A Recombination Repair Gene of Schizosaccharomyces pombe, rhp57, Is a Functional Homolog of the Saccharomyces cerevisiae RAD57 Gene and Is Phylogenetically Related to the Human XRCC3 Gene

Corresponding author: Hideo Shinagawa, Department of Molecular Microbiology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan., shinagaw{at}biken.osaka-u.ac.jp (E-mail)

Communicating editor: L. S. SYMINGTON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

To identify Schizosaccharomyces pombe genes involved in recombination repair, we identified seven mutants that were hypersensitive to both methyl methanesulfonate (MMS) and -rays and that contained mutations that caused synthetic lethality when combined with a rad2 mutation. One of the mutants was used to clone the corresponding gene from a genomic library by complementation of the MMS-sensitive phenotype. The gene obtained encodes a protein of 354 amino acids whose sequence is 32% identical to that of the Rad57 protein of Saccharomyces cerevisiae. An rhp57 (RAD57 homolog of S. pombe) deletion strain was more sensitive to MMS, UV, and -rays than the wild-type strain and showed a reduction in the frequency of mitotic homologous recombination. The MMS sensitivity was more severe at lower temperature and was suppressed by the presence of a multicopy plasmid bearing the rhp51 gene. An rhp51 rhp57 double mutant was as sensitive to UV and -rays as an rhp51 single mutant, indicating that rhp51 function is epistatic to that of rhp57. These characteristics of the rhp57 mutants are very similar to those of S. cerevisiae rad57 mutants. Phylogenetic analysis suggests that Rhp57 and Rad57 are evolutionarily closest to human Xrcc3 of the RecA/Rad51 family of proteins.

DOUBLE-strand breaks (DSBs) can be repaired by at least two mechanisms in eukaryotes: recombinational repair and nonhomologous end joining (NHEJ). In lower eukaryotes such as baker's yeast, recombinational repair is the major pathway for DSB repair, while in higher eukaryotes, such as mammals, NHEJ is the major pathway. The recombination repair mechanism in eukaryotes has been studied extensively in the budding yeast Saccharomyces cerevisiae, and many genes belonging to the RAD52 epistasis group have been identified. Strains with a mutation in these genes are sensitive to DNA-damaging agents that cause DSBs. The genes in the RAD52 group are divided into two subgroups according to their distinct roles in meiosis, the MRE11 and RAD51 subgroups. RAD50, MRE11, and XRS2, belonging to one group, are required for the formation and processing of DSBs (TSUBOUCHI and OGAWA 1998 ). The RAD51, RAD52, RAD54, RAD55, and RAD57 genes belonging to RAD51 subgroup are involved in promoting pairing and strand exchange reactions between two homologous DNA molecules, leading to formation of recombination intermediates (SHINOHARA and OGAWA 1995 ).

Studies on the functions of the RAD51 subgroup of genes revealed the physical interactions in vivo between Rad51 and Rad52, Rad51 and Rad54, Rad51 and Rad55, and Rad55 and Rad57 (HAYS et al. 1995 ; JOHNSON and SYMINGTON 1995 ; JIANG et al. 1996 ; CLEVER et al. 1997 ). The biochemical properties of these proteins have also been studied. Rad51, which is structurally homologous to Escherichia coli RecA, forms nucleoprotein filaments with ssDNA, like RecA (SHINOHARA et al. 1992 ; OGAWA et al. 1993 ), and mediates homologous pairing and strand exchange (SUNG 1994 ; SUNG and ROBBERSON 1995 ). Therefore, Rad51 is a functional homolog of RecA. Rad52 stimulates this reaction when the single-stranded DNA-binding factor RPA is added prior to or simultaneously with Rad51 (SUGIYAMA et al. 1997 ; SUNG 1997A ; SHINOHARA and OGAWA 1998 ), and Rad54 is required for the promotion of D-loop formation by Rad51 (PETUKHOVA et al. 1998 ). Rad55 and Rad57, both of which also have some sequence similarity to RecA, form a stable heterodimer and promote the Rad51-mediated strand exchange in the presence of RPA (SUNG 1997B ). Although no strand exchange activity of these two RecA homologs by themselves has been detected, focus formation of Rad51 in meiosis is dependent on the presence of Rad57, suggesting that Rad55 and Rad57 are required for efficient strand exchange by Rad51 (GASIOR et al. 1998 ). The detection of protein-protein interactions between functionally related proteins suggests that such interactions provide further evidence in support of this view (HAYS et al. 1995 ).

As a model system to study repair systems for DSBs, we have selected Schizosaccharomyces pombe, in which much less work has been done than in S. cerevisiae. The rhp51, rhp54, rad22, and rad32 genes are structurally and functionally similar to the RAD51, RAD54, RAD52, and MRE11 genes of S. cerevisiae, respectively (MURIS et al. 1993 , MURIS et al. 1996 ; OSTERMANN et al. 1993 ; SHINOHARA et al. 1993 ; JANG et al. 1994 ; TAVASSOLI et al. 1995 ). We have initiated extensive efforts to identify new genes of S. pombe involved in DNA repair by isolating repair-deficient mutants and cloning the genes that complement the mutant phenotypes. One of the strategies used to identify repair-deficient mutants is described below.

S. pombe Rad2 is a member of the human FEN-1 family. The FEN-1 protein has a flap-structure-specific endonuclease and 5' to 3' exonuclease activities and is implicated in the removal of RNA primers attached to the 5' ends of Okazaki fragments in DNA replication (for review see WAGA and STILLMAN 1998 ). A rad2 mutant is sensitive to UV and exhibits elevated chromosome loss rates (MURRAY et al. 1994 ). The FEN-1 gene complements a rad2 mutant, indicating that FEN-1 is structurally and functionally similar to Rad2 (MURRAY et al. 1994 ). Thus, Rad2 is thought to act in a similar manner to FEN-1 in DNA replication. Strains defective in processing Okazaki fragments require recombination function for viability in S. cerevisiae and in E. coli, since they produce DSBs during replication (CAO and KOGOMA 1995 ; SYMINGTON 1998 ). Indeed, rhp51, rhp54, and rad32 mutations also cause lethality when combined with the rad2 mutation in S. pombe (TAVASSOLI et al. 1995 ; MURIS et al. 1996 ). Mutations in the genes involved in processing the Holliday recombination intermediates into mature recombinant molecules cause lethality when combined with a polA mutation in E. coli (ISHIOKA et al. 1997 , ISHIOKA et al. 1998 ). None of the genes involved in the late stage of recombination have been identified in eukaryotes; thus, identifying mutations that cause synthetic lethality when combined with rad2 might provide a means to identify late acting as well as early acting recombination functions.

