Genetics, Vol. 154, 695-712, February 2000, Copyright © 2000

A Genetic Screen for Novel Components of the Ras/Mitogen-Activated Protein Kinase Signaling Pathway That Interact With the yan Gene of Drosophila Identifies split ends, a New RNA Recognition Motif-Containing Protein

Ilaria Rebaya,c, Fangli Chena, Francis Hsiaoa, Peter A. Kolodziejb, Bing H. Kuangb, Todd Lavertyc, Chris Suhc, Matthew Voasa, Andrina Williamsa, and Gerald M. Rubinc
a Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02142,
b Howard Hughes Medical Institute, Vanderbilt University Medical Center, Nashville, Tennessee 37232-0295
c Howard Hughes Medical Institute, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720

Corresponding author: Ilaria Rebay, Whitehead Institute, 9 Cambridge Center, Cambridge, MA 02142., rebay{at}wi.mit.edu (E-mail)

Communicating editor: R. S. HAWLEY


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The receptor tyrosine kinase (RTK) signaling pathway is used reiteratively during the development of all multicellular organisms. While the core RTK/Ras/MAPK signaling cassette has been studied extensively, little is known about the nature of the downstream targets of the pathway or how these effectors regulate the specificity of cellular responses. Drosophila yan is one of a few downstream components identified to date, functioning as an antagonist of the RTK/Ras/MAPK pathway. Previously, we have shown that ectopic expression of a constitutively active protein (yanACT) inhibits the differentiation of multiple cell types. In an effort to identify new genes functioning downstream in the Ras/MAPK/yan pathway, we have performed a genetic screen to isolate dominant modifiers of the rough eye phenotype associated with eye-specific expression of yanACT. Approximately 190,000 mutagenized flies were screened, and 260 enhancers and 90 suppressors were obtained. Among the previously known genes we recovered are four RTK pathway components, rolled (MAPK), son-of-sevenless, Star, and pointed, and two genes, eyes absent and string, that have not been implicated previously in RTK signaling events. We also isolated mutations in five previously uncharacterized genes, one of which, split ends, we have characterized molecularly and have shown to encode a member of the RRM family of RNA-binding proteins.


DURING development, multicellular organisms must coordinate the growth, differentiation, and maintenance of many different cell types. To achieve this, each cell must continually integrate a complex array of external signals, including both inductive and inhibitory cues, and then translate these instructions into spatially and temporally appropriate developmental responses. Many of the signaling mechanisms regulating these decisions are used repeatedly, generating different cellular responses in different developmental contexts.

The Drosophila compound eye is an ideal tissue in which to study the molecular mechanisms underlying cell-cell communication (RUBIN 1988 Down; ZIPURSKY and RUBIN 1994 Down). The adult eye is composed of a regular array of ~800 ommatidial units, each one containing ~20 cells recruited in a stereotyped sequence of inductive interactions that involves extensive networks of intercellular signaling events (TOMLINSON and READY 1986 Down). The same evolutionarily conserved signaling mechanisms used reiteratively during the development of all multicellular organisms, including receptor tyrosine kinase (RTK), Notch, hedgehog, wingless, and transforming growth factor-ß (TGF-ß) pathways, play essential roles in establishing the architecture of the fly eye (CAGAN and READY 1989 Down; HEBERLEIN et al. 1993 Down; DICKSON and HAFEN 1994 Down; TREISMAN and RUBIN 1995 Down; PIGNONI and ZIPURSKY 1997 Down). Because the Drosophila eye is not required for viability or fertility of the adult, these essential signaling pathways can be perturbed and manipulated in an eye-specific manner without affecting the development or viability of the animal as a whole.

We have been focusing our investigations on the RTK-mediated signaling pathway that regulates a broad range of developmental events including mitogenesis, cell fate specification, and differentiation (MARSHALL 1994 Down; MARUTA and BURGESS 1994 Down; VAN DER GEER et al. 1994 Down). Extensive investigations from numerous laboratories have shown that RTKs signal through an evolutionarily conserved pathway that involves the GTPase Ras and the mitogen-activated protein kinase (MAPK) cascade of serine/threonine kinases (MARSHALL 1994 Down; ZIPURSKY and RUBIN 1994 Down). In Drosophila, the RTK/Ras/MAPK cascade acts inductively to promote cell fate specification and differentiation of numerous embryonic and adult tissues including the central nervous system (CNS), muscles, tracheal system, wing veins, neuronal and nonneuronal cells in the eye, and oogenesis (SHILO 1992 Down; DICKSON and HAFEN 1994 Down; DUFFY and PERRIMON 1994 Down; SCHNORR and BERG 1996 Down; ENGSTROM et al. 1997 Down; LEE and MONTELL 1997 Down; SCHWEITZER and SHILO 1997 Down; BUFF et al. 1998 Down). While genetic and biochemical screens have identified many of the components required for Ras activation and for transmission of this information through the MAPK signaling cascade, the downstream effector molecules that coordinate different physiological responses, and thereby impart specificity to the pathway, have remained largely elusive.

A small number of genes have been identified as downstream targets of activated MAPK in Drosophila. These include two Ets-domain transcription factors, pointed and yan, the AP-1 transcription factor D-jun, and the cell death gene hid (O'NEILL et al. 1994 Down; KOCKEL et al. 1997 Down; BERGMANN et al. 1998 Down). However, little is known about how these proteins regulate gene expression in response to RTK-initiated signals or whether the Ras/MAPK signal alone regulates their activity. We have been investigating the function of one of these genes, yan, in an effort to understand more about how RTK-mediated signals are transduced to the nucleus.

yan was originally identified as a negative regulator of R7 photoreceptor neuron differentiation in the developing eye, acting as an antagonist to the proneural signal mediated by the sevenless RTK signaling pathway (LAI and RUBIN 1992 Down). Subsequent studies have shown that yan functions as a fairly general inhibitor of differentiation, preventing both neuronal and nonneuronal cell types from responding inappropriately to external signals in multiple developmental contexts (REBAY and RUBIN 1995 Down). Experiments in cultured cells suggest yan functions as a transcriptional repressor, and that phosphorylation of yan by MAPK negatively regulates this repressor activity (O'NEILL et al. 1994 Down).

Mutation of the phosphoacceptor residues in all eight of the MAPK phosphorylation consensus sites in yan produces a stable protein that cannot be properly "turned off" (REBAY and RUBIN 1995 Down). This allele is referred to as yanACT for "activated" yan. Overexpression of yanACT inhibits differentiation of multiple neuronal and nonneuronal cell types throughout development, indicating that yan function is not restricted to the sevenless (sev) RTK pathway, which operates only in a discrete subset of cells in the developing eye (REBAY and RUBIN 1995 Down). Work from several labs has confirmed that in addition to its role in antagonizing the sev-mediated signal, yan also functions downstream of and negatively regulates at least two other known RTK pathways, the epidermal growth factor receptor and the fibroblast growth factor receptor pathways (SHILO 1992 Down; REBAY and RUBIN 1995 Down; SAMAKOVLIS et al. 1996 Down). Thus, because yan functions as a transcriptional repressor downstream of multiple RTK pathways, it offers an ideal tool with which to address the issue of how specificity of response to RTK-mediated signaling events is generated in different developmental contexts.

