Saccharomyces cerevisiae G1 Cyclins Are Differentially Involved in Invasive and Pseudohyphal Growth Independent of the Filamentation Mitogen-Activated Protein Kinase Pathway

Corresponding author: Haoping Liu, Department of Biological Chemistry, University of California, 240D Med Sci I, Irvine, CA 92697.

Communicating editor: F. WINSTON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Several lines of evidence suggest that the morphogenetic transition from the yeast form to pseudohyphae in Saccharomyces cerevisiae may be regulated by the cyclin-dependent kinase (Cdk). To examine this hypothesis, we mutated all of the G1 cyclin genes in strains competent to form pseudohyphae. Interestingly, mutation of each G1 cyclin results in a different filamentation phenotype, varying from a significant defect in cln1/cln1 strains to enhancement of filament production in cln3/cln3 strains. cln1 cln2 double mutants are more defective in pseudohyphal development and haploid invasive growth than cln1 strains. FLO11 transcription, which correlates with the level of invasive growth, is low in cln1 cln2 mutants and high in grr1 cells (defective in proteolysis of Cln1,2), suggesting that Cln1,2/Cdks regulate the pseudohyphal transcriptional program. Epistasis analysis reveals that Cln1,2/Cdk and the filamentation MAP kinase pathway function in parallel in regulating filamentous and invasive growth. Cln1 and Cln2, but not Ste20 or Ste12, are responsible for most of the elevated FLO11 transcription in grr1 strains. Furthermore, phenotypic comparison of various filamentation mutants illustrates that cell elongation and invasion/cell-cell adhesion during filamentation are separable processes controlled by the pseudohyphal transcriptional program. Potential targets for G1 cyclin/Cdks during filamentous growth are discussed.

SACCHAROMYCES cerevisiae yeast form cells undergo a transition to pseudohyphal growth upon starvation for nitrogen (OEHLEN and CROSS 1998 ; WU et al. 1998 ). This filamentation response to changes in the environment is similar to morphological transitions observed in some pathogenic fungi, such as Candida albicans and Ustilago maydis. In both of these pathogens, the ability to form filaments has been correlated to pathogenicity. In C. albicans, the most prevalent fungal pathogen of humans, mouse in vivo assays have revealed that mutants defective in hyphal formation are much reduced in pathogenicity (LEBERER et al. 1997 ; LO et al. 1997 ). Likewise, the corn smut fungus U. maydis is pathogenic only in its filamentous form (BANUETT 1992 ). Genetic studies of pseudohyphal development in S. cerevisiae have already uncovered a key regulatory mechanism for morphological development shared with these pathogenic fungi. In each species, filamentous growth requires the activity of a conserved mitogen-activated protein (MAP) kinase pathway (for review see MADHANI and FINK 1998 ). Because of the apparent similarity in regulatory mechanisms between these fungi, and because of the powerful molecular and genetic tools available, S. cerevisiae should serve as an excellent model system to identify and study other aspects of morphogenetic regulation in pathogenic fungi.

In S. cerevisiae, the MAP kinase pathway for filamentous growth shares elements with the mating signal transduction pathway, including Ste20 (PAK, P21-activated kinase), Ste11 (MEKK, MAP kinase kinase), Ste7 (MEK, MAP kinase), and the transcription factor Ste12 (LIU et al. 1993 ). The same proteins are also required for invasive growth on rich medium by haploids, a phenomenon that shares many features with pseudohyphal growth (ROBERTS and FINK 1994 ). Clearly, this MAP kinase pathway must respond to different inputs and stimulate different outputs to effect these radically different developmental modes. Some of the response-specific elements are known. Pheromone receptors and a heterotrimeric G protein (Gpa1, Ste4, and Ste18) are required for mating, while the G protein encoded by RAS2 regulates the pseudohyphal/invasive pathway (MOSCH et al. 1996 ). Ras2, together with Gpa2, is also involved in a cAMP-mediated pathway for filamentation (KUBLER et al. 1997 ; LORENZ and HEITMAN 1997 ). Pathway specificity is also determined by use of different MAP kinases; the Fus3 MAP kinase regulates mating in wild-type cells, whereas the Kss1 MAP kinase regulates pseudohyphal/invasive growth (COOK et al. 1997 ; MADHANI et al. 1997 ). Another level of pathway specificity is conferred by combinatorial regulation at the level of transcription. Cooperative interaction of Ste12 with Tec1 regulates filamentation/invasion responsive elements (FRE), which are necessary and sufficient to direct expression of pseudohyphal/invasive growth-specific genes (MOSCH et al. 1996 ; MADHANI and FINK 1997 ). One important physiological target for transcriptional activation by Ste12/Tec1 is Flo11, a cell wall protein required for both pseudohyphal growth and invasion (LAMBRECHTS et al. 1996 ; LO and DRANGINIS 1996 , LO and DRANGINIS 1998 ; RUPP 1999).