To identify novel genes involved in recombination repair, in the present study we screened for mutants that were sensitive to methyl methanesulfonate (MMS) and -rays and that were, in addition, nonviable when combined with the rad2 mutation. Using complementation of the MMS sensitivity of one such mutant, we cloned a novel gene that encodes a protein whose sequence is similar to S. cerevisiae Rad57, and we named this gene rhp57 (RAD57 homolog of S. pombe). An rhp57 deletion strain was constructed and its phenotypes were studied in relation to those of rad57 mutants of S. cerevisiae.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains, plasmids, media, and mutagenesis:
The S. pombe strains used in this study are shown in Table 1. S. pombe cells were grown and maintained in YES or EMM media supplemented with appropriate nutrients as described in MORENO et al. 1991 . Mutagenesis with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was carried out as described in MORENO et al. 1991 . pUR19 is described in BARBET et al. 1992 . The plasmid pAUR2 carries the BglII fragment of pRN2 (MURRAY et al. 1994 ; a gift from A. M. Carr), which contains the rad2 gene, on pUR19. pSP102 was a gift from H. Masukata, and it contains the S. cerevisiae LEU2 gene and an autonomous replicating sequence (ars2004) of S. pombe (OKUNO et al. 1997 ). The BglII-BamHI fragment of the S. pombe chromosomal DNA carried on the plasmid p51-410 (a gift from A. Pastink) containing the rhp51 gene (MURIS et al. 1993 ) was cloned into the BamHI site of pSP102 to generate pYT101. pYT102 carries the LEU2, rhp57 genes and the ars sequence. The S. pombe cDNA library was a gift from H. Nojima (CHEN and OKAYAMA 1987 ). The leu1⁺-containing pJK148 plasmid used for the homologous integrations at the leu1-32 locus is described in KEENEY and BOEKE 1994 . The autonomously replicating pREP1 plasmid carries the S. cerevisiae LEU2 marker gene and was used as a control for DNA uptake (MAUNDRELL 1993 ).

Cloning of the gene that complements the MMS sensitivity of a repair-deficient mutant:
One of the mutant strains defective in DNA repair was transformed with 5–10 µg of S. pombe genomic library as described by OKAZAKI et al. 1990 , and the transformants were plated directly onto selective agar plates containing 0.004% MMS. Cells were grown at 30° for 3–4 days. More than 20,000 individual transformants were screened for MMS resistance and the candidate transformants were examined for plasmid dependency of MMS resistance. Plasmids were prepared from the plasmid-dependent resistant colonies and recovered in E. coli after transformation as described by BARBET et al. 1992 . The physical map of the isolated plasmids was constructed and the DNA sequence of the minimal complementing region was analyzed.

Construction of the deletion mutants:
The rhp57 deletion mutant was constructed essentially as described in GRIMM et al. 1988 . The DraI-KpnI fragment of pSLR2-2 carrying the rhp57 gene was cloned into the SmaI-KpnI site of pBluescript SK(+) to generate pYT103. The EcoRI-HindIII fragment of pYT103, which covers most of the rhp57 coding region, was replaced with the 1.8-kb HindIII fragment containing the S. pombe ura4 gene or the 2.2-kb HindIII fragment containing S. cerevisiae LEU2 to generate pYT103U and pYT103L. pYT103U and pYT103L were linearized by BamHI digestion and transformed into the haploid S. pombe strain TMP701. The Ura⁺ or Leu⁺ transformants were checked for the rhp57 deletion by genomic Southern analysis. The plasmid for the rhp51 gene disruption was as described in MURIS et al. 1993 , and the linearized plasmid was transformed into the haploid strain TMP701. The rhp51 disruption was confirmed by genomic Southern analysis.

-ray, UV light, and MMS sensitivity tests:
Cells were grown to midlog phase (OD₅₉₅ = 0.3–0.5) in YES, suspended in water, and irradiated with -rays from a ⁶⁰Co source at a dose rate of 184 Gy/hr. After irradiation, appropriately diluted samples were plated on YES plates and incubated at 30° for 4–7 days, and the resulting colonies were counted.

Midlog phase cultures diluted to appropriate concentrations were plated onto YES plates and the plates were irradiated with UV light at the indicated doses. They were incubated in the dark at 30° for 4–7 days, and the colonies were counted.

MMS was added to the concentration of 0.1% to midlog phase cells suspended in 5 ml of 0.05 M K₂HPO₄ in a 50-ml plastic tube, and the mixture was incubated at 30° for the indicated periods. Samples (500 µl) were taken from the cultures and mixed with 500 µl of 20% Na₂S₂O₃ to inactivate MMS. The cells were then washed with water, resuspended in 1 ml of water, appropriately diluted, plated onto YES plates, and incubated at 22° or 30° for 4–7 days before counting the colonies.

For the spot assay of MMS sensitivity, sequential 10-fold dilutions of late log cultures were spotted on EMM plates with or without MMS 0.004%. Plates were incubated at 30° for 4 days.

Cloning of rhp57 cDNA:
rhp57 cDNA was amplified with sense primer 5' primer-1 5'-GAAAAAGTGGGTTAGAAGTTCGTC-3' and antisense primer 3' primer-1 5'-GGGCAATTCATAAACCGG-3' (see Fig 2) using the S. pombe cDNA library as template, and the PCR products were cloned into pT7-Blue-2 (Novagen) and sequenced.

View larger version (13K): In this window In a new window Download PPT slide   Figure 1. Physical map of the rhp57 region and construction of an rhp57 deletion mutant. (A) Restriction maps of the DNA fragments that complemented the slr2 mutant. Two kinds of plasmid clones were isolated from the S. pombe genomic library by complementation of the MMS sensitivity of the mutant. Sequence analysis of pSLR2-2 revealed an open reading frame, rhp57, which encodes a protein of 354 amino acids. The open boxes represent exons and the closed box represents an intron. (B) Diagram of construction of an rhp57 deletion strain. Plasmids containing the rhp57 deletion were constructed by replacing the 0.8-kb EcoRI-HindIII fragment with the S. pombe ura4+ or S. cerevisiae LEU2 gene. The chromosomal DNA fragment containing the disrupted rhp57 region was used to transform the wild-type haploid strain TMP701 as described in MATERIALS AND METHODS.