We have undertaken an extensive genetic screen to identify dominant modifiers of the rough eye phenotype associated with eye-specific overexpression of the yanACT transgene. Our screen was modeled on previous successful screening efforts that have been pivotal in identifying components of the RTK/Ras/MAPK cascade. Each screen has taken a slightly different starting point, beginning with the RTK and progressing down the pathway (for example, SIMON et al. 1991 Down; DICKSON et al. 1996 Down; KARIM et al. 1996 Down). While there has been some overlap in the genes identified, each new screen has also isolated unique genes, and thereby has made significant contributions to our understanding of how the signal is transduced from the RTK, to Ras, Raf, and the MAPK cascade. Thus, by approaching the pathway from various angles, new information has been discovered at each step. Centering the screen around one of the most downstream components in this conserved pathway should facilitate identification of some of the elusive downstream effectors and regulators of the RTK pathway.

In this article we describe the results of a genetic modifier screen in which we isolated 15 complementation groups that dominantly enhance the yanACT rough eye phenotype and 6 complementation groups that dominantly suppress it. These genes include known components of the pathway such as rolled/MAPK, the guanine nucleotide exchange factor son of sevenless, and the Ets family transcription factor pointed, as well as several novel genes, which, based on genetic interaction data, are likely to encode relevant new components of the Ras/MAPK pathway. We report preliminary molecular analysis of one of these novel genes, called split ends, that suggests it encodes a member of the RNA recognition motif (RRM) family of proteins.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

yanACT modifier screen:
To facilitate chromosomal linkage analysis and establishment of balanced stocks, the GMR-yanACT and sev-yanACT transgenes (REBAY and RUBIN 1995 Down) were mobilized onto CyO and TM3Sb balancer chromosomes. Independent insertion events in which the yanACT phenotype cosegregated with the balancer were screened for strength, dose sensitivity, and variability of phenotype. Based on these criteria, two lines, Sev-yanACT on CyO (SCY) and GMR-yanACT on CyO (GCY), were selected as suitable for use in the modifier screen. Two other lines, sev-yanACT on TM3Sb (STY) and GMR-yanACT on TM3Sb (GTY), were selected for use in determining chromosomal linkage.

Male w1118 flies isogenic for the second and third chromosomes were fed 25 mM EMS or treated with 4000 R of X rays (1000 sec at 115 kEV, 5 mA), and then mated to w1118;Sco/SCY or w1118;Sco/GCY females. The eyes of F1 progeny were examined under a dissecting microscope for enhancement or suppression of the SCY or GCY phenotype. Potential modifiers were backcrossed to w1118;Sco/SCY or w1118;Sco/GCY as appropriate, and the F2 progeny were rescored for suppression or enhancement. In the F2 generation, linkage of the mutation to the second chromosome could be determined if all non-Sco flies bearing the SCY or GCY chromosome showed the appropriate modification; in this case a balanced stock, w1118;modifier/SCY or GCY, was established. If the modifier segregated randomly with respect to the SCY or GCY chromosome, this indicated linkage of the mutation to the third chromosome. To establish a balanced stock, flies of the genotype w1118;+/SCY or GCY;modifier/+ were crossed to w1118;CxD/STY or GTY. In the next generation, a balanced stock of w1118;modifier/STY or GTY was established by selecting STY or GTY flies showing the appropriate enhancement or suppression. x-chromosome-linked modifiers were too difficult to maintain in the yanACT backgrounds, which on their own exhibit reduced fertility, and were lost. Therefore, only the second and third chromosomes have been screened for modification of the yanACT phenotype.

Complementation tests based on lethality were performed among all mutations mapping to the same chromosome. Single hits are those mutations that complement all other mutations on that chromosome. A number of mutations are viable; these have not been mapped, and therefore it is not possible to know how many different genes they represent. Two alleles for each defined complementation group were mapped meiotically relative to b pr c px sp on the second chromosome and ru h th st cu sr e ca on the third. Both the lethality and enhancement or suppression of yanACT were mapped. Lethal complementation tests with deficiencies, P-element insertions, and other mutations in the region were used to further refine the map position. Noncomplementation was as follows (refer to Table 1): EY2-1 and clift(eya1); EY2-2 and rolledS135 (KARIM et al. 1996 Down); EY2-3 and son of sevenlesse2H (SIMON et al. 1991 Down); EY2-4 and StarES2-4e220 (NEUFELD et al. 1998 Down); EY2-5 and Df(2L)ast1; EY2-7 and P elements l(2)03350, l(2)k06805, l(2)k07612, l(2)k07721, l(2)k08102, l(2)k13233, l(2)k13624,l(2)k15612, l(2)k06703, l(2)k10325, l(2)k13601; EY2-8 and Df(2L)CX1; EY2-9 and sin3l(2)7401 (NEUFELD et al. 1998 Down); EY2-10 and dead ringer1 (GREGORY et al. 1996 Down); EY3-1 and pointed7825{Delta}78 (O'NEILL et al. 1994 Down); EY3-2 and Df(3R)e-R1; EY3-3 and Df(3R)e-R1; SY2-1 and SS2-1s35 (NEUFELD et al. 1998 Down); SY3-1 and SR3-4aS-192 (KARIM et al. 1996 Down); SY3-2 and TAF110S117 (KARIM et al. 1996 Down); SY3-3 and glass1; SY3-4 and stringeAS7a (VERHEYEN et al. 1996 Down).


 
View this table:
In this window
In a new window

 
Table 1. Summary of genetic interactions

Histology:
Flies were prepared for scanning electron microscopy by fixation for 2 hr in 1% glutaraldehyde, 1% paraformaldehyde in 1 M cacodylate buffer followed by dehydration through an ethanol series and critical point drying. Fixation and sectioning of adult eyes was as described by TOMLINSON et al. 1987 Down.

