAA is shown in outlined text.

Cr-tra-2 gene structure and transcripts:
Fig 2 compares the predicted exon/intron structures of Cr-tra-2 and Ce-tra-2. Where cDNA sequence was available (the 3'-most 2.2 kb of exonic sequence), the splicing pattern was directly inferred. For the remaining 5' portion, it was deduced by comparing genomic DNA sequences of Cr-tra-2 with that of Ce-tra-2, in conjunction with the conceptual translations of these genes and that of Cb-tra-2. This analysis revealed that the splicing events producing the longer full-length tra-2 mRNA (predicted to be 4.7 kb) are generally conserved, but not identical to those of Ce-tra-2 (Fig 2). Differences include the split of two Ce-tra-2 exons, 7 and 22, into two smaller exons apiece (7A/7B and 22A/22B) in Cr-tra-2 and the union of Ce-tra-2 exons 12 and 13 into a single exon (12/13) in Cr-tra-2. Another noteworthy structural difference is the decreased size of introns 1 and 16 in Cr-tra-2 relative to Ce-tra-2.

In addition to a full-length mRNA encoding TRA-2A, Ce-tra-2 also produces two shorter transcripts of 1.8 kb and 1.9 kb that encode only the cytoplasmic domain, called TRA-2B (OKKEMA and KIMBLE 1991 Down; KUWABARA et al. 1998 Down). Cb-tra-2 does not appear to produce these smaller RNAs (KUWABARA 1996A Down), but cDNA sequence and RNA blot analysis suggests that Cr-tra-2 makes a TRA-2B-encoding mRNA. A unique 5' sequence of 69 nucleotides (nt) in clone RTC11, encoded by an alternative exon lying within intron 20, suggests that a 5'-truncated transcript is produced, perhaps from an internal promoter lying inside this large intron. The transcript represented by RTC11 is predicted to encode a peptide exactly colinear with that encoded by the small transcripts produced by Ce-tra-2 (OKKEMA and KIMBLE 1991 Down; KUWABARA et al. 1998 Down). However, the putative promoter for the C. elegans 1.8-kb transcript apparently resides in a different large intron, intron 17, and includes only exons shared with the full-length 4.7-kb Ce-tra-2 mRNA (KUWABARA et al. 1998 Down). Both the 1.8-kb and 1.9-kb Ce-tra-2 transcripts and the Cr-tra-2 transcript corresponding to RTC11 are predicted to use a common start methionine codon that resides in exon 21, so that the Ce-tra-2 mRNA includes exons 18–20 as a 5' untranslated region, whereas that of Cr-tra-2 does not (Fig 2).

The predicted minimum transcript size of the RTC11-type Cr-tra-2 mRNA is 1639 nt, plus polyadenylation. To verify that RTC11 corresponds to a bona fide mRNA, we probed blots of C. remanei RNA with the 3'-most 1.5 kb of the Cr-tra-2 coding sequence. This probe identified a prominent RNA of ~4.7 kb, corresponding to the full-length Cr-tra-2A-encoding message, as well as a weak band at ~1.6 kb (data not shown). We have not been able to verify the precise 5' end of the alternative exon 20, but if RTC11 corresponds to the 1.6-kb transcript it is not much larger than the 69 nt contained in this cDNA.