View larger version (107K): In this window In a new window Download PPT slide   Figure 2. Nucleotide sequence of the rhp57 gene. The intron is shown in lowercase letters and the deduced amino acid sequence is shown with the single-letter code. The consensus sequences for the 5' splice, branch, and 3' splice sites are boxed and shown in that order. Putative TATA-box motifs are underlined, and a putative polyadenylation sequence is shown by a double underline. The n uc l e o s i d e-t r i p h o s p h a t e-binding motifs (Walker motifs A and B) are shown by boldface letters. The primers used in the cloning of rhp57 cDNA are shown by arrows.

Site-directed mutagenesis:
A synthetic 25-mer TCACATATGGATATTTCGAATTATG and 31-mer TCAGGATCCCTAGCACGAATATATCCCAACC were used for PCR to generate a new NdeI site at the ATG initiation codon and a BamHI site downstream from the TAG termination codon of rhp57 cDNA, respectively. The PCR product containing the rhp57 gene was digested with NdeI and BamHI, cloned into the NdeI-BamHI site of pUC19 to yield pYS102, and sequenced. Using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), site-directed mutagenesis was carried out with two sets of the synthetic oligonucleotide primers as follows. To generate rhp57 (K106A) mutant gene, 106A-1, AGCGGTTCAGGGGCATCACAGTTTTGTATG and K106A-2, CATACAAAACTGTGATGCC-CCTGAACCGC were used. To generate rhp57 (K106R) mutant gene, K106R-1, AGCGGTTCAGGGCGATCA-CAGTTTTGTATG and K106R-2, CATACAAAACTGTGATCGCCCTGAACCG-C were used. The mutant cDNA was digested with NdeI and BamHI and cloned into the NdeI-BamHI site of pREP1. The resultant plasmids, pREP1-R57K106A and pREP1-R57K106R, were introduced into the rhp57 strain by transformation and MMS sensitivity was tested by the spot assay.

Sequencing of the rhp57-1 mutant gene:
The rhp57 gene region covering 470 bp upstream of the first codon and 60 bp downstream of the stop codon was amplified using genomic DNA isolated from the rhp57-1 mutant strain (TMPR2-2) as template with several sets of appropriate synthetic oligonucleotide primers. The PCR product was purified and directly sequenced for both strands with overlaps using synthetic primers.

Mitotic homologous recombination at the leu1-32 locus:
The efficiency of integration by homologous recombination was assayed as described in MURIS et al. 1997 . Briefly, the rhp57 (TMP711), rhp51 (TMP712), and isogenic wild-type (TMP-701) strains with the leu1-32 mutation were transformed with 0.25 or 5 µg of linearized pJK148 plasmid DNA carrying the S. pombe leu1⁺ gene. Corresponding amounts of the uncut pREP1 plasmid carrying the S. cerevisiae LEU2 gene and the S. pombe ars sequence were used as controls to measure the transformation efficiency. Leu⁺ transformants were selected on EMM plates supplemented with histidine, adenine, and uracil after incubation for 10 days at 30°. No Leu⁺ revertants were detected among mock-transformed cells. For each strain, the recombination frequency was calculated by dividing the number of Leu⁺ transformants obtained with linearized pJK148 by that obtained with pREP1 (pJK148/pREP1 ratio). The recombination frequencies of the rhp57 and rhp51 mutants were determined by relating the pJK148/pREP1 ratio of the mutant to the pJK148/pREP1 ratio of the wild-type strain.

Phylogenetic analysis:
A multiple sequence alignment of the RecA/Rad51 homologs of humans (Hs), S. pombe (Sp), and S. cerevisiae (Sc) was constructed by using the CLUSTAL W program (THOMPSON et al. 1994 ). The references for 13 sequences used in this study are as follows: HsRad51 (SHINOHARA et al. 1993 ), HsDmc1 (HABU et al. 1996 ), Rad51B/hREC2 (ALBALA et al. 1997 ; RICE et al. 1997 ), Rad51C (DOSANJH et al. 1998 ), Rad51D (PITTMAN et al. 1998 ), Xrcc2 (CARTWRIGHT et al. 1998 ; LIU et al. 1998 ), Xrcc3 (LIU et al. 1998 ), ScRad51 (BASILE et al. 1992 ; SHINOHARA et al. 1992 ), ScDmc1 (BISHOP et al. 1992 ), Rad57 (KANS and MORTIMER 1991 ), Rhp51 (SHINOHARA et al. 1993 ), SpDmc1 (SWISS-PROT accession no. 042634), and Rhp57 (this work). Likewise, Rad51 and Dmc1 proteins were aligned by using the same program. It was difficult, however, to automatically align the sequences of Rad51s/Dmc1s together with those of the other homologs due to the high sequence divergence among the homologs, except for Rad51s/Dmc1s. Therefore, multiple alignment of Rad51s/Dmc1s and the other homologs was done manually based on the alignment shown in HEYER 1994 , which was modified by visual inspection to increase the similarity. On the basis of this alignment, the genetic distance for every pair of aligned sequences was calculated as a maximum likelihood estimate (FELSENSTEIN 1996 ). The overlapping regions used for phylogenetic analysis are from positions 82 to 354 of Rhp57. The aligned regions containing gaps were excluded from the calculation. Then, an unrooted molecular phylogenetic tree of the RecA/Rad51 homologs was constructed by the neighbor-joining method (SAITOU and NEI 1987 ) using the genetic distances. The statistical significance of the obtained tree topology was evaluated by bootstrap analysis (FELSENSTEIN 1985 ) with 1000 iterations. A program package, PHYLIP (version 3.5c; FELSENSTEIN 1993 ), was used for the molecular phylogenetic analysis.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Isolation of mutants defective in repairing DNA DSBs:
Mutations in recombination repair genes, such as rhp51, rhp54, and rad32, are lethal in combination with rad2 mutations. As a strategy to isolate recombination-defective mutants, we identified mutations that caused lethality in a rad2 background. For this purpose, we used the strain TMPR2C, which has a rad2 null mutation, and a plasmid carrying the rad2 and ura4 genes. We expected that recombination repair mutants derived from TMPR2C would die in the presence of a rad2 mutation, and therefore they would not be able to lose the rad2⁺ · ura4⁺ plasmid on EMM plates and would not grow on a medium containing 5-fluoroorotic acid (5-FOA). The cells of strain TMPR2C were mutagenized with MNNG and allowed to form colonies on EMM plates lacking uracil. About 7000 colonies were examined for MMS sensitivity by replica plating on EMM plates containing 0.004% MMS, and 282 MMS-sensitive colonies were identified initially. These candidates were spotted onto YES plates and irradiated with -rays at 800 Gy. A total of 27 isolates that did not grow after -ray irradiation were selected. Of them, 17 were defective in growth on EMM plates containing 5-FOA, so they were expected to carry mutations that cause defective growth when combined with rad2. These candidates were examined microscopically after irradiation with -rays at 800 Gy. A total of 7 mutants septated without elongation, which suggested that they were defective in radiation-checkpoint control and hence they were not analyzed further. Of the remaining 10 mutant strains, 7 were successively backcrossed three times with the wild-type strain. We attempted to clone the corresponding genes of all of the 7 mutants and succeeded in isolating three genes (our unpublished results). Cloning by complementation using a mutant tentatively named slr2 (synthetic lethal with rad2) is described below.

