- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Begun, D. J.
- Articles by Whitley, P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Begun, D. J.
- Articles by Whitley, P.
Adaptive Evolution of Relish, a Drosophila NF-
B/I
B Protein
David J. Beguna and
Penn Whitleya
a Section of Integrative Biology and Institute for Cellular and Molecular Biology, University of Texas, Austin, Texas 78712
Corresponding author: David J. Begun, Section of Integrative Biology, Patterson Labs C0930, University of Texas, Austin, TX 78712., djbegun{at}mail.utexas.edu (E-mail)
Communicating editor: W. STEPHAN
| ABSTRACT |
|---|
NF-
B and I
B proteins have central roles in regulation of inflammation and innate immunity in mammals. Homologues of these proteins also play an important role in regulation of the Drosophila immune response. Here we present a molecular population genetic analysis of Relish, a Drosophila NF-
B/I
B protein, in Drosophila simulans and D. melanogaster. We find strong evidence for adaptive protein evolution in D. simulans, but not in D. melanogaster. The adaptive evolution appears to be restricted to the I
B domain. A possible explanation for these results is that Relish is a site of evolutionary conflict between flies and their microbial pathogens.
A possible consequence of host-pathogen interactions is an "arms race" resulting in rapid evolution; pathogens evolve to evade host defenses while host defenses evolve to circumvent such evasion (![]()
![]()
![]()
![]()
![]()
![]()
Rel/NF-
B proteins and I
B proteins play an important role in vertebrate innate immunity and inflammation, and in regulation of the Drosophila immune response (![]()
![]()
![]()
B domains function in dimerization and DNA binding. I
B domains are composed primarily of ankyrin repeats, which function in protein-protein interactions. These domains interact to control the subcellular localization of NF-
B (![]()
B proteins form a complex with NF-
B proteins, maintaining the latter in an inactive cytoplasmic form, probably through interaction with a nuclear localization signal (![]()
![]()
![]()
![]()
B results in unmasking of the nuclear localization signal and subsequent translocation of NF-
B to the nucleus, where it transcriptionally upregulates several genes. Thus, I
B proteins usually function as inhibitors of NF-
B activity. Rel proteins are found complexed with their I
B inhibitors in the cytoplasm of uninfected animals, thereby allowing initiation of signal-induced immune response in the absence of additional production of Rel proteins. Such a mechanism allows rapid induction of the immune response.
Drosophila Relish is an unusual member of the Rel family of proteins (![]()
B domains and an inhibitory I
B domain (Fig 1). The mammalian p100 and p105 genes have a similar structure; however, in most cases these domains are found in different genes (![]()
B and NF-
B proteins are known to interact, there is no experimental evidence bearing on the question of whether the two functional domains of Relish participate in direct interactions with one another. Relish is transcriptionally upregulated in response to microbial infection (![]()
![]()
B domain of Relish is hypothesized to belong to the
subfamily of I
B proteins (![]()
![]()
![]()
|
| MATERIAL AND METHODS |
|---|
D. melanogaster alleles (n = 6) were sampled at random from homozygous chromosome III stocks made from isofemale lines from Zimbabwe. D. simulans alleles (n = 7) were sampled from a set of highly inbred lines made from individual females caught at the Wolfskill Orchard, Winters, California in summer of 1995. A D. yakuba allele was isolated from an isofemale line obtained from the Drosophila Species Center at Bowling Green State University. The Relish region was amplified in two fragments. The first fragment was amplified using PCR primers cccggcggcaattcaccacac (forward560) and cccggcggcaattcaccacac (reverse1560); the second fragment was amplified using PCR primers gtgtgggaggcatacgcaaagttccg (forward1543) and gttgggttaaccagtagggcgtaagc (reverse3246). Numbering of primers refers to the most 3' nucleotide of the primer using the coordinates of GenBank entry U62005. PCR products from Relish were directly sequenced using an ABI 377 automated sequencer. We analyzed 803 codons of Relish from all three species (the entire protein is 971 amino acids long in D. melanogaster). The region surveyed corresponds to bases 5612999 of GenBank entry U62005. A 303-bp intron is located between bases 1271 and 1272 of the GenBank entry (which was derived from a cDNA). Sequences reported here can be found under GenBank accession nos.