Molecular analysis of EY2-7:
Plasmid rescue (PIRROTTA 1986 Down) was used to isolate genomic DNA flanking l(2)7721 and l(2)7612. An ~20-kb BglII fragment on one side of the P-element insertion site and an ~25-kb SacII site on the other were recovered. Cytological examination of X-ray-induced EY2-7 alleles revealed one allele, designated xLS1000, to be a cytologically visible inversion. To determine whether either of the two plasmid rescue DNA fragments crossed the xLS1000 breakpoint, chromosomal in situ hybridization on xLS1000 chromosomes was performed. The SacII fragment crossed the xLS1000 breakpoint, while the BglII fragment was entirely distal (data not shown). The entire SacII genomic fragment and various smaller subclones of this fragment were used as probes to screen cDNA libraries prepared from eye-antennal imaginal discs (made by A. Cowman), adult heads (obtained from the lab of Y. N. Jan), and embryos (made by L. Hong and G. M. Rubin). To obtain cDNAs spanning the entire coding sequence, four successive rounds of screening were performed, each using a probe taken from the most 3' sequence of the longest cDNA at hand. The cDNAs were sonicated. Random ~1-kb fragments were subcloned into Bluescript and then sequenced with Universal and Reverse primers on an ABI 373 sequencer. An ~2-kb gap in the coding sequence (nucleotide coordinates 12018–14125), apparent from comparison of our sequence to the Berkeley Drosophila Genome Project (BDGP) genomic sequence (GenBank accession no. AC005334), was filled in by RT-PCR using the Marathon cDNA amplification kit (Clontech, Palo Alto, CA). Primer pairs used to amplify two overlapping fragments covering the region were: primer pair 1: 5' ATGGTAAGCCAACCATCACC 3' and 5' TCTGGTTACAGGAGCTGTTACGGG-3'; primer pair 2: 5' ATCATGATACAGAGGACGAAACGG 3' and 5' AGTATCCGTGAGCAACATGTGACCG 3'. Sequencing primers were designed based on the BDGP genomic sequence, and both strands of the RT-PCR products were sequenced directly without subcloning. To confirm the existence of the noncoding cDNAs j1 and 2A1, RT-PCR was performed from adult heads and embryos. Primers were designed to span the introns in both cDNAs: for cDNA j1: primers 5' CGAAACGGCAAGTGCTTAAGCGAAAG 3' and 5' AACAGTTCGTTGTGGATAGCAGCACC 3'. For cDNA 2A1: primers 5' TGGTAAGCTATCAAGAACATATCTGC 3' and 5' TACCTTCCCACACAGATCGTACTCC3'. For negative control, primers were designed in the predicted introns: for cDNA j1: intron primers 5' AGTGAAAGGCGTGTGGTAGATCACG 3' and 5' TACCTTCCCACACAGATCGTACTCC 3'; for cDNA 2A1: intron primers 5' AATACGACTTCAAGATGAGTCGTCG 3' and 5' TTTCGGAAGTCTGTGAATCGATAGC 3'. If our cDNAs were artifactual, no PCR product would be recovered in the case of j1, which has an ~12-kb predicted intron, and a larger than expected product would be amplified for 2A1, which has a much smaller predicted intron. For both j1 and 2A1, bands of the expected sizes were obtained, indicating that these two cDNAs represent bona fide spliced mRNA species (data not shown). No bands were amplified with the intronic primers. The approximate position of the introns was determined by comparing our cDNA sequence to BDGP genomic sequence.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

A genetic screen for modifiers of yanACT:
Overexpression of a yan cDNA in which all eight putative MAPK phosphorylation consensus sites were mutated to a nonphosphorylatable form, referred to as yanACT, inhibits the differentiation of multiple neuronal and nonneuronal cell types (REBAY and RUBIN 1995 Down). Previously, we have described the effects of expressing the yanACT transgene in the developing Drosophila eye using the sevenless (sev) and GMR promoters (Figure 1, A–C; FORTINI et al. 1992 Down; HAY et al. 1994 Down; REBAY and RUBIN 1995 Down). sev-yanACT flies have rough eyes characterized by the loss of the R3, R4, and R7 photoreceptor neurons and the nonneuronal cone cells. GMR-yanACT flies have more severely disrupted eyes due to inhibition of differentiation of photoreceptors R1–R8, the cone cells, and other accessory cells of the eye. Both sev-yanACT and GMR-yanACT rough eye phenotypes are sensitive to the copy number of the transgene (data not shown). That is, flies carrying two copies of the transgene have more severely disrupted eyes than flies with only one copy. The dose sensitivity of the phenotype suggested that both sev-yanACT and GMR-yanACT genetic backgrounds might represent good starting points for a genetic screen designed to identify potential regulators or targets of yan activity.



View larger version (117K):
In this window
In a new window
Download PPT slide
 
Figure 1. The yanACT-based genetic screen. Scanning electron micrographs (SEM) of the starting phenotypes used in the genetic modifier screen. (A) Wildtype, (B) sev-yanACT/+, and (C) GMR-yanACT/+. (D) Schematic representation of the strategy for the screen. w1118 males were mutagenized with either EMS or X rays and were mated to virgin females carrying the yanACT transgene either under sevenless or GMR promoter control (SCY and GCY, respectively). In the subsequent (F1) generation, progeny were scored for enhancement or suppression of the rough eye phenotype. An asterisk indicates a mutagenized chromosome.

An important feature of this type of genetic screen is that it is designed to isolate dominant modifiers of a specific phenotype. The expectation is that a twofold reduction in activity of a pathway relevant gene, achieved by mutating one of the two copies present in the diploid genome, will dominantly enhance or suppress the starting background phenotype. In contrast, in a wild-type background, a twofold reduction in gene activity will produce dominant phenotypes only rarely. Thus in a wild-type background, screens designed to study the phenotypic consequences of reduction in gene activity will require at least two generations to produce a homozygous mutant and a visible phenotype. However, many of the genes involved in signal transduction pathways are essential for viability, necessitating either analysis of lethal embryonic phenotypes or clonal analysis in particular tissues. While such F2 screens have been extremely successful at isolating genes functioning in specific developmental processes (for example, NUSSLEIN-VOLHARD et al. 1984 Down; DUFFY et al. 1998 Down) the genetic modifier screen has proven to be a highly efficient method of dissecting signaling pathways in genetically manipulable organisms (for example, in Drosophila, SIMON et al. 1991 Down; DICKSON et al. 1996 Down; KARIM et al. 1996 Down; VERHEYEN et al. 1996 Down). In addition, the ease of a dominant F1 screen allows large numbers of flies to be screened, thereby approaching saturation.

In our screen, because yan is a negatively acting factor in the RTK pathway, expression of the stable yanACT product reduces overall signaling output by the pathway. Thus in the yanACT background, a twofold reduction in activity of positively acting genes elsewhere in the pathway will further reduce signaling output, thereby exacerbating the eye phenotype. Such mutations will be recovered as enhancers. Conversely, halving the activity of negatively acting components of the pathway will increase the overall output of the pathway. Such mutations will be recovered as suppressors of yanACT or as flies with less severely disrupted eyes.

Approximately 80,000 progeny from EMS-mutagenized flies and 110,000 progeny from X-ray-mutagenized flies were screened for ability to dominantly modify the yanACT phenotype. The scheme of the screen is diagrammed in Figure 1D. Approximately half of the screen was performed in the sev-yanACT background and half in the GMR-yanACT background (Figure 2A and Figure D). Both enhancers and suppressors of the rough eye phenotype were recovered from each portion of the screen (Figure 2B, Figure C, Figure E, and Figure F). A total of 260 enhancer mutations was recovered, 177 on the second chromosome and 83 on the third chromosome. Also, 90 suppressor mutations were recovered, 49 on the second chromosome and 21 on the third chromosome. Complementation analysis placed 215 of the mutations into 21 complementation groups (Table 1). The remaining 135 mutations include both "single hit" alleles that do not fall into any of the complementation groups and viable mutations. These 135 mutations have not been mapped or characterized further.



View larger version (212K):
In this window
In a new window
Download PPT slide
 
Figure 2. Isolation of enhancers and suppressors of yanACT. SEMs of both the starting yanACT phenotypes and examples of recovered modifiers determined by the genetic tests as likely to encode RTK pathway relevant products. (A) SCY/+; (B) EY2-3/SCY; (C) SY2-2/SCY; (D) GCY/+; (E) EY2-3/GCY; (F) SY2-2/GCY. For enhancer mutations, the eye is smaller and more disorganized than the parental strain. For suppressor mutations, the eye is larger and the ommatidial lattice is more regular in appearance. EY, enhancer of yanACT; SY, suppressor of yanACT.