Cloning and sequencing of the S. pombe genomic DNA fragment that complemented a repair-deficient mutation:
Two kinds of plasmid clones that conferred MMS resistance on the slr2 mutant were isolated from the genomic library and these plasmids contained the overlapping chromosomal region (Fig 1). Both of them restored the wild-type level of the -ray sensitivity to the slr2 mutant (data not shown). Sequence analysis of the overlapping region revealed a large open reading frame (orf) of 340 amino acids (Fig 2). This orf could be extended further by splicing a putative 96-bp intron with the consensus sequences for the 5' splice, branch, and 3' splice sites, which are GTA(A/T)GT, CTAA(C/T), and (T/C)AG (Fig 2), respectively, observed in many introns in S. pombe (PRABHALA et al. 1992 ). The presence of this intron and the absence of any other introns in this orf were confirmed by amplifying and sequencing the cDNA corresponding to this orf of 354 amino acids. The nucleotide sequence data are available from the DDBJ/EMBL/GenBank nucleotide databases (accession no. AB024744). Upstream of this gene, two putative TATA-box motifs were found, one at position 754 (TATATAAAA), and one at position 794 (TATAAT; Fig 2). In the 3' untranslated region, a putative polyadenylation signal was found at position 2066 (AATAAA).

The database search for the predicted 354 amino acid sequence encoded by the complete gene revealed that it is homologous to proteins related to S. cerevisiae Rad51. Among those proteins, the highest homology was found with S. cerevisiae Rad57, with 32% identity and 51% similarity (Fig 3). Therefore, we named this gene rhp57, standing for RAD57 homolog of S. pombe. Rhp57 also has some homology with S. cerevisiae Rad51 (24% identity and 44% similarity) and human Xrcc3 (26% identity and 49% similarity; Fig 3).

View larger version (65K): In this window In a new window Download PPT slide   Figure 3. Sequence alignment of Rhp57, S. cerevisiae Rad57, human Xrcc3 and S. cerevisiae Rad51. The invariant and similar amino acid residues conserved among Rhp57, Rad57, and Xrcc3 are shaded in black and gray, respectively. When these are conserved also in Rad51, they are shaded in the same manner. Here, amino acid residues are classified into six groups based on physicochemical similarity: LIMV, SPTAG, YWF, DEQN, KRH, and C. The Walker motifs A and B for nucleotide binding are overlined.

The rhp57-1 mutation site:
The rhp57 gene of the original mutant was amplified and sequenced. A single transition of G to A was found at the second base of the 304^th codon, causing a change from the TGG codon for tryptophan to a TAG amber nonsense codon. Therefore, we concluded that this mutation is responsible for the phenotype of the original mutant and named this mutant allele rhp57-1.

Phenotypes of the rhp57 deletion mutant:
The rhp57 gene was disrupted by replacing most of the coding region with the ura4 gene (Fig 1). The resultant strain was more sensitive to MMS, UV, and -rays than the wild-type strain (Fig 4 and Fig 5), and the sensitivities were comparable to those of the rhp57-1 mutant, suggesting that rhp57-1 is a null mutation (data not shown).

View larger version (19K): In this window In a new window Download PPT slide   Figure 4. Sensitivities of the rhp57 mutants to UV (A) and -rays (B). Midlog phase cells were irradiated with UV or -rays at the indicated doses, and the relative plating efficiencies were determined. Wild-type strain, TMP701 (open circles); rhp-57 strain, TMP711 (open squares); rhp51 strain, TMP712 (open triangles); and rhp51 rhp57 strain, TMP713 (solid triangles). The data represent the average of three experiments.

View larger version (19K): In this window In a new window Download PPT slide   Figure 5. Sensitivities of rhp57 mutant to MMS at 30° and 22°. MMS sensitivities of the rhp57 mutant grown at 30° and 22° were assayed as described in MATERIALS AND METHODS. Wild-type strain (TMP701) at 30° (open circles), wild-type strain (TMP701) at 22° (solid circles), rhp57 strain (TMP711) at 30° (open squares), rhp57 strain (TMP711) at 22° (solid squares), rhp51 strain (TMP712) at 30° (open triangles), and rhp51 strain (TMP712) at 22° (solid triangles). The data represent the average of three experiments.

S. cerevisiae rad57 mutants were more sensitive to ionizing radiation at a lower temperature (22°) than at 30° (HAYS et al. 1995 ; JOHNSON and SYMINGTON 1995 ). Therefore, the effect of growth temperature on MMS sensitivity of the rhp57 mutant was examined. As shown in Fig 5, the rhp57 mutant was more sensitive to MMS at 22° than at 30°, while the sensitivities of the wild-type strain and the rhp51 mutant were not increased at the lower temperature.

Role of Walker motif A of Rhp57 for recombination repair:
In S. cerevisiae, the nucleoside-binding motif in Rad55 (GxxxxGKS/T) is important for the function, but the corresponding one in Rad57 is not (JOHNSON and SYMINGTON 1995 ). We constructed two rhp57 mutant genes by site-directed mutagenesis, altering the highly conserved lysine residue of Rhp57 to either an alanine or arginine residue. These mutant cDNAs were cloned into pREP1, introduced into the rhp57 mutant by transformation, and their abilities to complement the MMS sensitivity were tested by spot assay (Fig 6). The strains containing K106A and K106R were as resistant to MMS as the wild type, indicating that the nucleoside-binding motif of Rhp57 is not important for recombinational repair as in the case of Rad57 in S. cerevisiae.

View larger version (34K): In this window In a new window Download PPT slide   Figure 6. Effect of the rhp57 mutations altering the Walker motif A on the sensitivity to MMS. Late-log phase cultures of the wild-type strain (TMP701) carrying pREP1 and rhp57 (TMP711) strains carrying pREP1, pREP1-Rhp57, pREP1-R57K106A, or pREP1-R57K106R were spotted at different dilutions on EMM plates with or without MMS (0.004%) as described in MATERIALS AND METHODS.

rhp51 is epistatic to rhp57:
To examine the possible epistasis between rhp57 and rhp51, an rhp51 rhp57 double mutant was constructed and the sensitivities of the mutant to UV and -rays were assayed. As shown in Fig 4, the rhp51 mutant was more sensitive to UV and -rays than the rhp57 mutant and comparable to the rhp51 rhp57 double mutant in sensitivity, indicating that rhp51 is epistatic to rhp57.