The Cr-tra-2 sequence and comparison with its homologues:
A comparison of the amino acid sequences of Cr-tra-2A with both Ce-tra-2A and Cb-tra-2A reveals a conserved architecture, but a divergent sequence (Fig 3). The overall sequence similarity between Cr-tra-2 and its homologues is quite low: 54.8% (vs. Ce-tra-2) and 57.4% (vs. Cb-tra-2) nucleotide identity for coding sequences, 43.4% (vs. Ce-tra-2) and 49.9% (vs. Cb-tra-2) identity for amino acid sequences (see Table 1). However, all three tra-2 homologs possess a predicted signal peptide and nine predicted transmembrane domains (SP region and solid overlines in Fig 3). Of particular importance for this article, the MX domain in the cytoplasmic region of both TRA-2A and TRA-2B appears to be conserved. The tra-2(mx) alleles of C. elegans are caused by missense mutations in five different codons that are predicted to result in nonconservative amino acid changes (KUWABARA et al. 1998 Down); four of these five amino acids are conserved in all three species (asterisks, Fig 3). The fifth residue is a conservative substitution shared by Cr-tra-2 and Cb-tra-2. In addition to the MX domain, the alignment also revealed that Cr-tra-2 possesses the enhanced gain-of-function (EG) site implicated in regulation of TRA-2A by her-1 (KUWABARA 1996B Down; inverted triangle, Fig 3) and that the N-terminal putative extracellular region is more highly conserved than most of the rest of the protein (54% between Cr-tra-2 and Ce-tra-2). By contrast, the FEM-3-binding region (MEHRA et al. 1999 Down) is poorly conserved (thick dashed overline, Fig 3; 20–25% between Cr-tra-2 and Ce-tra-2, depending on alignment parameter values). In addition, this region is shortest in Cr-tra-2, being 8 amino acids shorter than Ce-tra-2 and 11 shorter than Cb-tra-2. Although precise alignment of this region is difficult due to the lack of conservation, the plausible version shown in Fig 3 suggests that the length difference is primarily due to a 22-amino-acid deletion in Cr-tra-2, near the center of the domain, relative to C. briggsae. Ce-tra-2 appears to possess 16 of these residues. We conclude that the Cr-tra-2 protein shares most features with Ce-tra-2 and Cb-tra-2, but that one potentially key region, the FEM-3-binding domain, is more similar in the two hermaphroditic species than in C. remanei.


 
View this table:
In this window
In a new window

 
Table 1. Sequence similarities between tra-2 homologues

Cr-tra-2 promotes female development in C. remanei:
To ask whether the cloned Cr-tra-2 homologue is in fact a sex-determining gene, we employed RNA interference (RNAi; GUO and KEMPHUES 1995 Down; FIRE et al. 1998 Down) to disrupt its activity in C. remanei. Using double-stranded (ds) RNA, we observed a range of masculinization among progeny of the injected mother (Fig 4). Thus, weakly masculinized animals were vulvaless (Vul) with gonads containing only sperm; moderately affected animals were Vul with a fully developed testis but whip-like tails characteristic of females; and severely transformed animals were pseudomales similar to tra-2 null mutants in C. elegans (Fig 5A). These pseudomales did not exhibit mating behavior, were unusually small (compare Fig 5A and Fig B), and were lethargic and uncoordinated. The near absence of wild-type females, a graded distribution of partially masculinized animals, and the large fraction of normal males led us to conclude that all non-wild-type male progeny were genetically female.

In addition to sexual transformation, dsRNAi with Cr-tra-2 also significantly reduced the number and viability of embryos laid by injected mothers relative to Tris-EDTA buffer (TE) mock-injected controls (Fig 4; P < 0.01 for both 22-hr laying windows, on the basis of binomial confidence limits as described in SOKAL and ROHLF 1995 Down). Although only data from the first two laying windows is shown, by the fourth window, broods dropped in both size and viability until injected mothers were laying only a few inviable embryos. Therefore, the Cr-tra-2 RNA may have interfered with germline function of the mother. In contrast, mothers mock-injected with TE actually increased their brood size in the second day after injection, with the viability of their progeny always being >97%. Many embryos of RNAi-treated mothers that failed to develop were obviously abnormal under the dissecting scope (not shown). In addition to the general decrease in viability of progeny, a sex-biased lethality was also seen. Only 87/236 (37%) of viable progeny laid in the first 22 hr and 76/179 (42%) in the second 22 hr were genetically female. These numbers are significantly different from the null hypothesis of equal sex ratios at the level of 0.01 for the first laying window and 0.05 for the second ({chi}2 test).

As no lethality had been observed in C. elegans tra-2 null mutants (HODGKIN and BRENNER 1977 Down; E. HAAG, unpublished observations), we also investigated whether RNAi directed against Ce-tra-2 resulted in such effects in C. elegans. Using dsRNA corresponding to the 5'-most 1.5 kb of the Ce-tra-2 coding sequence, we found that viability was comparable to that of uninjected animals over two 22-hr laying windows (98%, N = 877). Furthermore, Ce-tra-2(RNAi) mothers did not suffer the same decrease in brood size seen in the Cr-tra-2(RNAi) experiment and actually increased their progeny from 321 in the first laying window to 556 in the second, a recovery effect similar to that seen in TE-injected control animals. The Tra phenotype of Ce-tra-2(RNAi) progeny was 100% penetrant in the 22–44-hr laying window, though the extent of transformation, especially in the tail, was somewhat variable. Although no lethality was observed, 14% (78/556) of the pseudomales were unusually small. Closer inspection of these animals revealed that they had defects in defecation that resulted in a blocked posterior gut and gradual necrosis. The extent to which these animals were sexually transformed was not distinguishably different from that of other sibling pseudomales.