AF204277,
AF204278,
AF204279,
AF204280,
AF204281,
AF204282,
AF204283,
AF204284,
AF204285,
AF204286,
AF204287,
AF204288,
AF204289,
AF204290. All sequences were easily aligned, with the exception of alignment of the D. yakuba intron with the intron of both D. simulans and D. melanogaster; none of the analyses presented here depend on proper alignment of this region. Analyses were carried out using the SITES (![]()
![]()
![]()
![]()
![]()
| RESULTS |
|---|
Fig 2 and Table 1 Table 2 Table 3 Table 4 Table 5 show summaries of variation at the Relish gene within and between D. simulans and D. melanogaster. Silent site heterozygosity at Relish in D. simulans is close to the average value for genes located in regions of normal recombination in this species (![]()
![]()
![]()
![]()
|
|
|
|
|
|
Table 2 shows the number of silent and replacement polymorphisms within D. melanogaster and D. simulans, and the number of silent and replacement fixations between species. Under the null hypothesis that polymorphisms and fixations are neutral, the ratio of silent to replacement polymorphism should be roughly equal to the ratio of silent to replacement fixations (![]()
![]()
Polymorphisms and fixations in different regions of Relish can be analyzed separately to determine whether significant heterogeneity of polymorphisms and fixations in D. simulans is attributable to unusual evolution throughout the gene or rather to evolution in particular regions. We divide up the sequenced region of Relish into four domains (Fig 1). Two easily recognizable functional domains of Relish are the NF-
B region and the region from the first ankyrin repeat to the termination codon (![]()
![]()
B domain as our fourth domain, though again there are no data suggesting a particular function. We refer to regions I and II as the NF-
B region (composed primarily of two Rel-homology domains), and regions III and IV as the I
B region (composed primarily of ankyrin repeats).
Table 3 shows the numbers of silent and replacement polymorphisms and fixed differences, as well as numbers of fixed differences in each of the two lineages for each of the four regions of Relish. The main conclusion from analyses of these data is that polymorphism and divergence are significantly heterogeneous for both region III (the "spacer") and region IV (the ankyrin repeats) in D. simulans and in the pooled data. Homogeneity tests of polymorphism and divergence for other subsets of the data are not significant. In terms of functional domains, the I
B region of Relish (corresponding roughly to region III and IV; ![]()
B domain shows no evidence of deviations from neutrality in either species or in the pooled data.
![]()
![]()
![]()
![]()
Table 4 shows the numbers of preferred and unpreferred mutations at Relish. Homogeneity tests of the 2 x 3 contingency tables of polymorphic and fixed, preferred, unpreferred, and no change mutations are not significant in either D. simulans (P = 0.78) or D. melanogaster (P = 0.71). Addition of amino acid variation to the analyses results in significant rejection of homogeneity for the 2 x 4 contingency table from D. simulans (P < 10-5) but not for the comparable contingency table from D. melanogaster (P = 0.71). This suggests that rejection of homogeneity in D. simulans is attributable to selection on replacement sites.