Evidence for functional interactions between rhp57 and rhp51:
Overexpression of either the Rad51 or Rad52 proteins in S. cerevisiae partially suppresses the sensitivity of rad55 and rad57 mutants to ionizing radiation (HAYS et al. 1995 ; JOHNSON and SYMINGTON 1995 ). To investigate the functional interaction between the Rhp57 and Rhp51 proteins in S. pombe, the MMS sensitivity of the rhp57 mutant carrying a multicopy plasmid bearing the rhp51 gene was measured (Fig 7). The overexpressed Rhp51 protein suppressed the MMS sensitivity of the rhp57 mutant, indicating a functional interaction between the Rhp57 and Rhp51 proteins.

View larger version (17K): In this window In a new window Download PPT slide   Figure 7. The effect of overexpression of Rhp51 on the MMS sensitivity of the rhp57 strain. The MMS sensitivity of the rhp57 strain carrying either the rhp57 or rhp51 gene on a multicopy plasmid was determined. Wild-type strain (TMP701) with the vector pSP102 (open circles), rhp57 strain (TMP711) with the vector pSP102 (solid circles), rhp57 strain (TMP711) with the rhp51+ plasmid pYT101 (solid squares), and rhp57 strain (TMP711) with the rhp57+ plasmid pYT102 (solid triangles). The data represent the average of three experiments.

Mitotic homologous recombination in the rhp57 mutant:
The capability of the rhp57 mutant to carry out homologous recombination was studied by measuring the efficiency of integration of homologous linear DNA into the leu1-32 locus (Table 2). The efficiency of homologous integration in the rhp57 strain was reduced 3.6-fold when 0.25 µg DNA, which is in the linear range of dose response, was used. When the efficiencies were compared by using 5 µg DNA, which is above the saturating dose of the plasmid transformation, it was reduced 5-fold in the rhp57 strain and 30-fold in the rhp51 strain compared to that of the wild-type strain. These results indicate that Rhp57 protein is involved in homologous recombination in vegetative cells.

View this table: In this window In a new window   Table 2. Efficiency of integration by homologous recombination at the leu1-32 locus in the rhp57 strain

Synthetic lethality with the rad2 mutation:
Synthetic lethality of the rhp57 mutation with the rad2 mutation was confirmed by crossing a rhp57::LEU2 strain, TMP715, with a rad2::ura4⁺ mutant, TMP721, and analyzing the resulting segregants. Among the 13 tetrads dissected, the ratios of the segregants of Leu^-Ura^-, Leu⁺Ura^-, Leu^-Ura⁺, and Leu⁺Ura⁺ were 7, 13, 14, and 0, respectively. By random spore analysis, the ratios of the segregants of Leu^-Ura^-, Leu⁺Ura^-, Leu^-Ura⁺, and Leu⁺Ura⁺ were 570, 435, 626, and 0, respectively. These results show that the rhp57::LEU2 rad2::ura4⁺ double mutant is nonviable, as is the rhp57-1 rad2::ura4^- double mutant.

Spore viability was reduced in the rhp57 strain:
Since it was reported that the spore viabilities of recombination mutants such as rhp51, rad22, rhp54, and rhp55 were reduced in S. pombe (MURIS et al. 1997 ; KHASANOV et al. 1999 ), spore viability was examined in the rhp57 mutant. To avoid the synergistic effect of spontaneous DSB at mat1 locus on spore viability, the strains carrying cis mutations (smt-0 or mat1p17::LEU2), which eliminate DSB formation at mat1, were used (KHASANOV et al. 1999 ). The viability of spores formed by a cross of mat1p17::LEU2 rhp57::ura4⁺ x smt-0 rhp57::ura4⁺ (TMP752 x TMP753) was reduced to 58%, while the spore viability mat1p17::LEU2 rhp57⁺ x smt-0 rhp57⁺ (TMP751 x IBGY5-1) was 98%.

Phylogenetic analysis:
Three RecA/Rad51 protein homologs, Rhp51, Rhp55, and SpDmc1, have been identified previously in S. pombe. Rhp57, which we isolated in this work, is the fourth RecA/Rad51 homolog found in S. pombe. S. cerevisiae has counterparts of these four proteins, namely ScRad51, Rad55, ScDmc1, and Rad57, respectively. In humans, 7 RecA/Rad51 homologs have been identified: HsRad51, Rad51B/hREC2, Rad51C, Rad51D, Xrcc2, Xrcc3, and HsDmc1. The evolutionary relationships between these seven human proteins and four fungal proteins have not yet been extensively investigated. Therefore, we performed molecular phylogenetic analysis using amino acid sequence data of 13 RecA/Rad51 homologs to reveal the evolutionary relationships among them. However, RecA, Rad55, and Rhp55 were not included in the 13 sequences analyzed in the present phylogenetic study since the distinctly greater divergence of these 3 sequences from the other 13 sequences hindered calculation of the phylogenetic relationship.

The unrooted phylogenetic tree obtained as described in MATERIALS AND METHODS is shown in Fig 8. The number associated with each node indicates the bootstrap probability. When the number was 90.0%, the clustering at the node was regarded as statistically significant. As shown in Fig 8, ScRad51, Rhp51, and HsRad51 are closely related to each other, and the bootstrap probabilities of the clustering suggest that clustering is highly significant. Node X is regarded as the species divergence point between fungi and vertebrates. Likewise, ScDmc1, SpDmc1, and HsDmc1 are closely related to each other, and the clustering is highly significant. Node Y is also regarded as the species divergence point between fungi and vertebrates. The cluster of Dmc1 and that of Rad51/Rhp51 gather to form a larger cluster, which is also highly significant. Considering the position of node Z relative to nodes X and Y, the functional divergence between Rad51/Rhp51 and Dmc1 is considered to have occurred before the divergence between fungi and vertebrates. Rhp57, Rad57, and Xrcc3 also form a cluster, and comparison of their sequences is shown in Fig 3. Rhp57 and Rad57 are more similar to Xrcc3 than ScRad51 is. The identities/similarities between Rhp57 and Xrcc3, between Rad57 and Xrcc3, and between ScRad51 and Xrcc3 are 26/49%, 25/46%, and 24/45%, respectively. The bootstrap probabilities associated with the nodes within the cluster did not satisfy the statistical criterion, 90.0%, but were quite close to 90.0%. Therefore, the clustering at node A is considered to be meaningful.