The Cr-tra-2 3' UTR binds a potential repressor in vitro:
In C. elegans, the DRE control elements of the tra-2 3' UTR bind DRF and repress translation (see Introduction). In the Cb-tra-2 3' UTR, DRE elements were not detected by sequence comparison (KUWABARA 1996A Down), but binding by DRF was observed using gel-shift assays (JAN et al. 1997 Down). As a result, Jan and colleagues defined a smaller motif, called the tra-gli element (TGE), as the repressor binding site. We inspected the Cr-tra-2 3' UTR sequence for either a DRE or TGE, but found neither (see Fig 6 and its legend). As a more stringent test than sequence comparison, which had also failed for Cb-tra-2, we used the gel mobility shift method of GOODWIN et al. 1993 Down to assay for DRF binding to the Cr-tra-2 3' UTR. We found that a factor present in C. remanei extract can bind either the Ce-tra-2 3' UTR (Fig 7, lane 4) or the Cr-tra-2 3' UTR (Fig 7, lane 8) in vitro under conditions used to demonstrate DRF binding in C. elegans. The specificity of this binding was explored in two ways. First, we asked if a mutant Ce-tra-2 3' UTR that lacks the DREs can bind factor in the C. remanei extract. The mutant used, tra-2(e2020), deletes 108 nucleotides from the 3' UTR, including both DREs. We found that this mutant probe did not shift after incubation with C. remanei extract. Second, we asked if binding of the factor to the Cr-tra-2 3' UTR could be inhibited by addition of unlabeled wild-type Ce-tra-2 3' UTR. To this end, we added either 10-fold or 100-fold wild-type competitor and found that binding by either the Ce-tra-2 3' UTR (Fig 7, lanes 5 and 6) or the Cr-tra-2 3' UTR (Fig 7, lanes 9 and 10) was inhibited. We conclude that the Ce-tra-2 and Cr-tra-2 3' UTRs are likely to compete for the same factor. Identical results were obtained when these same probes were incubated with extracts from wild-type C. elegans worms (not shown). We note that the C. elegans 3' UTR consistently produced a somewhat stronger shift than that of C. remanei (2.1-fold average over three experiments). Although this difference was reproducible in several experiments and observed using either C. elegans or C. remanei extract, its significance is not known.



View larger version (62K):
In this window
In a new window
Download PPT slide
 
Figure 7. Binding of a DRF-like factor to the Cr-tra-2 3' UTR. After incubation of 5 fmol labeled RNA probe with 2 µg C. remanei crude extract, free and bound forms were separated by gel electrophoresis (see MATERIALS AND METHODS). In certain incubations, unlabeled wild-type C. elegans tra-2 3' UTR RNA was added at 10- or 100-fold molar excess to the binding reactions as competitor. Both variants of the Cr-tra-2 3'UTR gave similar results; only data from the RTC7 probe are shown here. The Ce{Delta}108 probe deletes both DRE elements and was derived from C. elegans tra-2(e2020 gf); this probe does not bind DRF and when serving as a 3' UTR does not support translational repression. The Ce{Delta}108 lanes were aligned with the others for convenience.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Role of Cr-tra-2 in sex determination is conserved:
Several lines of evidence suggest that we have isolated the true Cr-tra-2 homologue and that its role in sex determination has been conserved. Like the C. elegans and C. briggsae tra-2 homologs, Cr-tra-2 lies in a putative operon just 3' of the Cr-ppp-1 gene; it encodes a large integral membrane protein with multiple predicted transmembrane domains; and it promotes female development in both somatic and germline tissues. In the simplest scenario, Cr-tra-2 would be predicted to interact with homologues of the same upstream and downstream genes as found in the sex determination pathway of C. elegans. This idea is supported by conservation of the EG site in the N terminus of TRA-2A, which is thought to mediate regulation by her-1 (Fig 6; KUWABARA 1996A Down), the conservation of fem-2 and tra-1 genes in C. briggsae (DE BONO and HODGKIN 1996 Down; HANSEN and PILGRIM 1998 Down), and the recent identification of a fem-1 homologue in both C. briggsae and C. remanei (J. GAUDET and A. SPENCE, personal communication). Therefore, sex determination in all three Caenorhabditis species appears to be controlled by a homologous regulatory pathway.