A number of physiological changes, such as cell shape, budding pattern, and cell-cell attachment, are necessary for filament formation. Besides Flo11, other important targets necessary for filamentous growth are largely unknown. Two lines of evidence suggest that the alternation of cell shape may involve regulation by the cyclin-dependent kinase (CDK) system (LEW and REED 1995 ). In S. cerevisiae, Cdc28 is the major CDK that controls cell cycle progression at the G1/S and the G2/M transitions (for reviews see ANDREWS and MEASDAY 1998 ; MENDENHALL and HODGE 1998 ). Stage-specific functions are defined by nine different associated cyclins. Three G1 cyclins (Cln1–3) are necessary for the G1/S transition, and six B-type cyclins (Clb1–6) are involved in stimulating S phase and mitosis. The first line of evidence implicating Cdk regulation of filamentous growth is that manipulating the relative concentrations of G1 and B-type cyclins or the activity of the Cdc28 protein kinase affects the extent of polarized cell growth (LEW and REED 1993 ). Activation of Cdc28 by the G1 cyclins Cln1 and Cln2 (but not Cln3) promotes apical growth, while activation of Cdc28 kinase by mitotic cyclins Clb1 or Clb2 leads to isotropic growth. On the basis of these and other results, LEW and REED 1995 proposed a model where specific CDK activity controls cell morphogenesis. Consistent with these findings, a grr1 mutant, which stabilizes Cln1 and Cln2 (BARRAL et al. 1995 ), enhances pseudohyphal growth (BLACKETER et al. 1995 ). Grr1 is the F-box protein in the SCF^Grr1 (Skp1/Cdc53/Grr1) ubiquitin-ligase complex (LI and JOHNSTON 1997 ) and is responsible for recruiting phosphorylated substrates to the SCF^Grr1 complex for ubiquitination and subsequent degradation (SKOWYRA et al. 1997 ; KISHI and YAMAO 1998 ). Grr1 is also a component in glucose and amino acid sensing pathways and regulates transcription of many genes encoding nutrient transporters (FLICK and JOHNSTON 1991 ; OZCAN et al. 1994 ; IRAQUI et al. 1999 ).

Another strand of suggestive evidence is from comparison of the cell cycle between the yeast form and pseudohyphal form (KRON et al. 1994 ). KRON et al. 1994 observed differences in the timing and distribution of cells in various cell cycle stages. Unlike the yeast form, pseudohyphal cells divide symmetrically and have a shorter G1 phase and a longer G2 phase and may possess an additional level of cell cycle control during G2 (KRON et al. 1994 ). Taken together, it has been suggested that the timing of the transition from G1 cyclin CDK predominance to G2 cyclin CDK predominance may be a regulated step involved in controlling the developmental switch between filamentous and yeast growth (KRON and GOW 1995 ; LEW and REED 1995 ).