View larger version (13K): In this window In a new window Download PPT slide   Figure 8. The unrooted phylogenetic tree of 13 RecA/Rad51 homologs including Rhp57. A multiple alignment of 13 RecA/Rad51 homologs was done by the procedure described in MATERIALS AND METHODS. On the basis of the alignment, the tree was constructed. The number at each node indicates the bootstrap probability of the clustering at the node. The references are listed in MATERIALS AND METHODS.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

S. cerevisiae RAD51, RAD52, and RAD54 are homologous to S. pombe rhp51, rad22, and rhp54, respectively, and these S. pombe genes have been shown to be involved in DNA recombination and repair. Here we identified and characterized the S. pombe rhp57 gene, which is structurally similar to S. cerevisiae RAD57. The rhp57 null mutant was viable and more sensitive to DNA-damaging agents than the wild-type strain. Interestingly, this sensitivity was more severe at 22° than at 30°. The cold sensitivity of the rhp57 mutant is similar to that of the S. cerevisiae rad57 null mutant, which has increased sensitivity to X rays at a lower temperature (HAYS et al. 1995 ; JOHNSON and SYMINGTON 1995 ). Moreover, S. pombe rhp57 and rhp51 interact functionally in a manner very similar to the S. cerevisiae RAD57 and RAD51 genes (see below). On the basis of these common properties, in conjunction with the structural resemblance, we propose that S. pombe rhp57 is a functional homolog of S. cerevisiae RAD57. Most recently, an S. pombe gene structurally and functionally similar to S. cerevisiae RAD55 was identified and designated rhp55 (KHASANOV et al. 1999 ). Therefore, RAD51, RAD52, RAD54, RAD55, and RAD57 genes are conserved in S. cerevisiae and S. pombe. Consistent with the in vitro data, most of the currently available data from in vivo experiments suggest that Rad55 and Rad57 act as accessory factors in recombination by stimulating the Rad51 function rather than by playing a role redundant with that of Rad51. The rad51 mutation is epistatic to the rad55 and rad57 mutations, suggesting that Rad55 and Rad57 play roles distinct from that of Rad51 in a pathway also involving Rad51. Moreover, overexpression of Rad51 partially suppresses the radiation-sensitive phenotype of the rad55 and rad57 mutants, suggesting that even in the absence of Rad55 or Rad57, Rad51 can promote recombination when present at a higher concentration. These phenotypes were also seen in the S. pombe rhp57 mutant (this work) and rhp55 mutant (KHASANOV et al. 1999 ). Therefore, Rhp57 and Rhp55 also appear to be accessory factors that form a complex and stimulate Rhp51 function.

As noted above, five RecA/RAD51 homologs in mammals, in addition to human HsRad51 and HsDmc1, have been isolated recently. They probably also play accessory roles for HsRad51 (BISHOP et al. 1998 ; CARTWRIGHT et al. 1998 ). Our phylogenetical analysis shows that these five proteins are much diverged from Rad51s and Dmc1s. The phylogenetical relationships among Rhp57, Rad57, and Xrcc3 are relatively close, suggesting that Xrcc3 may be most similar in function to Rhp57 and Rad57. Consistent with this notion, interaction between Rhp57 and Rhp51 was suggested by two-hybrid analysis in S. cerevisiae (our unpublished data), which would correspond to the interaction between Xrcc3 and Hs-Rad51 suggested also by two-hybrid analysis (LIU et al. 1998 ). Further genetic and biochemical studies are needed to reveal the functional relationships between Rhp57/Rad57 and Xrcc3 in recombination. Unfortunately, we cannot draw any clear conclusion about the evolutionary relationships among the remaining RecA/Rad51 homologs due to the low bootstrap probabilities. At this stage we can only state that the seven human RecA/Rad51 homologs diverged before fungi and vertebrates diverged, because neither the clusters of ScDmc1/SpDmc1/HsDmc1 and HsRad51/Rhp51/Sc-Rad51, nor the cluster of Xrcc3/Rhp57/Rad57 includes any other homolog within the cluster. The analysis also suggests that three copies of the seven duplicated genes have been deleted in the fungal lineage to S. cerevisiae, while they have been kept in the lineage to vertebrates. We must wait for further accumulation of sequence data of RecA/Rad51 homologs to clarify the evolutionary relationships among the RecA/Rad51 homologs.

In this study, we screened S. pombe mutants for MMS sensitivity, -ray sensitivity, and rad2 synthetic lethality. We expected to isolate mutants defective in DSB repair, since MMS, -rays, and rad2 mutations all cause DSBs in DNA. Two mechanisms that can repair DSBs are known in eukaryotes: recombination repair and NHEJ. Mutants defective in either mechanism may become hypersensitive to MMS and -rays, but a mutation in HDF1 (NHEJ pathway) did not cause synthetic lethality when combined with a rad27 mutation in S. cerevisiae (SYMINGTON 1998 ). Thus, the synthetic lethality with the rad2 mutation is specific to homologous recombination defects and enabled us to isolate a mutant defective in a novel gene, rhp57, involved in recombination repair. This result promises further isolation of novel recombination genes by the present strategy, which will lead to extension of our knowledge of the regulatory mechanisms of recombination repair in S. pombe.

	ACKNOWLEDGMENTS

We thank A. M. Carr, A. Pastink, and V. I. Bashkirov for S. pombe strains and cloned genes, H. Nojima for an S. pombe cDNA library, H. Masukata for pSP102, and W.-D. Heyer for communicating results before publication. Special thanks to A. M. Carr for useful suggestions for this work. This work is supported by Grants-in-Aid for Scientific Research on Priority Areas (08280102 and 08280103) and Monbusho International Scientific Research Program (10044206) from the Ministry of Science, Education, Sports, and Culture of Japan to H.S. Y.T. was supported by a Research Fellowship of the Japan Society for the Promotion of Science for Young Scientists.

Manuscript received June 22, 1999; Accepted for publication December 10, 1999.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALBALA, J. S., M. P. THELEN, C. PRANGE, W. FAN, and M. CHRISTENSEN et al., 1997  Identification of a novel human RAD51 homolog, RAD51B.. Genomics 46:476-479[Medline].

BARBET, N., W. J. MURIEL, and A. M. CARR, 1992  Versatile shuttle vectors and genomic libraries for use with Schizosaccharomyces pombe.. Gene 114:59-66[Medline].

BASILE, G., M. AKER, and R. K. MORTIMER, 1992  Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51.. Mol. Cell. Biol. 12:3235-3246[Abstract/Free Full Text].