In addition to the expected masculinization of Cr-tra-2(RNAi) animals, severely transformed animals were much smaller than normal and Cr-tra-2(RNAi) embryos were less viable than controls. The lethal phenotype of Cr-tra-2(RNAi) embryos, furthermore, is biased toward, but not restricted to, females, which is reminiscent of C. elegans defects in dosage compensation (MEYER 1997 Down). However, neither the effects on brood size nor on viability of progeny were seen in a comparable RNAi experiment with Ce-tra-2. In C. elegans the only known maternal function of tra-2 is to decrease sperm number (KUWABARA et al. 1998 Down). Genetically female (XX) C. elegans tra-2 null mutants do not suffer lethality, but are transformed with complete penetrance into vigorous but nonmating pseudomales (HODGKIN and BRENNER 1977 Down). Therefore C. elegans tra-2(RNAi) animals closely resemble Ce-tra-2 null mutants, and thus if Cr-tra-2(RNAi) also reflects the null phenotype, tra-2 may perform a novel role in C. remanei in maintaining the viability of embryos, especially in genetically female animals. The presence of unusually small and feeble pseudomales among the Ce-tra-2(RNAi) animals, apparently rendered thus by a defecation defect, raises the possibility that the smallness of Cr-tra-2(RNAi) pseudomales is due to a similar defect and thus is distinct from embryonic lethality. While the small Cr-tra-2(RNAi) pseudomales did not show the same symptoms of a blocked gut (a large impacted mass of Escherichia coli dilating the posterior gut, prone to rupture upon handling of the animals), they did appear to be partially paralyzed posteriorly and thus we cannot rule out a common underlying defect for both phenotypes.

The gradual loss of fertility of injected C. remanei mothers indicates that continual zygotic tra-2 function may be required to maintain fertility. Temperature-shift experiments using a tra-2(ts) allele (KLASS et al. 1976 Down) indicate that young adult C. elegans hermaphrodites also require tra-2 function for maximal fertility, but that after 70 hr posthatching (~36 hr into adulthood at 25°) brood size is not reduced by shifting to restrictive temperature. This suggests that in C. elegans, unlike in C. remanei, tra-2 function is needed only transiently for normal fertility. Our results with Ce-tra-2(RNAi) support this scenario, as no decrease in brood size is observed in hermaphrodites injected ~24 hr after attaining adulthood. The reduced fertility of Cr-tra-2(RNAi) mothers is unlikely to be a general effect of the RNAi technique, as RNAi with two other C. remanei genes, Cr-lag-1 and Cr-glp-1, produced highly penetrant phenotypes of the expected sort in progeny, but did not adversely affect maternal fecundity in the first 48 hr after injection (E. HAAG and D. RUDEL, unpublished data).

Conservation of tra-2 is extensive among Caenorhabditis species and largely independent of mating system:
This work was motivated by our desire to find differences in the molecular regulation of sex determination in androdioecious species such as C. elegans and gonochoristic species such as C. remanei. We surmised that close gonochoristic relatives of C. elegans might not possess negative controls of tra-2 necessary for the onset of hermaphrodite spermatogenesis. Consistent with this idea, the germline of genetically female C. remanei animals was masculinized by reduction of Cr-tra-2 activity via RNAi. Despite these expectations and in spite of the large amount of sequence divergence in the three known tra-2 homologues, we provide evidence that Cr-tra-2 possesses both DRE/TGE and MX regulatory sites used for repression of its Ce-tra-2 homologue. While the Cr-tra-2 3' UTR binding factor has not been shown to be a translational repressor, the ability of the Ce-tra-2 3' UTR to bind this factor and the complementary ability of the Cr-tra-2 3' UTR to bind the C. elegans DRF suggests that these are homologous factors. Given that the Cr-tra-2 3' UTR does not contain a canonical TGE element (JAN et al. 1997 Down; legend to Fig 6), we suggest that the more broadly conserved feature may be a structural motif in the 3' UTR that is difficult to recognize from sequence gazing alone.