Genetic tests to determine which are the "pathway relevant" groups:
One of the most important aspects of a genetic interaction screen is to design suitable secondary screens that will distinguish pathway relevant mutations from inevitable background. These secondary tests serve as a sort of "genetic triage" that allows rapid classification of the isolated mutations and prioritization of further efforts to understand the role of the genes in the particular context being studied. Our secondary screens were designed to identify those mutations that specifically affect the RTK/Ras/MAPK/yan pathway. All alleles from the 21 complementation groups were tested, and the results for two alleles representative of each group are shown in Table 1. The results of these genetic tests, together with the identification of several known components of the RTK signaling pathway among the candidate genes isolated, indicate that the yanACT interaction screen appears to have worked as designed.

Test 1: To distinguish potential pathway relevant mutations from those that affect the strength of the promoters driving yanACT expression: Because our screen involves expressing the yanACT transgene under the control of eye-specific promoter elements, one class of modifiers we expected to isolate and wanted to eliminate was that affecting the strength of the promoters. For example, because the yanACT phenotypes are dose sensitive, if we recover a mutation that increases the strength of the promoter element, this will result in increased yanACT expression and an enhancement of the rough eye phenotype. Such a mutation does not affect yan or Ras pathway activity directly, and is unlikely to be relevant to the signaling pathway. Thus, the first genetic test was designed to separate the pathway relevant mutants from the promoter-specific mutants. We reasoned that pathway relevant mutants will modify both the GMR-yanACT and sev-yanACT rough eye phenotypes, whereas promoter-specific mutations will modify one background only. Therefore, all modifiers obtained from the GMR-yanACT half of the screen were crossed to the sev-yanACT background, and conversely all modifiers obtained from the sev-yanACT half of the screen were crossed to the GMR-yanACT background.

On the basis of this test, 11 of the 21 complementation groups appear relevant to Ras/MAPK/yan signaling (these are underlined in Table 1). In fact, for the complementation groups that passed test 1, alleles were isolated both from the sev-yanACT and the GMR-yanACT halves of the screen, confirming these results in an unbiased manner. Further confirming that this test was working as planned, among the 11 pathway relevant groups are known components of the RTK pathway including rolled/MAPK, son of sevenless, Star, and pointed (ROGGE et al. 1991 Down; SIMON et al. 1991 Down; KLAMBT 1993 Down; BIGGS et al. 1994 Down; O'NEILL et al. 1994 Down). Isolation of these genes as enhancers of the yanACT phenotype is consistent with their known roles as positive factors in the RTK pathway.

Two of the 11 pathway relevant groups were found to be allelic to previously characterized genes whose role, if any, in the RTK signaling pathway has not yet been determined. EY2-1 is allelic to eyes absent (eya), a gene known to function within a hierarchy of genes essential for determining eye fate during development (BONINI et al. 1993 Down, BONINI et al. 1997 Down). SY3-4 is allelic to string, the Drosophila homologue of the cdc25 phosphatase cell cycle regulator (EDGAR and O'FARRELL 1989 Down). The remaining RTK pathway candidate groups, EY2-5, EY2-6, EY2-7, and EY3-5, appear to be uncharacterized genes.

Among the known genes classified as promoter specific are TAF110, a coactivating factor in PolII transcription (HOEY et al. 1993 Down), glass, a transcription factor essential for expression of the GMR element (ELLIS et al. 1993 Down; HAY et al. 1994 Down), dead ringer, a homeodomain-related protein (GREGORY et al. 1996 Down), and sin3A, a transcriptional repressor (WANG et al. 1990 Down). Other genes in this category that have been isolated in previous screens are SY2-1, which is allelic to SS2-1, and SY3-1, which is allelic to SR3-4a and SS3-4 (KARIM et al. 1996 Down; NEUFELD et al. 1998 Down). The genes corresponding to the EY2-8, EY3-2, EY3-3, and EY3-4 complementation groups have to our knowledge not been identified previously.

Test 2: To determine which groups interact with an endogenous gain-of-function yan allele: In the second genetic test to determine which were the relevant yan-interacting genes, a gain-of-function yan allele (yanS2382; KARIM et al. 1996 Down) was crossed to all alleles of the 21 complementation groups (Table 1). The phenotypes of yanS2382 animals are similar to, although milder than, those seen with the yanACT transgene. Homozygous yanS2382 flies have slightly roughened eyes, reflecting an increase in stability of the yanS2382 protein product that inhibits differentiation of the photoreceptor neurons. Sequence determination of the molecular lesion associated with the mutation revealed the predicted protein to be a truncated form of yan that lacks the C-terminal 162 amino acids (REBAY and RUBIN 1995 Down). The sequence deleted in yanS2382 covers one of the PEST-rich regions of the protein that is postulated to be critical for normal downregulation of yan in response to Ras/MAPK activation. Thus yanACT, a gain-of-function allele generated by mutating the phosphoacceptor residue in all eight putative MAPK sites to alanine, and yanS2382, a truncation allele, although they each cause very different alterations in the protein, both result in similar phenotypes in the developing eye. Modifiers that interact strongly with both gain-of-function yan backgrounds are likely to encode proteins relevant to yan function.

The results of this second test overlapped almost perfectly with the first test, further supporting our logic that those groups "passing" the tests represent likely RTK/yan pathway relevant genes. We found that 9/11 of the genes determined to be pathway relevant by test 1 interacted strongly with yanS2382, whereas none of the promoter-specific groups affected yanS2382. The two groups (indicated in Table 1 with an asterisk) that did not modify the yanS2382 background but are not promoter specific are EY2-5 and SY3-4 (string). One possibility is that these two groups are relevant to the Ras/MAPK/yan pathway, but that functional differences between yanACT and the yanS2382 gain-of-function allele create differences in sensitivity to second site modifiers. An alternative possibility is that these two genes act at the level of promoter strength, but act similarly on both the GMR and sev elements. Interestingly, EY2-5, a group of two alleles, was placed in the category of genes passing test 1 because one allele was isolated from the sev-yanACT part of the screen and the other from the GMR-yanACT part. However, neither EY2-5 allele modifies the eye phenotype in the other promoter background.

Test 3: To determine which groups interact with other RTK pathway components: The third test was based on the assumption that if a modifier of yanACT is involved in the RTK signaling pathway, it is likely to interact with other components of the pathway in addition to yan. We therefore tested whether the modifiers of yanACT interacted with two eye-specific transgenes, sev promoter-driven dominant negative Ras (RasN17) and sev promoter-driven activated Ras (RasV12), as well as with a hypomorphic Raf alleles which at 18° produces occasional hemizygous males with rough eyes (RafHM7; KARIM et al. 1996 Down). Furthermore, the direction of interaction, whether enhancement or suppression, should be consistent with the modifier acting as a positive or negative factor in the pathway. For example, the expectation for an allele that enhances yanACT is that it should enhance dominant negative RasN17 and hypomorphic RafHM7, but suppress activated RasV12. All 11 groups identified as RTK pathway relevant showed consistent interactions with additional components of the pathway, whereas the promoter-specific groups did not (Table 1).

The alleles we isolated of known components of the RTK pathway behaved generally as expected or as shown previously by others. For example, EY2-2 (rolled/MAPK) alleles, which were isolated as enhancers of yanACT, strongly suppress RasV12, enhance RasN17, and are synthetic lethal with RafHM7. The direction of modification is in each case consistent with rolled functioning as a positively acting component of the RTK pathway. Several complementation groups exhibited similar patterns of interactions in these crosses, strongly suggesting an involvement as positively acting factors in the pathway. For example, most alleles of EY2-1 (eyes absent) suppress RasV12 (although several, including G130, show no interaction), enhance RasN17, and are either synthetic lethal with RafHM7 or else produce hemizygous "escaper" males with an enhanced rough eye phenotype (data not shown). EY2-7 exhibited a similar pattern of interactions except all alleles were synthetic lethal with RafHM7.