On the basis of these observations, our laboratory has begun to examine the role of G1 CDKs in filamentous growth. We have shown previously that a G1 cyclin is necessary for maintenance of hyphal growth in C. albicans (LOEB et al. 1999 ). Recently, Cln1,2/Cdk have been shown to be responsible for the cyclic phosphorylation of Ste20 (OEHLEN and CROSS 1998 ; WU et al. 1998 ). Furthermore, a cln1/cln1 cln2/cln2 double mutant does not produce pseudohyphal colonies and, thus, has been implicated in regulating pseudohyphal growth through the MAP kinase pathway (OEHLEN and CROSS 1998 ). In this article we extend these previous results by mutating all of the G1 cyclin genes in strains competent to form pseudohyphae. Interestingly, mutation of each G1 cyclin results in a different filamentation phenotype, varying from a significant defect in cln1/cln1 mutant strains to enhancement of filament production in cln3/cln3 strains. Diploid cln1/cln1 cln2/cln2 double mutants are profoundly defective in filamentation. Cln1 and Cln2 are also involved in haploid invasive growth. Analysis of FLO11 transcription, which correlates with the level of invasive growth, suggests that G1 Cdks regulate the pseudohyphal transcriptional program. Furthermore, we studied the relationship between Cln1,2/CDK and the filamentation MAP kinase pathway. Epistasis analysis reveals that the Cln1,2/Cdk and Kss1 MAP kinase pathways function in parallel in regulating the transcriptional program for invasive and filamentous growth. Therefore, Cln1,2/CDK must have targets beyond Ste20.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Yeast strains and media:
All yeast strains used are congenic to the 1278b background and are listed in Table 1. The cln1::URA3 deletion mutation was introduced with a cln1::hisGURA3hisG construct (NASMYTH and DIRICK 1991 ). The cln1::ura3::TRP1 was obtained by subsequent transformation of the cln1::URA3 with the ura3::TRP1 URA3 disruption cassette (from Yona Kassir, Technion, Haifa, Israel). The cln2::LEU2 mutation was introduced with the cln2::LEU2 plasmid (HADWIGER et al. 1989 ). The cln3::URA3 mutation was introduced with the daf2-1::URA3 plasmid (CROSS 1988 ). The CLN3-1 mutation was generated by transformation with the DAF1-1 plasmid (CROSS 1988 ). The grr1::LEU2 mutation was introduced with the grr1::LEU2 plasmid pBM1829 (FLICK and JOHNSTON 1991 ). All deletion mutations were confirmed by Southern analyses. clb2 and flo11 strains were generously provided by Dr. Steve Kron (University of Chicago) and Dr. Anne Dranginis (St. John's University), respectively. Standard methods for transformation and genetic crosses were used for all strain constructions and standard yeast media were prepared essentially as described (SHERMAN et al. 1986 ). Synthetic low ammonia medium (SLAD) was prepared as described (GIMENO et al. 1992 ). Invasive growth tests were performed using solid YPD medium as described (ROBERTS and FINK 1994 ).

Plasmids:
pADH-CLN1 (pHL377) and pADH-CLN2 (pHL-379) plasmids were constructed by inserting the ADH promoter region, a BamHI-SalI fragment from the pAD4 plasmid (from Wigler lab), to the BamHI/SalI site of GAL-CLN1/pRS316 and GAL-CLN2/pRS316 plasmids, respectively. The GAL-CLN1 and GAL-CLN2 plasmids were isolated from a cDNA library (LIU et al. 1992 ) by Dr. Steve Kron. The pADH is located between pGAL and CLN genes in plasmids pHL377 and pHL379.

Microscopy:
Closeups of Saccharomyces microcolony morphology were made by growing cells on microscope slides on which a thin layer of solid growth medium had been poured. Cells were streaked onto the slides with toothpicks and then the cultures were allowed to grow for ~12 hr at 30°. Then coverslips were placed over the cells, and a Zeiss (Thornwood, NY) Axioplan 2 with a 100x objective and Nomarski imaging were used for photography. Pictures of Saccharomyces colony morphology were taken on a Zeiss Telaval 31 with 5x objective after 4 days of growth on SLAD medium.