Analysis of the three Drosophila lineages provides a moderate degree of additional insight into the evolutionary history of Relish. In the absence of sequence data from outgroups we are unable to distinguish between fixations from the common ancestor of the three species to D. yakuba, and the fixations from the common ancestor of the three species to the common ancestor of D. simulans/D. melanogaster. For convenience we refer to the lineage connecting the common ancestor of D. simulans/D. melanogaster with D. yakuba as the D. yakuba lineage. Silent divergence along the D. simulans lineage is about twice as great as the silent divergence along the D. melanogaster lineage, as was previously observed for other genes located in regions of normal rates of crossing-over in these two species (![]()
![]()
Table 5 shows the numbers of silent and replacement differences between the hypothetical ancestor of D. simulans/D. melanogaster and each of the three species in our analysis. The ratio of silent to replacement fixations in the D. yakuba lineage is significantly higher than the ratio in the other lineages. It is difficult to decide whether the silent fixations, the replacement fixations, or both kinds of fixations contribute to the lineage differences. Our estimates of silent substitutions per site along the D. simulans and D. melanogaster lineages are similar to the average rate estimated for eight genes (![]()
![]()
![]()
![]()
| DISCUSSION |
|---|
The configuration of polymorphisms and fixations at silent and replacement sites in Relish provides extremely strong evidence that a neutral model of molecular evolution cannot explain evolution of this gene; departures from predictions of the neutral model are primarily attributable to evolution in the D. simulans lineage. Furthermore, separate analysis of distinct structural/functional domains reveals that nonneutral evolution is apparent only in the I
B region of Relish.
Rejections of the null hypothesis of homogeneity in analyses of contingency tables of polymorphism and divergence can be difficult to interpret because, in principle, any observation or combination of observations can contribute to rejection of the null hypothesis (e.g., ![]()
![]()
![]()
![]()
However, ![]()
![]()
![]()
![]()
Multiple lines of evidence, however, render this explanation unlikely. Among the eight genes analyzed in ![]()
![]()
![]()
![]()
![]()
![]()
As we noted earlier, silent heterozygosity at Relish in D. melanogaster is low relative to silent heterozygosity at Relish in D. simulans. Comparison of the ratios of polymorphism to divergence (![]()
![]()
2 = 3.18, P = 0.07). Genes experiencing lower recombination rates are expected to be less variable (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
If the high rate of protein evolution at Relish in D. simulans is a consequence of directional selection, then how are we to explain the finding that a similar rate of protein evolution in D. melanogaster leaves us with no statistical support for adaptive evolution in this lineage? Comparison of silent and replacement divergence along each lineage (Table 1 and Table 2) shows that the main difference between lineages is the much higher rate of silent site evolution in D. melanogaster. As noted above, this might be attributable to differences in the recombinational environment of Relish in D. simulans and D. melanogaster resulting from the fixed inversion difference between species, as well as from the reduction of recombination that presumably occurred in ancestral D. melanogaster populations as this inversion increased in frequency on its way toward fixation. Therefore, one interpretation is that protein evolution has proceeded rapidly in both lineages as a consequence of directional selection but that statistical support for adaptation in D. melanogaster has been obscured by increased rates of silent site evolution in this lineage compared to the rate in D. simulans (![]()
![]()
The high silent heterozygosity at Relish in D. simulans is interesting in light of our inference of recurrent, directional selection at this gene in this lineage. This is something of a paradox, as directional selection can have large effects on reducing silent heterozygosity at tightly linked sites (![]()
![]()
![]()
![]()
Directional selection can result in rapid fixation times relative to the neutral expectation, yet can still have a fairly restricted impact on reducing linked sequence variation (![]()
![]()
![]()
![]()
![]()
![]()
![]()
We have convincingly established a history of directional selection on amino acid variation in D. simulans. How might our analysis impinge on broader issues of the evolution of fly immunity and the biological role of Relish? One potentially relevant finding is that there is strong evidence for adaptive evolution in the I
B domain, yet no evidence for adaptive protein evolution in the NF-
B domain. Models of I
B function posit that such proteins are modulated primarily through kinase-dependent phosphorylation and subsequent ubiquitin-dependent targeting to proteolytic degradation pathways (![]()
B region of Relish is likely to be caused strictly by selection resulting from interactions of this protein with internal signaling components. If this is thought to be unlikely, an alternative possibility is that selection pressures acting on the I
B domain of Relish arise from direct interactions with other molecules; those deriving directly from pathogens are obvious candidates.