Other groups exhibited less consistent patterns of interactions in the various Ras pathway backgrounds. For complementation groups consisting of small numbers of alleles, there were allele-specific differences in behavior that made classification difficult. With large complementation groups of 10 or more alleles, it was easier to establish the general pattern of interaction, despite an occasional allele-specific inconsistency. SY3-4 (string) alleles showed no interaction with RasN17 or RafHM7, but 1 of the 2 alleles strongly enhanced RasV12 while the other showed no interaction. EY2-5 and EY2-6 also showed some contradictory patterns of interaction. One allele of EY2-5 and 1 allele of EY2-6 were found to enhance both RasN17 and RasV12, while the other allele showed no interaction. Other groups, such as EY2-3 (sos), EY3-1 (pointed), and EY3-5, enhanced RasN17 but showed little or no interaction with RasV12. These inconsistencies could simply be indicative of the different sensitivities of a particular genetic background to modification by reduction of dosage of a specific gene, or could suggest that the interaction may be more complex, possibly involving both positive and negative regulatory feedback loops. It should be stressed that these initial tests are used to prioritize future efforts as to which genes to investigate in detail. Definitive proof of involvement in RTK/yan-mediated signaling events must await further genetic and biochemical characterization of the function of the genes.

Molecular analysis of EY2-7:
EY2-7 comprises a group of 37 alleles, of which 18 are EMS induced and 19 are X-ray induced. Meiotic mapping localized the gene to the distal end of the left arm of the second chromosome. To define the genomic location of the gene more precisely, we screened deficiencies and lethal P-element insertions in the region for failure to complement EY2-7. Df(2L)PMF47c and 11 lethal P-element insertions fail to complement EY2-7 and also enhance yanACT (data not shown).

To determine whether the P-element insertions were responsible for the lethal noncomplementation, the P elements were excised from all 11 lines. For all P alleles, both viable and lethal excision events were recovered. The viable lines, presumably precise excision events in which the P elements were removed without causing chromosomal deletions, complemented EY2-7 alleles, and no longer enhanced the yanACT rough eye phenotype, indicating that they no longer carried an EY2-7 mutation (data not shown). The lethal lines, presumably imprecise excisions in which the chromosomal region surrounding the original P-element insertion site was disrupted, failed to complement EY2-7 alleles and enhanced yanACT(data not shown). These results suggested that the P alleles were inserted in or near the EY2-7 gene and could be used as molecular probes with which to clone the gene.

We isolated ~45 kb of genomic DNA flanking the insertion sites of the two P elements showing the strongest enhancement of yanACT (see MATERIALS AND METHODS). We have subsequently determined that all 11 P-element lines are inserted within the same ~4-kb region (Figure 3A; data not shown). A 25-kb fragment of genomic DNA flanking the P-element insertion sites was found to cross the inversion breakpoint of a cytologically visible X-ray-induced EY2-7 allele (Figure 3A; data not shown). Southern blot restriction fragment polymorphism (RFLP) analyses using this genomic fragment as a probe revealed polymorphisms in multiple EY2-7 alleles (data not shown). Together, these data suggested the EY2-7 gene would reside within the 25 kb of genomic DNA. This genomic fragment was therefore used as a probe to screen an embryonic cDNA library. A single class of cDNAs was isolated (referred to as class I; Figure 3A), the largest of which was ~6.5 kb in length. Restriction mapping placed the cDNA ~20 kb away from the site of P-element insertion. In situ hybridization showed that the cDNA crossed the EY2-7 inversion allele breakpoint (data not shown). Sequence analysis revealed that the class I cDNA contained a 6-kb open reading frame (ORF) but lacked a stop codon. To obtain the full-length cDNA, several additional rounds of screening were needed to compile an ~18-kb contig.






View larger version (349K):
In this window
In a new window
Download PPT slide
 
Figure 3. Molecular characterization of EY2-7 (spen). (A) The 50-kb genomic region encompassing the spen gene is depicted as a black line. The numbers underneath indicate the size of the region in kilobases. The scale of the drawing is indicated with a short line representing 2 kb. The P-element lines that fail to complement EY2-7 mutations are inserted over an ~4-kb region. The position of the inversion allele, xLS1000, is indicated with a pair of lines at ~15 kb along the genomic sequence, and is marked as In for inversion. Three cDNAs, j1, 2A1, and class I, are indicated as thick black lines above the genomic line. j1 and 2A1 are noncoding cDNAs; class I corresponds to the spen gene. Introns are depicted as open triangles above the cDNAs. The predicted spen protein product derived from the class I cDNA is depicted underneath. Three structural domains, RRM, black box, coiled-coil (CC, striped box), and C-terminal conserved region (c-term, gray box) are indicated. The scale bar beneath indicates 500 amino acids. (B) The spen RRM motif is shown aligned with RRMs from several predicted proteins. The positions of conserved residues that define the RRM consensus sequence are indicated with an asterisk above the amino acid. The amino acid consensus sequence defining the RRM motif is indicated above the asterisk for the first RRM of spen. The RNP1 hexapeptide and RNP2 octapeptide regions for each RRM are indicated with a line above the amino acid sequence. The three spen RRMs are indicated with circled numbers 1, 2, and 3. In the alignment, identical amino acids are boxed and highlighted in dark gray. Similar amino acids are boxed and highlighted in light gray. Alignment was done using MacVector's ClustalW program. Accession numbers for all GenBank sequences are as follows: Dm 44a, AC005448; Hs spen, AL096858; Mm RRM, CAB01562 (the aligned sequence for Mm RRM is a composite of the GenBank sequence and sequence from a partial cDNA isolated from a mouse teratocarcinoma library; I. REBAY, unpublished results; sequence available upon request); Ce RRM, AF067616. (C) The conserved spen C terminus is shown aligned with C-terminal domains from several predicted proteins. Identical amino acids are boxed and highlighted in dark gray. Similar amino acids are boxed and highlighted in light gray. Alignment was done using MacVector's ClustalW program. Accession numbers for all GenBank sequences are as follows: Hs spen, AL096858; Dm 44a, AC005448; Ce CAA91320, Z66511. (D) Sequence of the composite full-length spen cDNA. Nucleotide sequence is indicated above; conceptual translation of the ORF is indicated below. The putative RRM region is underlined with a solid line. The predicted coiled-coil region is underlined with a dashed line. The conserved C-terminal region is highlighted in gray. Two putative potential polyadenylation signal sequences are highlighted in bold. GenBank accession no. AF184612.

Because the 5' end of our cDNA was so far away from the P-element insertion site, we wanted to rule out the possibility that the true EY2-7 gene lay within the intervening ~20 kb of genomic DNA. To test whether there were additional transcripts in this region, we subdivided the intervening ~20 kb into five different subclones, and screened several cDNA libraries with each fragment. Two cDNA clones were isolated, one from an eye imaginal disc library (2A1) and the other from an adult head library (j1; Figure 3A). When sequenced, both were found to lack ORFs greater than ~250 amino acids in any reading frame. Because we isolated so many EMS alleles of EY2-7, we reasoned the gene was unlikely to encode a short polypeptide, and did not consider these noncoding cDNAs likely candidates to encode EY2-7. We have used RT-PCR to confirm that the noncoding cDNAs we isolated reflect actual transcripts rather than possible genomic contaminants in the libraries (see MATERIALS AND METHODS).