Given that the protein TRA-1 has recently been shown to regulate tra-2 mRNA localization by binding to its 3' UTR (GRAVES et al. 1999 Down), the concern exists that perhaps the factor binding the Cr-tra-2 3' UTR in these experiments is actually not DRF, but TRA-1. However, the tra-2(e2020) RNA that served as our negative control is known to bind TRA-1 (GRAVES et al. 1999 Down) and undergoes little or no shift upon incubation with crude extracts, both in our hands (Fig 7, lane 2) and in studies published by others (GOODWIN et al. 1993 Down; JAN et al. 1997 Down). As RNA binding by TRA-1 was demonstrated with purified protein, the endogenous protein may simply not be abundant enough in crude extracts to produce a detectable shift.

The tra-2 gene acts genetically as a repressor of fem-3 (HODGKIN 1986 Down). Furthermore, the cytoplasmic domain shared by TRA-2A and TRA-2B binds FEM-3 protein (MEHRA et al. 1999 Down). The inference is that the binding of FEM-3 by TRA-2 may inhibit FEM-3 activity, which might explain why a balance between tra-2 and fem-3 activity controls sperm number in hermaphrodites (SCHEDL and KIMBLE 1988 Down). Intriguingly, the most poorly conserved domain among the three cloned tra-2 homologues is the FEM-3-binding site in the cytoplasmic domain of Ce-tra-2 (Fig 4). Cr-tra-2, perhaps importantly, appears to have a deletion in this region relative to Ce-tra-2 and Cb-tra-2. Such divergence in a domain that mediates a potentially critical protein-protein contact suggests that this region may have undergone selection. Positive selection on protein-protein interactions has been most clearly demonstrated for gamete recognition components in marine invertebrates, in which rapid evolution of proteins facilitating the interaction of sperm and egg facilitates reproductive isolation of congeneric sympatric species (METZ and PALUMBI 1996 Down; SWANSON and VACQUIER 1998 Down). Homologues of fem-3 have yet to be isolated, but a reasonable prediction is that the region of FEM-3 that binds tra-2 protein products will also be unusually divergent in sequence. Such modification of the TRA-2A/B-FEM-3 interaction might allow the number of sperm made by hermaphrodites to be optimized to prevailing ecological conditions. The actual number of self-progeny produced by C. elegans and C. briggsae hermaphrodites does in fact differ (FODOR et al. 1983 Down; HODGKIN and BARNES 1991 Down).

Our data also suggest that Cr-tra-2 produces a small transcript of ~1.6 kb encoding the cytoplasmic domain, similar to the 1.8-kb and 1.9-kb C. elegans mRNAs known to encode TRA-2B. It is unclear if these smaller transcripts are homologous in the strict sense, however. A striking similarity is the exact colinearity of the proteins encoded by the 1.6-kb Cr-tra-2 mRNA and the two smaller Ce-tra-2 transcripts. But the Cr-tra-2 transcript appears to be transcribed from a different intron than either smaller Ce-tra-2 mRNA, suggesting that TRA-2B-encoding transcripts may have evolved independently. We have, however, named the protein Cr-tra-2B by analogy. TRA-2B is oocyte specific in C. elegans and is thought to promote oocyte differentiation and limit sperm production in hermaphrodites (KUWABARA et al. 1998 Down), perhaps by binding and downregulating FEM-3 (MEHRA et al. 1999 Down). Interestingly, no TRA-2B-encoding transcript was detected in C. briggsae (KUWABARA 1996A Down), suggesting that hermaphroditic development can occur in its absence. This notion is supported by the relatively small effect produced by removing maternal tra-2 function in C. elegans (KUWABARA et al. 1998 Down). Since C. remanei females make no sperm, we surmise that the ancestral function of TRA-2B was either to promote oocyte development or to act maternally to promote female development in XX progeny.

Potential roles for tra-2 in female vs. hermaphrodite development:
Given the overall similarity of Cr-tra-2 structure and function to its homologues in androdioecious species, three possible scenarios can be envisioned for its role in the evolution of germline sex determination in Caenorhabditis. One is that tra-2 in fact is regulated in the same way regardless of mating system. If true, this implies that the MX and translational controls on tra-2 do not exist primarily to control hermaphrodite germ cell differentiation as suggested previously (KUWABARA 1996A Down; JAN et al. 1997 Down). Instead, both controls may instead be more general—necessary for sexual mosaicism in the hermaphrodite germ line, but not the factors that actually drive it. This idea is also supported by the fact that tra-2 and fem-3 translational controls are exerted in the soma of both males and hermaphrodites (GOODWIN et al. 1993 Down; JAN et al. 1997 Down; GALLEGOS et al. 1998 Down), even though in somatic tissues their removal causes little or no sexual transformation. We suggest that the hermaphrodite germline may simply be more sensitive to their loss.