BISHOP, D. K., D. PARK, L. XU, and N. KLECKNER, 1992  DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69:439-456[Medline].

BISHOP, D. K., U. EAR, A. BHATTACHARYYA, C. CALDERONE, and M. BECKETT et al., 1998  Xrcc3 is required for assembly of Rad51 complexes in vivo.. J. Biol. Chem. 273:21482-21488[Abstract/Free Full Text].

CAO, Y. and T. KOGOMA, 1995  The mechanism of recA polA lethality: suppression by RecA-independent recombination repair activated by the lexA(Def) mutation in Escherichia coli.. Genetics 139:1483-1494[Abstract].

CARTWRIGHT, R., C. E. TAMBINI, P. J. SIMPSON, and J. THACKER, 1998  The XRCC2 DNA repair gene from human and mouse encodes a novel member of the recA/RAD51 family. Nucleic Acids Res. 26:3084-3089[Abstract/Free Full Text].

CHEN, C. and H. OKAYAMA, 1987  High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745-2752[Abstract/Free Full Text].

CLEVER, B., H. INTERTHAL, J. SCHMUCKLI-MAURER, J. KING, and M. SIGRIST et al., 1997  Recombinational repair in yeast: functional interactions between Rad51 and Rad54 proteins. EMBO J. 16:2535-2544[Medline].

DOSANJH, M. K., D. W. COLLINS, W. FAN, G. G. LENNON, and J. S. ALBALA et al., 1998  Isolation and characterization of RAD51C, a new human member of the RAD51 family of related genes. Nucleic Acids Res. 26:1179-1184[Abstract/Free Full Text].

FELSENSTEIN, J., 1985  Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791.

FELSENSTEIN, J., 1993 PHYLIP (phylogeny inference package). Department of Genetics, University of Washington, Seattle.

FELSENSTEIN, J., 1996  Inferring phylogenies from protein sequences by parsimony, distance, and likelihood methods. Methods Enzymol. 266:418-427[Medline].

GASIOR, S. L., A. K. WONG, Y. KORA, A. SHINOHARA, and D. K. BISHOP, 1998  Rad52 associates with RPA and functions with Rad55 and Rad57 to assemble meiotic recombination complexes. Genes Dev. 12:2208-2221[Abstract/Free Full Text].

GRIMM, C., J. KOHLI, J. MURRAY, and K. MAUNDRELL, 1988  Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol. Gen. Genet. 215:81-86[Medline].

HABU, T., T. TAKI, A. WEST, Y. NISHIMUNE, and T. MORITA, 1996  The mouse and human homologs of DMC1, the yeast meiosis-specific homologous recombination gene, have a common unique form of exon-skipped transcript in meiosis. Nucleic Acids Res. 24:470-477[Abstract/Free Full Text].

HAYS, S. L., A. A. FIRMENICH, and P. BERG, 1995  Complex formation in yeast double-strand break repair: participation of Rad51, Rad52, Rad55, and Rad57 proteins. Proc. Natl. Acad. Sci. USA 92:6925-6929[Abstract/Free Full Text].

HEYER, W.-D., 1994  The search for the right partner: homologous pairing and DNA strand exchange proteins in eukaryotes. Experientia 50:223-233[Medline].

ISHIOKA, K., H. IWASAKI, and H. SHINAGAWA, 1997  Roles of the recG gene product of Escherichia coli in recombination repair: effects of the recG mutation on cell division and chromosome partition. Genes Genet. Syst. 72:91-99[Medline].

ISHIOKA, K., A. FUKUOH, H. IWASAKI, A. NAKATA, and H. SHINAGAWA, 1998  Abortive recombination in Escherichia coli ruv mutants blocks chromosome partitioning. Genes Cells 3:209-220[Abstract].

JANG, Y. K., Y. H. JIN, E. M. KIM, F. FABRE, and S. H. HONG et al., 1994  Cloning and sequence analysis of rhp51⁺, a Schizosaccharomyces pombe homolog of the Saccharomyces cerevisiae RAD51 gene. Gene 142:207-211[Medline].

JIANG, H., Y. XIE, P. HOUSTON, K. STEMKE-HALE, and U. H. MORTENSEN et al., 1996  Direct association between the yeast Rad51 and Rad54 recombination proteins. J. Biol. Chem. 271:33181-33186[Abstract/Free Full Text].

JOHNSON, R. D. and L. S. SYMINGTON, 1995  Functional differences and interactions among the putative RecA homologs Rad51, Rad55, and Rad57. Mol. Cell. Biol. 15:4843-4850[Abstract].

KANS, J. A. and R. K. MORTIMER, 1991  Nucleotide sequence of the RAD57 gene of Saccharomyces cerevisiae.. Gene 105:139-140[Medline].

KEENEY, J. B. and J. D. BOEKE, 1994  Efficient targeted integration at leu1-32 and ura4-294 in Schizosaccharomyces pombe.. Genetics 136:849-856[Abstract].

KHASANOV, F. K., G. V. SAVCHENKO, E. V. BASHIKIROVA, V. G. KOROLEV, and W.-D. HEYER et al., 1999  A new recombinational DNA repair gene from Schizosaccharomyces pombe with homology to E. coli RecA. Genetics 152:1557-1572[Abstract/Free Full Text].

LIU, N., J. E. LAMERDIN, R. S. TEBBS, D. SCHILD, and J. D. TUCKER et al., 1998  XRCC2 and XRCC3, new human Rad51-family members, promote chromosome stability and protect against DNA cross-links and other damages. Mol. Cell 1:783-793[Medline].

MAUNDRELL, K., 1993  Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123:127-130[Medline].

MORENO, S., A. KLAR, and P. NURSE, 1991  Molecular genetics analysis of fission yeast Schizosaccharomyces pombe.. Methods Enzymol. 194:795-823[Medline].

MURIS, D. F. R., K. VREEKEN, A. M. CARR, B. C. BROUGHTON, and A. R. LEHMANN et al., 1993  Cloning the RAD51 homologue of Schizosaccharomyces pombe.. Nucleic Acids Res. 21:4586-4591[Abstract/Free Full Text].

MURIS, D. F. R., K. VEEKEN, A. M. CARR, J. M. MURRAY, and C. SMIT et al., 1996  Isolation of the Schizosaccharomyces pombe RAD54 homologue, rhp54⁺, a gene involved in the repair of radiation damage and replication fidelity. J. Cell Sci. 109:73-81[Abstract].