Another possibility was that the EY2-7 transcript was within this ~20-kb genomic region, but was of such low abundance that even extensive screening of the libraries would fail to detect it. However, confirming that our lack of success in finding a candidate cDNA within the ~20-kb genomic region was not simply due to its being an extremely low abundance message, but rather due to the lack of coding transcripts within this region, the BDGP has submitted complete genomic sequence covering this region (GenBank accession no. AC005334). Conceptual translation of this ~20-kb genomic DNA confirms the absence of any sizeable ORFs (data not shown), suggesting that there are no additional coding sequences residing in between the P-element insertion sites and our class I cDNA.

On the basis of this information, our best cDNA candidate for EY2-7 resides ~20 kb away from the P-element insertion sites. We think it is likely that the noncoding cDNAs we isolated may represent parts of a large and complex 5' untranslated region (5'UTR) or possibly alternatively spliced 5' ends of EY2-7. Supporting this idea, the insertion sites for several of the noncomplementing P-element alleles fall within one of these cDNAs (j1; Figure 3A).

Complementation tests show that EY2-7 is allelic to the gene split ends (spen) (KOLODZIEJ et al. 1995 Down). Mutations in EY2-7 fail to complement two alleles of spen that have been molecularly characterized and shown to have lesions within the coding sequence of the EY2-7/spen cDNA that result in predicted truncated protein products (B. KUANG and P. KOLODZIEJ, unpublished results). This indicates that our class I cDNA is indeed encoded by the EY2-7 gene. From now on we will refer to EY2-7 as spen.

spen encodes a predicted protein of 5476 amino acids. Database searches indicate spen belongs to a family of RRM proteins. The RRM is a loosely conserved RNA binding domain of ~22 conserved amino acids spread over an 80–100-amino-acid-long region (for review see BURD and DREYFUSS 1994 Down). The most highly conserved sequences within the RRM motif are two ribonucleoprotein (RNP) domains designated RNP2 (a hexapeptide) and RNP1 (an octapeptide). Other conserved residues are scattered throughout the domain and include primarily hydrophobic amino acids.

Spen contains three RRM motifs in tandem toward the N terminus of the protein (amino acids ~500–750). The spen RRMs are most similar to RRMs in several novel proteins of unknown function. These include proteins predicted from conceptual translation of the BDGP Drosophila genomic sequence and the Caenorhabditis elegans genomic sequence, and proteins predicted from conceptual translation of human and mouse EST sequences (Figure 3B). The first RRM of spen is most divergent from the RRM consensus, and is also more loosely conserved among other spen-like proteins. Homology between spen and other known RRM proteins in Drosophila or other species is less striking and strictly limited to residues defining the RRM consensus sequence (not shown). Thus, spen may define a new subclass of RRM proteins.

Other motifs in spen include a predicted coiled coil region over amino acids 1857–1922 (probability 1.0) and amino acids 1979–2014 (probability 0.589) that could be suggestive of protein-protein interactions (BERGER et al. 1995 Down; WOLF et al. 1997 Down) and a highly conserved C-terminal domain of unknown function that is found in proteins from worms to humans (Figure 3A and Figure C). Otherwise, the spen protein sequence appears novel. Because some of the sequences identified by the database searches correspond to short EST sequences (for example, Mm RRM), it will be necessary to isolate full-length cDNA clones in order to determine whether these proteins contain both the RRM and the C-terminal domain. However, both motifs are found in a second Drosophila protein and in a human protein (referred to as Dm 44A and Hs spen, respectively, in Figure 3B and Figure C), suggesting that Drosophila spen is a member of a novel family of proteins defined by both the RRM and C-terminal motifs.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have performed a dominant modifier screen for enhancers and suppressors of the rough eye phenotype associated with expression of the yanACT transgene in the developing Drosophila eye with the goal of isolating novel components of the RTK/Ras/MAPK pathway. Genetic tests suggest 11 of the 21 complementation groups recovered are Ras pathway relevant genes. We have found that 4 of these 11 groups are allelic to known RTK/Ras pathway genes. Isolation of known Ras pathway signaling components confirms that both the screen and the genetic tests are working as designed. That is, known Ras pathway genes are isolated as modifiers of yanACT, and these genes can be functionally distinguished from the promoter-specific factors that were also recovered in the screen.

In addition to known pathway components, we have also isolated a set of seven genes that have not been implicated previously in RTK signaling events, but appear likely to play important roles in this pathway, based on the genetic tests. Thus, by initiating a genetic modifier screen based on one of the most downstream components of the RTK pathway identified to date, we have successfully isolated new candidate signaling molecules that were not recovered in previous RTK pathway-based screens. These seven genes include two genes with known functions in other developmental contexts, eyes absent and string, as well as five previously uncharacterized genes. We have initiated the molecular characterization of one of these novel genes, called split ends, and show it encodes a member of the RRM family of RNA-binding proteins.

Isolation of known RTK pathway genes:
Among the mutations in known RTK pathway genes isolated in our screen, 44 alleles of the Ets domain transcription factor pointed were recovered as strong enhancers of yanACT. Genetically, pointed is a positive regulator of RTK/Ras-mediated signals, functioning downstream of MAPK in multiple developmental contexts including the developing oocyte, the embryonic CNS, and the photoreceptors of the eye (KLAMBT 1993 Down; BRUNNER et al. 1994 Down; O'NEILL et al. 1994 Down; SCHOLZ et al. 1997 Down). Experiments in cultured cells have demonstrated that pointed is a transcriptional activator whose activity is stimulated by the Ras/MAPK pathway (O'NEILL et al. 1994 Down). Because pointed and yan are members of the same family of transcription factors and will bind to the same DNA sequences in vitro, it has been postulated that cellular responses to RTK signaling may involve a competition between yan and pointed for access to certain promoters. An alternate model is that yan and pointed represent two different branches of gene regulation downstream of MAPK. Efforts to distinguish between these hypotheses have been thwarted by our lack of knowledge of the identities of these downstream targets. In addition, other than homology and parallel placement in the Ras pathway, there was no evidence supporting a functional interaction between yan and pointed. Our isolation of pointed alleles as dominant enhancers of yanACT is a strong indication of an intimate interaction between yan and pointed. Future genetic and biochemical investigations will be required to understand more fully the mechanisms underlying the genetic relationship between these two transcription factors in RTK signaling events.

Our screen also identified a group of 35 enhancers allelic to Star. Star encodes a membrane protein of unknown biochemical function that is thought to assist in processing of the epidermal growth factor receptor (Egfr) ligand Spitz, thereby promoting signaling (KOLODKIN et al. 1994 Down; PICKUP and BANERJEE 1999 Down). Star mutations exhibit a dominant rough eye phenotype, suggesting the enhancement of yanACT could simply represent an additive phenotype rather than a synergistic interaction. On the other hand, the enhancement of yanACT is extremely strong, reducing the eye to a tiny slit (data not shown). This phenotype is stronger than would be expected if the phenotypes were simply additive, and this suggests that there may be a synergistic aspect to the interaction. Mutations in Star have been isolated in numerous, but not all, genetic screens based on rough eye phenotypes, again suggesting there may be meaningful specificity to the interaction (DICKSON et al. 1996 Down; KARIM et al. 1996 Down; VERHEYEN et al. 1996 Down; NEUFELD et al. 1998 Down). Assuming Star functions at the level of regulating the production of an activated ligand for Egfr (PICKUP and BANERJEE 1999 Down), the interaction with yan is likely to be indirect unless regulatory feedback loops or direct transcriptional control is involved.