Northern blotting:
Yeast cells were diluted from saturated cultures and grown to early log in YPD before harvesting. Total RNA was extracted from cell pellets by phenol extraction (GREENBERG 1987 ). Formaldehyde gels were prepared and blotted essentially as described in Current Protocols in Molecular Biology (GREENBERG 1987 ). DNA probes were labeled using the Stratagene Prime-It II random labeling kit and [-³²P]dCTP (New England Nuclear, Boston, MA). A 1.5-kb BamHI-HindIII fragment of ACT1 was used for ACT1 probe. Oligos 5' GTAACTCCTGCCACTAATGCCGTA and 5' CCACATAAAGTTTCCAAGAACCTTG were used to amplify a 350-bp fragment from the Flo11 C-terminal region for the FLO11 probe.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Saccharomyces G1 cyclin mutations have differing effects on filamentous growth:
To investigate whether the G1 cyclins Cln1 and Cln2 are required for pseudohyphal growth, we deleted them in diploid strains (1278b, a wild-type pseudohyphal growth competent strain) and examined their ability to form filaments on nitrogen starvation medium. Diploid cln1/cln1 strains produced chains of round cells upon nitrogen starvation and gave rise to colonies with rare stubby filaments (Figure 1A). cln2/cln2 mutant stains, on the other hand, generated cells slightly longer than those of the wild type and were able to produce long chains of filaments. Strikingly, cln1/cln1 cln2/cln2 strains completely lost the ability to form pseudohyphal colonies (Figure 1A). The double mutants made enlarged round cells, which became misshapen with a wrinkled cell wall after longer incubation on nitrogen starvation medium. The phenotypes of cln1/cln1 and cln2/cln2 single mutant strains suggest that Cln1 is the major cyclin involved in filamentous growth. The more severe phenotype observed in cln1/cln1 cln2/cln2 double mutants indicates that Cln1 and Cln2 have overlapping roles in this phenomenon. This notion of semiredundant function between these homologues is further supported by the observation that overexpression of either CLN1 or CLN2 gene slightly stimulated cell elongation in wild-type cells (Figure 1C).

View larger version (98K): In this window In a new window Download PPT slide   Figure 1. Three G1 cyclins have differential effects on filamentous growth. Cell and colony morphology of indicated diploid strains grown on SLAD medium was photographed after 12 hr and 4 days, respectively. (A) Diploid cln1/cln1 cln2/cln2 cells are defective in filamentous growth: wild type (HLY447), cln1/cln1 (HLY885), cln2/cln2 (HLY882), and cln1/cln1 cln2/cln2 (HLY876) are shown. (B) Deletion of the CLN3 gene enhances pseudohyphal growth. Strains are cln3/cln3 (HLY1560), cln3/cln3 cln1/cln1 (HLY1573), and cln3/cln3 cln2/cln2 (HLY1584). (C) Overexpression of CLN1 or CLN2 stimulates cell elongation while hyperactive CLN3 inhibits cell elongation. Wild-type diploid cells harboring ADH-CLN1 (HLY1443), ADH-CLN2 (HLY1444), and CLN3-1 (HLY1884) are shown.

Diploid cln3/cln3 strains in the 1278b background consistently generated longer cells and better filaments than wild-type strains (Figure 1B). The enhanced pseudohyphal growth caused by deletion of CLN3 was more evident in a cln3/cln3 cln1/cln1 double mutant because the double mutant behaved like cln3/cln3 and had much more florid filaments than cln1/cln1 strains (Figure 1B). Thus, Cln3 has an antagonistic effect on pseudohyphal growth. The inhibitory activity of the Cln3 protein is further supported by the phenotype of a dominant CLN3 mutation. CLN3-1 (DAF1-1) was isolated as a mutant that fails to arrest its cell cycle in the presence of mating pheromone (CROSS 1988 ). One copy of CLN3-1 was introduced into wild-type MATa and MAT cells as determined by Southern hybridization (data not shown), and the haploid cells were mated to generate diploid CLN3-1 strains. CLN3-1 diploid cells exhibit a small round cell morphology on SLAD medium (Figure 1C), confirming the inhibitory effect of Cln3 on cell elongation.

However, the nitrogen starvation signal is not mediated through Cln3 because diploid cln3 cells are not elongated on media with ample nitrogen, such as the yeast synthetic complete medium (SHERMAN et al. 1986 ) (not shown). cln3 cells are much larger than wild-type cells, a phenotype of cln3 in other strain backgrounds as well. cln1 cln2 cells are only slightly larger than wild-type cells with no other discernable morphological defects when grown on rich medium (not shown).