MURIS, D. F. R., K. VREEKEN, H. SCHMIDT, K. OSTERMANN, and B. CLEVER et al., 1997  Homologous recombination in the fission yeast Schizosaccharomyces pombe: different requirements for the rhp51⁺, rhp54⁺ and rad22⁺ genes. Curr. Genet. 31:248-254[Medline].

MURRAY, J. M., M. TAVASSOLI, R. AL-HARITHY, K. S. SHELDRICK, and A. R. LEHMANN et al., 1994  Structural and functional conservation of the human homolog of the Schizosaccharomyces pombe rad2 gene, which is required for chromosome segregation and recovery from DNA damage. Mol. Cell. Biol. 14:4878-4888[Abstract/Free Full Text].

OGAWA, T., X. YU, A. SHINOHARA, and E. H. EGLMAN, 1993  Similarity of the yeast RAD51 filament to the bacterial RecA filament. Science 259:1896-1899[Abstract/Free Full Text].

OKAZAKI, K., N. OKAZAKI, K. KUME, S. JINNO, and K. TANAKA et al., 1990  High-frequency transformation method and library transducing vectors for cloning mammalian cDNAs by trans-complementation of Schizosaccharomyces pombe.. Nucleic Acids Res. 181:6485-6489.

OKUNO, Y., T. OKAZAKI, and H. MASUKATA, 1997  Identification of a predominant replication origin in fission yeast. Nucleic Acids Res. 25:530-536[Abstract/Free Full Text].

OSTERMANN, K., A. LORENTZ, and H. SCHMIDT, 1993  The fission yeast rad22 gene, having a function in mating-type switching and repair of DNA damages, encodes a protein homolog to Rad52 of Saccharomyces cerevisiae.. Nucleic Acids Res. 21:5940-5944[Abstract/Free Full Text].

PETUKHOVA, G., S. STRATTON, and P. SUNG, 1998  Catalysis of homologous DNA pairing by yeast Rad51 and Rad54 proteins. Nature 393:91-94[Medline].

PITTMAN, D. L., L. R. WEINBERG, and J. C. SCHIMENTI, 1998  Identification, characterization, and genetic mapping of Rad51d, a new mouse and human RAD51/RecA-related gene. Genomics 49:103-111[Medline].

PRABHALA, G., G. H. ROSENBERG, and N. F. KÄUFER, 1992  Architectural features of pre-mRNA introns in the fission yeast Schizosaccharomyces pombe.. Yeast 8:171-182[Medline].

RICE, M. C., S. T. SMITH, F. BULLRICH, P. HAVRE, and E. B. KMIEC, 1997  Isolation of human and mouse genes based on homology to REC2, a recombinational repair gene from the fungus Ustilago maydis.. Proc. Natl. Acad. Sci. USA 94:7417-7422[Abstract/Free Full Text].

SAITOU, N. and M. NEI, 1987  The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Evol. Biol. 4:406-425[Abstract].

SHINOHARA, A. and T. OGAWA, 1995  Homologous recombination and the roles of double-strand breaks. Trends Biochem. Sci. 20:387-391[Medline].

SHINOHARA, A. and T. OGAWA, 1998  Stimulation by Rad52 of yeast Rad51-mediated recombination. Nature 391:404-407[Medline].

SHINOHARA, A., H. OGAWA, and T. OGAWA, 1992  Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein. Cell 69:457-470[Medline].

SHINOHARA, A., H. OGAWA, Y. MATSUDA, N. USHIO, and K. IKEO et al., 1993  Cloning of human, mouse and fission yeast recombination genes homologous to RAD51 and recA.. Nature Genet. 4:239-243[Medline].

SUGIYAMA, T., E. M. ZAITSEVA, and S. C. KOWALCZYKOWSKI, 1997  A single-stranded DNA-binding protein is needed for efficient presynaptic complex formation by the Saccharomyces cerevisiae Rad51 protein. J. Biol. Chem. 272:7940-7945[Abstract/Free Full Text].

SUNG, P., 1994  Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein. Science 265:1241-1243[Abstract/Free Full Text].

SUNG, P., 1997a  Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. J. Biol. Chem. 272:28194-28197[Abstract/Free Full Text].

SUNG, P., 1997b  Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes Dev. 11:1111-1121[Abstract/Free Full Text].

SUNG, P. and D. L. ROBBERSON, 1995  DNA strand exchange mediated by a Rad51-ssDNA nucleoprotein filament with polarity opposite to that of RecA. Cell 82:453-461[Medline].

SYMINGTON, L. S., 1998  Homologous recombination is required for the viability of rad27 mutants. Nucleic Acids Res. 26:5589-5595[Abstract/Free Full Text].

TAVASSOLI, M., M. SHAYEGHI, A. NASIM, and F. Z. WATTS, 1995  Cloning and characterization of the Schizosaccharomyces pombe rad32 gene: a gene required for repair of double strand breaks and recombination. Nucleic Acids Res. 23:383-388[Abstract/Free Full Text].

THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994  CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680[Abstract/Free Full Text].

TSUBOUCHI, H. and H. OGAWA, 1998  A novel mre11 mutation impairs processing of double-strand breaks of DNA during both mitosis and meiosis. Mol. Cell. Biol. 18:260-268[Abstract/Free Full Text].

WAGA, S. and B. STILLMAN, 1998  The DNA replication fork in eukaryotic cells. Annu. Rev. Biochem. 67:721-751[Medline].

This article has been cited by other articles:

				Y. Akamatsu, Y. Murayama, T. Yamada, T. Nakazaki, Y. Tsutsui, K. Ohta, and H. Iwasaki Molecular Characterization of the Role of the Schizosaccharomyces pombe nip1+/ctp1+ Gene in DNA Double-Strand Break Repair in Association with the Mre11-Rad50-Nbs1 Complex Mol. Cell. Biol., June 1, 2008; 28(11): 3639 - 3651. [Abstract] [Full Text] [PDF]

				J. C. Hope, L. D. Cruzata, A. Duvshani, J. Mitsumoto, M. Maftahi, and G. A. Freyer Mus81-Eme1-Dependent and -Independent Crossovers Form in Mitotic Cells during Double-Strand Break Repair in Schizosaccharomyces pombe Mol. Cell. Biol., May 15, 2007; 27(10): 3828 - 3838. [Abstract] [Full Text] [PDF]

				D. M. Sheedy, D. Dimitrova, J. K. Rankin, K. L. Bass, K. M. Lee, C. Tapia-Alveal, S. H. Harvey, J. M. Murray, and M. J. O'Connell Brc1-Mediated DNA Repair and Damage Tolerance Genetics, October 1, 2005; 171(2): 457 - 468. [Abstract] [Full Text] [PDF]