The third known RTK pathway gene isolated in our screen is rolled. rolled encodes the MAPK that functions downstream of multiple RTKs in Drosophila, and has been shown to phosphorylate yan directly in vitro (BIGGS et al. 1994 Down; BRUNNER et al. 1994 Down). Because the yanACT product lacks the eight MAPK consensus phosphorylation sites and can thus presumably no longer be phosphorylated by MAPK, it is likely that enhancement of the yanACT eye phenotype by mutations in rolled reflects either an interaction with the endogenous wild-type yan protein or with other pathway components such as pointed. For example, reducing the activity of MAPK would increase the stability of the endogenous pool of yan protein, thereby exacerbating the rough eye phenotype associated with yanACT. Reduction in MAPK activity would also result in a reduction in levels of pointed activation, which, based on our isolation of pointed mutations in the screen, causes a strong enhancement of the yanACT rough eye phenotype.

The final known RTK component we isolated is son of sevenless (sos), the guanine nucleotide exchange factor (GEF) for Ras (ROGGE et al. 1991 Down; SIMON et al. 1991 Down; CHARDIN et al. 1993 Down). We were somewhat surprised to isolate alleles of sos because prior to initiating the genetic screen, we had tested all available RTK pathway mutations, including sos null mutations, for interaction with our yanACT background (I. REBAY and G. M. RUBIN, unpublished results). We found that mutations in sos exhibited a barely detectable enhancement of the rough eye phenotype, and thus we did not expect to isolate sos in our screen. However, mapping and complementation tests showed that EY2-3, a complementation group of 10 alleles that includes several extremely strong enhancers of yanACT (Figure 2B and Figure E), is allelic to sos. In addition, sos null alleles are strong suppressors of the RasV12 background, whereas our EY2-3 alleles show little or no suppression (F. CHEN and I. REBAY, unpublished observations). On the basis of the difference in interaction patterns between null sos alleles and our EY2-3 alleles, we think it is likely that our screen has selected for a particular class of sos alleles. In addition to the Ras GEF domain, sos also contains a so-called Dbl homology domain that is thought to serve as a GEF for the Rho family of small GTPases that included Ras, Rho, and Cdc42 (NIMNUAL et al. 1998 Down; SOISSON et al. 1998 Down). Thus, one possibility is that our EY2-3 alleles have normal Ras GEF function, but have altered Rho GEF function. If correct, this hypothesis implies a role for yan downstream of the Rho family GTPases in addition to its role downstream of the Ras pathway.

Consistent with the idea that our yan-based screen may be identifying genes that function in pathways other than the Ras/MAPK cascade and that yan itself may be a downstream target of multiple signaling pathways, yan has been shown previously to be a downstream target of Jun kinase (Jnk; RIESGO-ESCOVAR and HAFEN 1997 Down). Jnk is a member of the MAPK family, and is thought to function downstream of the Rac/Rho/Cdc42 GTPases (NOSELLI 1998 Down). In vitro, Jnk can directly phosphorylate yan on the same sites phosphorylated by rolled/MAPK, and based on genetic interactions between yan and basket (Jnk), this phosphorylation presumably destabilizes and inactivates yan (RIESGO-ESCOVAR and HAFEN 1997 Down). It is possible that sos, being capable of serving as a GEF for both Ras and Rho family GTPases, may be a key mediator of cross-talk between these signaling cascades, and that yan, a direct target of at least two MAPK family members, may represent an additional downstream integration point for the different signals. Further investigation of points of intersection between the Ras, and the Rac, Rho, and Cdc42 signaling pathways will be required to elucidate the mechanisms underlying these interactions.

Isolation of string and eyes absent, two known genes that have not been implicated previously in RTK signaling events:
Among the remaining seven pathway relevant candidates are two genes of known function that have not been implicated previously in RTK/Ras-mediated signaling events. One of these groups, SY3-4, is allelic to the phosphatase string, a Drosophila homologue of the yeast cell cycle gene cdc25 (EDGAR and O'FARRELL 1989 Down). string regulates the G2-M transition in dividing cells by dephosphorylating and activating the cdc2 kinase, thereby allowing formation of cyclin/cdc2 complexes that promote S phase (EDGAR and O'FARRELL 1990 Down). On the basis of the direction of interaction with yanACT, string would be postulated to be an antagonist of Ras signaling. Previous suggestions of a possible antagonistic relationship between string and Ras signaling came from a screen for modifiers of roughex, a negative regulator of G1 progression in the developing eye, which identified string as a suppressor and ras1 as an enhancer (THOMAS et al. 1994 Down).

yan itself has been implicated in cell cycle control (ROGGE et al. 1995 Down). Whereas hypomorphic yan mutations are semi-viable and have an extra photoreceptor phenotype (LAI and RUBIN 1992 Down), null mutations in yan are embryonic lethal, with the embryos dying as a result of overproliferation of cells in the dorsal neuroectoderm (ROGGE et al. 1995 Down). Thus, depending on the developmental context, yan regulates not only the transition between undifferentiated and differentiated cell types, but also the choice between differentiation and cell division. Recovery of string alleles in our screen could reflect cross-talk between cell cycle and differentiation pathways that occurs in part at the level of transcriptional regulation. Thus, it is possible that the downstream targets of yan will include cell cycle regulators such as string or that yan expression and stability may be linked to cell cycle controls. Alternatively, string could have postmitotic functions essential to differentiation.

To our knowledge, string has not been isolated in any other Ras pathway screens; however, it was isolated, again as a suppressor, in a screen for modifiers of activated Notch (VERHEYEN et al. 1996 Down). The direction of interaction suggests string acts as a positive regulator of Notch signaling. Expression of NACT and yanACT have similar developmental consequences in that both inhibit or delay differentiation of the cell types in which they are expressed (FORTINI et al. 1993 Down; REBAY and RUBIN 1995 Down). Isolation of string in both screens could indicate a point of cross-talk between the Notch and the RTK/Ras pathway. Alternatively, isolation of string as a suppressor of both NotchACT and yanACT could have more to do with the similar terminal phenotype of these two backgrounds rather than reflecting direct interactions with the two pathways. Supporting the first hypothesis, cross-talk between the Notch and RTK pathways has been reported by numerous labs (CAGAN and READY 1989 Down; ROGGE et al. 1995 Down; KARIM et al. 1996 Down; VERHEYEN et al. 1996 Down; PRICE et al. 1997 Down). Despite all the genetic interaction data, the mechanisms whereby the Notch and RTK pathways intersect remain to be determined. Experiments designed to study signaling by both pathways in vivo have suggested an antagonistic relationship (DE CELIS and BRAY 1997 Down; PRICE et al. 1997 Down; GREENWALD 1998 Down; MILLER and CAGAN 1998 Down), which would be consistent with string acting as a negative regulator of Ras signal transduction and a positive regulator of Notch signal transduction.