A second possibility is that the regulatory interactions required for hermaphrodite spermatogenesis are present in C. remanei, but differ quantitatively in their effects. One datum consistent with this model is the apparently weaker affinity of the DRF-like factor for the Cr-tra-2 3' UTR than for the Ce-tra-2 3' UTR (Fig 7). The Cb-tra-2 3' UTR is known to bind a DRF homologue and repress translation in vivo to an extent similar to that seen in Ce-tra-2 (JAN et al. 1997 Down). This raises the possibility that the translational control may have originally evolved as a redundant mechanism in male sex determination and was later coopted for use in hermaphrodite germline development by strengthening its effect.

The third possibility is that a qualitative difference in tra-2 regulation exists between hermaphrodites and females. For example, the factor that binds the Cr-tra-2 3' UTR may not be capable of repressing translation. Or there may be additional factors in hermaphrodites that act in concert with a conserved RNA-binding protein to enhance translational repression. Indeed, a well-conserved homologue of GLD-1, which binds the tra-2 DRE and represses translation in C. elegans (JAN et al. 1999 Down), has been identified in C. remanei (JONES and SCHEDL 1995 Down). In addition, the germline-specific C. elegans protein FOG-2 is required for the onset of spermatogenesis and binds GLD-1 (SCHEDL and KIMBLE 1988 Down; T. SCHEDL, personal communication). FOG-2 is thus a good candidate for a factor that might distinguish germline sex determination of hermaphrodites and females, as previously suggested (SCHEDL and KIMBLE 1988 Down). Regulation of the MX domain might also be distinct, but little is currently known about its role in controlling hermaphrodite spermatogenesis.

tra-2, Caenorhabditis phylogeny, and the evolution of mating system:
Of the seven very closely related Caenorhabditis species that form the Elegans group (see SUDHAUS and KIONTKE 1996 Down), only elegans and briggsae are androdioecious. The sister group to the Elegans group, composed of perrieri and craspedocerca, also produces hermaphrodites, but all other described Caenorhabditis species are gonochoristic. The Elegans group species are nearly identical in morphology, and molecular sequences thus far exist for only four of them. Further, at least two of the species may be synonymous with others in the group (SUDHAUS and KIONTKE 1996 Down; S. BAIRD, personal communication). Consequently, most relationships within the group are not yet known and it is therefore not clear for an individual Elegans group species whether its mating system is a derived or ancestral condition. A clade of the two androdioecious species would suggest that hermaphroditism is a shared derived character. However, if a gonochoristic species such as C. remanei were instead grouped with one of the androdioecious species, with the other as an outgroup, then it would be equally parsimonious to postulate either independent gains of hermaphroditism by elegans and briggsae or a single gain in the common ancestor of all three species, followed by the reversion to dioecy in remanei. Neither of the two previous attempts to determine the exact phylogeny of elegans, briggsae, and remanei have suggested an all-hermaphrodite clade. Both a briggsae/remanei clade (FITCH et al. 1995 Down) and a remanei/elegans clade (BALDWIN et al. 1997 Down) have been proposed, albeit with weak statistical support in both cases. On the basis of the latter result, SUDHAUS and KIONTKE 1996 Down suggested that androdioecy may have evolved three times in Caenorhabditis, once in the perrieri/craspedocerca clade and twice in the Elegans group, with elegans and briggsae thus representing independent acquisitions. However, the hypothesis of FITCH et al. 1995 Down would fit this scenario just as well.

As shown in Table 1, all analyzed features of the tra-2 sequences indicate that Cr-tra-2 and Cb-tra-2 are more similar to each other than either is to Ce-tra-2. This would be most consistent with a clade of C. briggsae plus C. remanei, the proposal of FITCH et al. 1995 Down. This pairing is also supported by the unique ability of briggsae and remanei to produce viable hybrid progeny (BAIRD et al. 1992 Down). But in the absence of a fourth outgroup sequence, a rigorous phylogenetic analysis using character-state methods (parsimony or maximum likelihood) cannot be performed. Simplified distance methods using the assumption of midpoint rooting produced trees from the tra-2 amino acid sequence with all three possible topologies, depending upon the correction for multiple hits and the tree-building algorithm employed (not shown). Thus until an outgroup sequence is available, tra-2 is of little utility for resolving Caenorhabditis phylogeny.