One can speculate that microbial pathogens could benefit by interfering with activation of the Drosophila immune response. Pathogenic bacteria possessing type III secretion systems are able to carry out contact-mediated transport of proteins directly into the cytoplasm of host cells. These bacterial proteins can specifically interfere with host-cell signal transduction or other processes (![]()
B proteins such that nuclear translocation of NF-
B proteins (which regulate transcription of other immune system proteins) is inhibited would be a potential mechanism whereby microbial pathogens could suppress the Drosophila immune response. Drosophila populations would experience strong natural selection to evade such strategies. In this scenario, a putative arms race is manifested in an evolutionary conflict (mediated through interactions with I
B proteins) between fly and pathogen over control of subcellular localization of NF-
B proteins. These hypotheses must be considered to be very speculative. Our ability to formulate evolutionary hypotheses about Relish is limited by our poor understanding of the biology of this protein and its precise role in the Drosophila immune response.
Nevertheless, the data presented here provide at least one potential experimental foothold into the evolutionary or ecological genetics of Drosophila-microbe interactions. For example, analysis of phenotypic consequences of standing variation at Relish could prove interesting from both a mechanistic and evolutionary/ecological perspective. Experiments to elucidate functional consequences of interspecific differences in Relish in the context of natural pathogens might also be interesting. The recent discovery of numbers of Drosophila mutants affecting nuclear localization of Rel proteins (![]()
| ACKNOWLEDGMENTS |
|---|
Anonymous reviewers provided useful comments. This work was supported by National Institutes of Health grant GM55298.
Manuscript received September 9, 1999; Accepted for publication November 12, 1999.
| LITERATURE CITED |
|---|
AKASHI, H., 1996 Molecular evolution between Drosophila melanogaster and D. simulans: reduced codon bias, faster rates of amino acid substitution, and larger proteins in D. melanogaster.. Genetics 144:1297-1307[Abstract].
AKASHI, H., 1999 Inferring the fitness effects of DNA mutations from polymorphism and divergence data: statistical power to detect directional selection under stationarity and free recombination. Genetics 151:221-238
AQUADRO, C. F., D. J. BEGUN and E. C. KINDAHL, 1994 Selection, recombination, and DNA polymorphism in Drosophila, pp. 4656 in Non-Neutral Evolution: Theories and Molecular Data, edited by B. GOLDING. Chapman and Hall, New York.
ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BAUER, V. L. and C. F. AQUADRO, 1997 Rates of DNA sequence evolution are not sex-biased in Drosophila melanogaster and D. simulans.. Mol. Biol. Evol. 14:1252-1257[Abstract].
BEGUN, D. J. and C. F. AQUADRO, 1992 Levels of naturally occurring DNA polymorphism correlate with recombination rates in D. melanogaster.. Nature 356:519-520[Medline].
BEGUN, D. J. and C. F. AQUADRO, 1995 Molecular variation at the vermilion locus in geographically diverse populations of Drosophila melanogaster and D. simulans.. Genetics 140:1019-1032[Abstract].
BAEUERLE, P. A., 1998 I
B-NF-
B structures: at the interface of inflammation control. Cell 95:729-731[Medline].
CHARLESWORTH, B., M. T. MORGAN, and D. CHARLESWORTH, 1993 The effect of deleterious mutations on neutral molecular variation. Genetics 134:1289-1303[Abstract].
CLARK, A. G. and L. WANG, 1997 Molecular population genetics of Drosophila immune system genes. Genetics 147:713-724[Abstract].
DATE, A., Y. SATTA, N. TAKAHATA, and S. I. CHIGUSA, 1998 Evolutionary history and mechanism of the Drosophila cecropin gene family. Immunogenetics 47:417-429[Medline].
DURELL, S. R., G. RAGHUNATHAN, and H. R. GUY, 1992 Modeling the ion channel structure of cecropin. Biophys. J. 63:1623-1631
DUSHAY, M. S. and E. ELDON, 1998 Drosophila immune responses as models of human immunity. Am. J. Hum. Genet. 62:10-14[Medline].