The second gene with a previously defined function that may be relevant to the RTK pathway on the basis of our genetic tests is eyes absent (eya; BONINI et al. 1993 Down). eya encodes a novel nuclear protein of unknown function that has been shown recently by several labs to function in a hierarchy of "master eye regulatory genes" that are required to specify and promote differentiation of eye tissue (CHEN et al. 1997 Down; PIGNONI et al. 1997 Down; HALDER et al. 1998 Down). However, on the basis of expression pattern and phenotypes, it is possible that eya plays additional roles in development independent of its role in determining competence to become eye tissue (BONINI et al. 1998 Down; LEISERSON et al. 1998 Down). One possibility is that eya could be directly complexed with yan, and could direct its transcriptional repressor activity in certain tissues. However, preliminary yeast two-hybrid experiments have failed to indicate yan-eya protein-protein interactions (A. WILLIAMS and I. REBAY, unpublished results). An alternate possibility to be investigated is transcriptional regulation of eya by yan. Given the genetic interactions we have observed between eya and yanACT, it will be interesting to investigate the possible role of eya in RTK/yan-mediated signaling events in the embryo and developing eye. It could be that in order to differentiate as eye tissue, a developing cell must receive both a "general" differentiation signal from the RTK pathway and a more specific eye fate specification signal.

Isolation of potential new components of the RTK/Ras/Yan signaling pathway:
Four of the remaining five pathway relevant complementation groups, EY2-5, EY2-6, EY3-5, and SY2-2, are in the initial stages of characterization. Potential roles for these genes include downstream transcriptional targets of yan, upstream kinases or phosphatases, proteins directly complexed with yan that regulate its activity, or elements of intersecting signaling pathways that cross-talk with the Ras pathway at the level of yan (Figure 4). We are particularly interested in SY2-2 as it is one of the few suppressor groups recovered in the screen that passed both genetic tests, strongly suppressing GMR-yanACT, Sev-yanACT, and yanS2382 (Figure 2C and Figure D; Table 1). Based on the direction of our screen, suppressor mutations are expected to be negative regulators of Ras signal transduction. In addition, both alleles of SY2-2 interact very strongly, in the expected direction, with all Ras pathway backgrounds tested except GMR-sina and GMR-ttk (Table 1). Therefore, because of the unique nature of SY2-2 in the screen and because of the strength and consistency of its genetic behavior, a primary focus in the future will be to determine what it encodes. To date, complementation analyses with available Ras pathway and other candidate genes have been uninformative.



View larger version (14K):
In this window
In a new window
Download PPT slide
 
Figure 4. Potential functions for yan-interacting genes isolated in the screen. A simplified RTK pathway is depicted. Arrows indicate a positive direction of interaction, and blunt arrows indicate a negative direction of interaction. Enhancers of yanACT [E(yan)], predicted to be positively acting components of the pathway, could potentially function as downstream targets of yan's transcriptional activity, as cofactors binding to yan that regulate its transcriptional activity, as components of other intersecting signaling pathways that feed into the RTK pathway at the level of yan, as other downstream targets of MAPK that function in parallel or in conjunction with yan, or as regulators of the RTK/Ras/MAPK cascade upstream of yan.

spen encodes a novel member of the RRM family of RNA-binding proteins:
We have cloned the fifth pathway relevant complementation group, spen (EY2-7), and found that it encodes a member of the RRM family of RNA-binding proteins (BURD and DREYFUSS 1994 Down). The RRM sequence is an 80–100-amino-acid stretch of sequence that forms an RNA-binding domain (RBD). This motif is characterized by a bipartite RNP consensus sequence that forms the RNA-binding surface of the domain, as well as several predominantly hydrophobic amino acids dispersed throughout the RRM that are essential for the overall structure of the domain. RRM-containing proteins mediate a variety of post-transcriptional RNA-processing reactions including mRNA splicing, stability, and transport. In Drosophila, RNA-processing reactions and the RRM-containing proteins that mediate them are critical to multiple developmental processes. For example, in sex determination, sex-specific alternate splicing reactions are regulated by the RRM-containing proteins tra2 and Sxl (BELL et al. 1988 Down; AMREIN et al. 1994 Down). Establishment of dorsoventral polarity in the oocyte requires input from the RRM protein squid to localize the mRNA encoding the Egfr ligand gurken (MATUNIS et al. 1994 Down). Another RRM protein, elav, is expressed in all Drosophila neurons and is required for determination and maintenance of the neuronal fate, although the precise mechanism of function is not clear (KOUSHIKA et al. 1996 Down; YANNONI and WHITE 1997 Down).

spen has three RRM motifs in tandem within the first 1000 amino acids of the protein. Database searches identify a number of predicted proteins from either genomic sequencing efforts or EST projects that have very similar RRMs. For these proteins, the homology within the RRM region extends beyond the conserved residues that define the motif. Homology between spen and other RRM-containing proteins is less striking and is limited to the residues that comprise the motif (data not shown). Because the RRM domain is thought to mediate specificity of RNA-binding interaction, it is possible that the spen class of RRM proteins interacts with similar substrates (BURD and DREYFUSS 1994 Down). Further experiments will be required to determine whether spen actually binds RNA, what its in vivo targets are, and what the function of this activity is in the context of RTK signaling events during development.

Two additional structural motifs of note in the spen protein are the C-terminal ~170 amino acids and a region of predicted coiled-coil near the middle of the protein. The coiled-coil domain is likely to mediate protein-protein interactions, either with spen itself or with other proteins (BERGER et al. 1995 Down; WOLF et al. 1997 Down). One possibility is that spen interacts directly with yan via this domain. Alternatively, the interaction between spen and yan could be less direct. Homology searches using the C terminus of the spen detect several proteins, several of which, including a Drosophila protein predicted from the BDGP genomic sequence and a human protein compiled from multiple overlapping ESTs, also have spen-class RRMs. Although the structure of the C terminus of spen is not homologous to any protein domain of known function, the high degree of conservation of this region between fly, worm, and mammalian proteins suggests it is likely to have a conserved function. Apart from the RRM, coiled-coil, and C-terminal domains, the rest of the spen protein is novel, and to date it is uninformative in terms of providing clues as to function. Because the protein is so large (5476 amino acids), structure-function analyses and determination of the molecular lesions associated with the various spen alleles will be required to determine whether there are other important functional domains not detected by sequence homology. Investigation of the function of spen homologues in other species may also be informative.

Our isolation of spen as an enhancer of yanACT suggests it may play a role as a positive regulator of the RTK/Ras pathway. Preliminary results indicate spen is a nuclear protein broadly expressed in most tissues and enriched in neuronal lineages (F. CHEN and I. REBAY, unpublished results). We currently do not know whether spen functions upstream or downstream of yan. One possibility is that spen might regulate the stability of the yan transcript. It has been postulated that the mechanism for downregulating yan activity involves post-translational modifications of the protein, namely phosphorylation by activated MAPK, that subsequently targets yan for degradation. Such post-translational regulation of yan would presumably need to be reinforced at the transcriptional and/or translational level. Thus, spen might play a role in destabilizing yan mRNA in response to Ras signaling. This would be consistent with our isolating mutations in spen as enhancers of yanACT. Alternatively, spen could be transcriptionally regulated by yan, and could play a role in splicing, stability, or transport of other downstream effector genes. Future phenotypic, genetic, and biochemical characterization of spen will be necessary to understand its role in Ras/yan signaling events.