*  ACKNOWLEDGMENTS

We thank Dave Rudel for providing the C. remanei cDNA library. We also thank David Fitch for invaluable advice on strain choice and Scott Baird for clarifying the status of Caenorhabditis taxonomy. Eric Jan, Laura Graves, and Elizabeth Goodwin (Northwestern University Medical School) graciously welcomed E.S.H. into their laboratory to learn the RNA gel-shift technique. We also thank the Kimble Lab for many useful discussions, and Anne Helsley-Marchbanks for assistance in preparing the manuscript. This work was supported financially by a Jane Coffin Childs Memorial Fund for Medical Research postdoctoral fellowship to E.S.H. J.K. is an Investigator of the Howard Hughes Medical Institute.

Manuscript received November 12, 1999; Accepted for publication January 31, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BAIRD, S. E., M. E. SUTHERLIN, and S. W. EMMONS, 1992  Reproductive isolation in Rhabditidae (Nematoda: Secernentea): mechanisms that isolate six species of three genera. Evolution 46:585-594.

BAIRD, S. E., D. H. FITCH, and S. W. EMMONS, 1994  Caenorhabditis vulgaris sp.n. (Nematoda: Rhabditidae): a necromenic associate of pill bugs and snails. Nematologica 40:1-11.

BALDWIN, J. G., R. M. GIBLIN-DAVIS, C. D. EDDLEMAN, D. S. WILLIAMS, and J. T. VIDA et al., 1997  The buccal capsule of Aduncospiculum halicti (Nemata: Diplogasterina): an ultrastructural and molecular phylogenetic study. Can. J. Zool. 75:407-423.

CHARLESWORTH, D., 1984  Androdioecy and the evolution of dioecy. Biol. J. Linn. Soc. 23:333-348.

DARWIN, C., 1877 The Different Forms of Flowers on Plants of the Same Species. Murray, London.

DE BONO, M. and C. I. BARGMANN, 1998  Natural variation in a neuropeptide Y receptor homolog modifies social behavior and food response in C. elegans.. Cell 94:679-689[Medline].

DE BONO, M. and J. HODGKIN, 1996  Evolution of sex determination in Caenorhabditis: unusually high divergence of tra-1 and its functional consequences. Genetics 144:587-595[Abstract].

DOEBLEY, J., A. STEC, and L. HUBBARD, 1997  The evolution of apical dominance in maize. Nature 386:485-488[Medline].

DONIACH, T., 1986  Activity of the sex-determining gene tra-2 is modulated to allow spermatogenesis in the C. elegans hermaphrodite. Genetics 114:53-76[Abstract/Free Full Text].

EIZINGER, A., B. JUNGBLUT, and R. J. SOMMER, 1999  Evolutionary change in the functional specificity of genes. Trends Genet. 15:197-202[Medline].

FELIX, M. A. and P. W. STERNBERG, 1996  Symmetry breakage in the development of one-armed gonads in nematodes. Development 122:2129-2142[Abstract].

FIRE, A., S. XU, M. K. MONTGOMERY, S. A. KOSTAS, and S. E. DRIVER et al., 1998  Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.. Nature 391:806-811[Medline].

FITCH, D. H. A., 1997  Evolution of male tail morphology and development in rhabditid nematodes related to Caenorhabditis elegans.. Syst. Biol. 46:145-179[Medline].

FITCH, D. H. A. and S. W. EMMONS, 1995  Variable cell positions and cell contacts underlie morphological evolution of the rays in the male tails of nematodes related to Caenorhabditis elegans.. Dev. Biol. 170:564-582[Medline].

FITCH, D. H. A., B. BUGAJ-GAWEDA, and S. W. EMMONS, 1995  18S ribosomal RNA phylogeny for some Rhabditidae related to Caenorhabditis.. Mol. Biol. Evol. 12:346-358[Abstract].

FODOR, A., D. L. RIDDLE, F. K. NELSON, and J. W. GOLDEN, 1983  Comparison of a new wild-type Caenorhabditis briggsae with laboratory strains of C. briggsae and C. elegans.. Nematologica 29:203-217.

GALLEGOS, M., J. AHRINGER, S. CRITTENDEN, and J. KIMBLE, 1998  Repression by the 3'UTR of fem-3, a sex-determining gene, relies on a ubiquitous mog-dependent control in Caenorhabditis elegans.. EMBO J. 17:6337-6347[Medline].