Relationship between G1 cyclins and the Kss1 MAP kinase pathway in filamentous growth:
Cln1,2/Cdk have been proposed to activate Cdc42 in promoting polarization of the actin cytoskeleton (LEW and REED 1995 ). Two recent reports suggest that Cln1,2/Cdk are responsible for a cell-cycle-regulated mobility shift of Ste20 protein (OEHLEN and CROSS 1998 ; WU et al. 1998 ). Mutual genetic interactions with CLA4 (a Ste20 homologue) suggest that Cln1, Cln2, Ste20, and Bem1 (a protein required for bud emergence and polarized growth) function in the same pathway during polarized cell growth (OEHLEN and CROSS 1998 ). Because both Cdc42 and Ste20 are upstream components of the Kss1/MAP kinase pathway (LIU et al. 1993 ; MOSCH et al. 1996 ), it is possible that Cln1and Cln2 function through the MAP kinase pathway to regulate pseudohyphal growth. Therefore, we performed epistasis analysis between G1 cyclins and components of the Kss1/MAP kinase pathway in filamentous growth. At the cell morphology level, overexpression of CLN1 in diploid ste7/ste7 and ste12/ste12 mutant strains could partially suppress the defect in cell elongation (Figure 2A). However, overexpression of CLN1 had almost no effect on the morphology of ste20/ste20 cells (Figure 2A). At the colony level, overexpression of CLN1 or CLN2 only slightly alleviated the defect of pseudohyphal colony formation in ste20/ste20, ste7/ste7, or ste12/ste12 mutants (not shown).

View larger version (51K): In this window In a new window Download PPT slide   Figure 2. Relationship between G1 cyclins and the Kss1 MAP kinase pathway in filamentous growth. Cell morphology of indicated strains grown for 12 hr on SLAD. (A) Overexpression of CLN1 alleviates the defect in filamentation in mutants of the Kss1 pathway. Diploid wild-type (L5783), ste20/ste20 (HLY492), ste7/ste7 (HLY351), and ste12/ste12 (HLY352) strains transformed with either a vector or a ADH1-CLN1 plasmid are shown. (B) Stimulation of the Kss1 pathway partially bypasses the defect of filamentation in cln1/cln1 cln2/cln2 mutants. Diploid wild-type (L5783) and cln1/cln1 cln2/cln2 (HLY874) strains transformed with a vector, and a STE20 overexpression plasmid (pRS426-STE20) (MOSCH 1996) or STE11-4 (STEVENSON et al. 1992 ). (C) Deletion of STE12 blocks enhanced filamentation in cln3/cln3. Strains shown are wild type (HLY477), cln3/cln3 (HLY1560), ste12/ste12 cln3/cln3 (HLY1604). Bottom row shows the pseudohyphal colony morphology of the indicated strains.

Reciprocal experiments to determine the effect of MAP kinase stimulation in G1 cyclin mutants were also performed. Activation of the MAP kinase pathway by either overexpression of STE20 or introduction of a gain-of-function mutation STE11-4 can enhance filamentous growth in wild-type cells. In cln1/cln1 cln2/cln2 mutants, overexpression of STE20 or STE11-4 can partially suppress the cell elongation defect (Figure 2B). Similarly, they partially alleviate the defect in pseudohyphal colony formation of cln1/cln1 cln2/cln2 diploids (not shown). While the effect of stimulation of the STE pathway on cln1/cln1 cln2/cln2 is more pronounced than the effect of CLN1 overexpression on ste mutants, it is important to note that stimulation of pseudohyphal growth by overexpression of CLN1 or CLN2 is much weaker than that observed for enhancers of the MAP kinase pathway. Nevertheless, the bidirectional nature of these epistasis studies indicates that the MAP kinase pathway and Cln1,2 may function in parallel in regulating pseudohyphal growth.

As shown above, cln3/cln3 mutant strains are more filamentous than wild type. This enhanced filamentation may function through the Kss1/MAP kinase pathway. To test this possibility, diploid strains mutated in both STE12 and CLN3 genes were constructed. The ste12/ste12 cln3/cln3 homozygous diploids were found as defective in pseudohyphal development as the ste12/ste12 single mutants (Figure 2C), indicating that most of the Cln3 inhibitory activity on pseudohyphal growth may act through Ste12.