DUSHAY, M. S., B. ASLING, and D. HULTMARK, 1996 Origins of immunity: Relish, a compound Rel-like gene in the antibacterial defense of Drosophila. Proc. Natl. Acad. Sci. USA 93:10343-10347
EANES, W. F., M. KIRCHNER, J. YOON, C. H. BIERMANN, and I. N. WANG et al., 1996 Historical selection, amino acid polymorphism and lineage-specific divergence at the G6pd locus in Drosophila melanogaster and D. simulans.. Genetics 144:1027-1041[Abstract].
GHOSH, S., M. J. MAY, and E. B. KOPP, 1998 NF-
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225-260[Medline].
HEY, J. and J. WAKELEY, 1997 A coalescent estimator of the population recombination rate. Genetics 145:833-846[Abstract].
HOFFMANN, J. A. and J.-M. REICHHART, 1997 Drosophila immunity. Trends Cell Biol. 7:309-316[Medline].
HUDSON, R. R., M. KREITMAN, and M. AGUADE, 1987 A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159
HUECK, C. J., 1998 Type III protein secretion systems in bacterial pathogens of plants and animals. Microbiol. Mol. Biol. Rev. 62(2):379-433
HUXFORD, T., D.-B. HUANG, S. MALEK, and G. GHOSH, 1998 The crystal structure of the I
B
/NF-
B complex reveals mechanisms of NF-kB inactivation. Cell 95:759-770[Medline].
INOUE, J., L. D. KERR, A. KAKIZUKA, and I. M. VERMA, 1992 I
B
, a 70kd protein identical to the C-terminal half of p110 NF-
B: a new member of the IkB family. Cell 68:1109-1120[Medline].
JACOBS, M. D. and S. C. HARRISON, 1998 Structure of an I
B
/NF-
B complex. Cell 95:749-758[Medline].
KAPLAN, N. L., R. R. HUDSON, and C. H. LANGLEY, 1989 The "hitchhiking" effect revisited. Genetics 123:887-899
KIMURA, M., 1983 The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge, United Kingdom.
KINDAHL, E. C., 1994 Recombination and DNA polymorphism on the third chromosome of Drosophila melanogaster. Ph.D. Thesis, Cornell University, Ithaca, NY.
KLIMAN, R. M. and J. HEY, 1993 Reduced natural selection associated with low recombination in Drosophila melanogaster.. Mol. Biol. Evol. 10:1239-1258[Abstract].
KYLSTEN, P., C. SAMAKOVLIS, and D. HULTMARK, 1990 The cecropin locus in Drosophila: a compact gene cluster involved in the response to infection. EMBO J. 9:217-224[Medline].
LEVIN, B. R., and R. E. LENSKI, 1983 Coevolution in bacteria and their viruses and plasmids, pp. 99127 in Coevolution, edited by D. FUTUYMA and M. SLATKIN. Sinauer, Sunderland, MA.
MAYNARD SMITH, J. and J. HAIGH, 1974 The hitchhiking effect of a favourable gene. Genet. Res. 23:23-35[Medline].
MCDONALD, J. M. and M. KREITMAN, 1991 Adaptive protein evolution at the Adh locus in Drosophila. Nature 351:652-654[Medline].
MORIYAMA, E. and J. R. POWELL, 1996 Intraspecific nuclear DNA variation in Drosophila. Mol. Biol. Evol. 13:261-277[Abstract].
NEI, M., 1987 Molecular Evolutionary Genetics. Columbia University Press, New York.
OHTA, T., 1992 The nearly neutral theory of molecular evolution. Annu. Rev. Ecol. Syst. 23:263-286.
RAMOS-ONSINS, S. and M. AGUADÉ, 1998 Molecular evolution of the cecropin multigene family in Drosophila: functional genes vs. pseudogenes. Genetics 150:157-171
ROZAS, J. and R. ROZAS, 1999 DnaSP 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175
SHARP, P. M., and A. T. LLOYD, 1993 Codon usage, pp. 378397 in An Atlas of Drosophila Genes: Sequences and Molecular Features, edited by G. MARONI. Oxford University Press, Oxford.