GOODWIN, E. B., P. G. OKKEMA, T. C. EVANS, and J. KIMBLE, 1993  Translational regulation of tra-2 by its 3' untranslated region controls sexual identity in C. elegans.. Cell 75:329-339[Medline].

GOODWIN, E. B., K. HOFSTRA, C. A. HURNEY, S. MANGO, and J. KIMBLE, 1997  A genetic pathway for regulation of tra-2 translation. Development 124:749-758[Abstract].

GRAVES, L. E., S. SEGAL, and E. B. GOODWIN, 1999  TRA-1 regulates the cellular distribution of the tra-2 mRNA in C. elegans.. Nature 399:802-805[Medline].

GUO, S. and K. J. KEMPHUES, 1995  par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell 81:611-620[Medline].

HANSEN, D. and D. PILGRIM, 1998  Molecular evolution of a sex determination protein: FEM-2 (PP2C) in Caenorhabditis. Genetics 149:1353-1362[Abstract/Free Full Text].

HODGKIN, J., 1986  Sex determination in the nematode Caenorhabditis elegans: analysis of tra-3 suppressors and characterization of fem genes. Genetics 114:15-52[Abstract/Free Full Text].

HODGKIN, J. and T. M. BARNES, 1991  More is not better: brood size and population growth in a self-fertilizing nematode. Proc. R. Soc. Lond. Ser. B. 246:19-24[Medline].

HODGKIN, J. and S. BRENNER, 1977  Mutations causing transformation of sexual phenotype in the nematode Caenorhabditis elegans.. Genetics 86:275-287[Abstract/Free Full Text].

JAN, E., J. W. YOON, D. WALTERHOUSE, P. IANNACCONE, and E. B. GOODWIN, 1997  Conservation of the C. elegans tra-2 3'UTR translational control. EMBO J. 16:6301-6313[Medline].

JAN, E., C. K. MOTZNY, L. E. GRAVES, and E. B. GOODWIN, 1999  The STAR protein, GLD-1, is a translational regulator of sexual identity in Caenorhabditis elegans.. EMBO J. 18:258-269[Medline].

JONES, A. R. and T. SCHEDL, 1995  Mutations in gld-1, a female germ cell-specific tumor suppressor gene in Caenorhabditis elegans, affect a conserved domain also found in Src-associated protein Sam68. Genes Dev. 9:1491-1504[Abstract/Free Full Text].

KLASS, M., N. WOLF, and D. HIRSH, 1976  Development of the male reproductive system and sexual transformation in the nematode Caenorhabditis elegans.. Dev. Biol. 69:329-335.

KRAEMER, B., S. CRITTENDEN, M. GALLEGOS, G. MOULDER, and R. BARSTEAD et al., 1999  NANOS-3 and FBF proteins physically interact to control the sperm-oocyte switch in Caenorhabditis elegans.. Curr. Biol. 9:1009-1018[Medline].

KUWABARA, P. E., 1996a  Interspecies comparison reveals evolution of control regions in the nematode sex-determining gene tra-2.. Genetics 144:597-607[Abstract].

KUWABARA, P. E., 1996b  A novel regulatory mutation in the C. elegans sex determination gene tra-2 defines a candidate ligand/receptor interaction site. Development 122:2089-2098[Abstract].

KUWABARA, P. E. and S. SHAH, 1994  Cloning by synteny: identifying C. briggsae homologues of C. elegans genes. Nucleic Acids Res. 22:4414-4418[Abstract/Free Full Text].

KUWABARA, P. E., P. G. OKKEMA, and J. KIMBLE, 1992  tra-2 encodes a membrane protein and may mediate cell communication in the Caenorhabditis elegans sex determination pathway. Mol. Biol. Cell 3:461-473[Abstract].

KUWABARA, P. E., P. G. OKKEMA, and J. KIMBLE, 1998  Germ-line regulation of the Caenorhabditis elegans sex-determining gene tra-2.. Dev. Biol. 204:251-262[Medline].

MACKAY, T. F. C., 1995  The genetic basis of quantitative variation: numbers of sensory bristles of Drosophila melanogaster as a model system. Trends Genet. 11:464-470[Medline].

MEHRA, A., J. GAUDET, L. HECK, P. E. KUWABARA, and A. M. SPENCE, 1999  Negative regulation of male development in Caenorhabditis elegans by a protein-protein interaction between TRA-2A and FEM-3. Genes Dev. 13:1453-1463