TAJIMA, F., 1989 Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595
TAKANO, T. S., 1998 Rate variation of DNA sequence evolution in the Drosophila lineages. Genetics 149:959-970
TSAUR, S.-C., C.-T. TING, and C.-I. WU, 1998 Positive selection driving the evolution of a gene of male reproduction, Acp26Aa, of Drosophila: II. Divergence vs. polymorphism. Mol. Biol. Evol. 15:1040-1046[Abstract].
WATTERSON, G. A., 1975 On the number of segregating sites in genetic models without recombination. Theor. Popul. Biol. 7:256-276[Medline].
WRIGHT, F., 1990 The "effective number of codons" used in a gene. Gene 87:23-29[Medline].
WU, L. P. and K. V. ANDERSON, 1998 Regulated nuclear import of Rel proteins in the Drosophila immune response. Nature 392:93-96[Medline].
YANG, Z., 1999 Phylogenetic analysis by maximum likelihood (PAML), Version 2.0. University College, London.
This article has been cited by other articles:
![]() |
S. Maheshwari, J. Wang, and D. A. Barbash Recurrent Positive Selection of the Drosophila Hybrid Incompatibility Gene Hmr Mol. Biol. Evol., November 1, 2008; 25(11): 2421 - 2430. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Lazzaro, T. B. Sackton, and A. G. Clark Genetic Variation in Drosophila melanogaster Resistance to Infection: A Comparison Across Bacteria Genetics, November 1, 2006; 174(3): 1539 - 1554. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Bulmer and R. H. Crozier Variation in Positive Selection in Termite GNBPs and Relish Mol. Biol. Evol., February 1, 2006; 23(2): 317 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Jiggins and K.-W. Kim The Evolution of Antifungal Peptides in Drosophila Genetics, December 1, 2005; 171(4): 1847 - 1859. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. B. DuMont and C. F. Aquadro Multiple Signatures of Positive Selection Downstream of Notch on the X Chromosome in Drosophila melanogaster Genetics, October 1, 2005; 171(2): 639 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Kroemer and B. A. Webb I{kappa}{beta}-Related vankyrin Genes in the Campoletis sonorensis Ichnovirus: Temporal and Tissue-Specific Patterns of Expression in Parasitized Heliothis virescens Lepidopteran Hosts J. Virol., June 15, 2005; 79(12): 7617 - 7628. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Lazzaro Elevated Polymorphism and Divergence in the Class C Scavenger Receptors of Drosophila melanogaster and D. simulans Genetics, April 1, 2005; 169(4): 2023 - 2034. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Bulmer and R. H. Crozier Duplication and Diversifying Selection Among Termite Antifungal Peptides Mol. Biol. Evol., December 1, 2004; 21(12): 2256 - 2264. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Nuzhdin, M. L. Wayne, K. L. Harmon, and L. M. McIntyre Common Pattern of Evolution of Gene Expression Level and Protein Sequence in Drosophila Mol. Biol. Evol., July 1, 2004; 21(7): 1308 - 1317. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Lazzaro, B. K. Sceurman, and A. G. Clark Genetic Basis of Natural Variation in D. melanogaster Antibacterial Immunity Science, March 19, 2004; 303(5665): 1873 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Schlenke and D. J. Begun Natural Selection Drives Drosophila Immune System Evolution Genetics, August 1, 2003; 164(4): 1471 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Lazzaro and A. G. Clark Molecular Population Genetics of Inducible Antibacterial Peptide Genes in Drosophila melanogaster Mol. Biol. Evol., June 1, 2003; 20(6): 914 - 923. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Begun The Frequency Distribution of Nucleotide Variation in Drosophila simulans Mol. Biol. Evol., July 1, 2001; 18(7): 1343 - 1352. [Abstract] [Full Text] [PDF] |
||||