Cln1 and Cln2 are involved in haploid invasive growth:
Many mutants defective in pseudohyphal growth are also impaired in haploid invasive growth into rich solid medium (ROBERTS and FINK 1994 ). This invasion phenotype is thought to be an accurate measure of the cell-cell adhesion and budding aspects of pseudohyphal growth, but not cell elongation, because haploid cells do not elongate appreciably during invasion (ROBERTS and FINK 1994 ). We found that cln1 cln2 haploid strains also had reduced levels of invasion (Figure 3A). Although not as pronounced as the cln1 cln2 double mutant, the reduced invasiveness was evident even in cln1 single mutant strains and the phenotype segregated 2:2 in a backcross to a congenic wild-type strain (not shown). Haploid cln2 mutants had no obvious defect in invasive growth (Figure 3A).

View larger version (54K): In this window In a new window Download PPT slide   Figure 3. Haploid invasion is proportional to G1 cyclin activity. (A) cln1cln2 mutants are defective in haploid invasion. Substrate invasiveness of haploid strains cln1 (HLY884), cln2 (HLY868), and cln1 cln2 (HLY870) in comparison to wild type (HLY334). Yeast strains were replicated onto YPD medium. After 3 days of incubation the plate was photographed before and after washing the cells from the surface of the plate. (B) grr1 mutants are hyperinvasive and this invasion phenotype requires Cln1 and Cln2. Invasiveness of haploid and diploid cln1 cln2 and grr1 strains as measured by washing assay described in A. (C) Expression of the invasion-specific gene FLO11 requires Cln1 and Cln2 activity. RNA was isolated from the indicated strains logarithmically growing in YPD, Northern blotted, and probed with FLO11 and ACT1 as a loading control. Blots were then analyzed with a PhosphoImager. The ratio of FLO11 transcript to ACT1 is shown graphically under the blot. Strains in B and C are: 1, wild-type a (HLY333); 2, a grr1 (HLY1377); 3, a grr1 cln1 cln2 (HLY1536); 4, a clb2 (HLY1401); 5, a cln1 cln2 (HLY870); 6, wild-type a/ (HLY5783); 7, a/ grr1/grr1 (HLY1380); 8, a/ grr1/grr1 cln1/cln1 cln2/cln2 (HLY1540); 9, a/ clb2/clb2 (HLY1466).

Consistent with the result that diminished activity of G1 cyclins leads to reduced invasiveness, grr1 mutants, which stabilize Cln1 and Cln2 and thus lead to very high concentrations of these normally labile proteins, had a greatly enhanced level of invasive growth into the agar surface as monitored by a washing assay (Figure 3B). First, a haploid grr1 mutant shows elevated invasive growth compared to wild-type strains. Hyperinvasiveness is even more pronounced in grr1/grr1 diploids. While wild-type diploid strains do not invade solid medium, a diploid grr1 strain invades as well as a wild-type haploid strain (Figure 3B). Invasiveness is much reduced in both cln1 cln2 grr1 haploid and diploid strains, suggesting that the accumulation of stable Cln1 and Cln2 contributed to most of the elevated invasiveness observed in the grr1 mutant.

FLO11 transcription correlates with invasive growth in cln1cln2 and grr1 strains:
FLO11 was employed as a molecular marker for activity of the filamentation/invasive transcriptional program. FLO11 expression is higher in haploids than in diploids (LO and DRANGINIS 1998 ). Its transcription is also induced under filament-inducing conditions (LO and DRANGINIS 1998 ). FLO11 encodes a GPI-anchored cell wall protein (LAMBRECHTS et al. 1996 ; LO and DRANGINIS 1996 ). It is the only cell wall protein required for pseudohyphal growth and invasive growth identified thus far (LAMBRECHTS et al. 1996 ; LO and DRANGINIS 1998 ). Because FLO11 transcription correlates with filamentation and invasion we suspected it may be an output of the Cdk invasion pathway. Therefore, we tested the effect of Grr1 and Cln1,2 mutations on FLO11 transcription (Figure 3C). In haploids, FLO11 transcript was about threefold higher in grr1 cells than in wild-type cells. This elevated FLO11 expression is not evident in haploid grr1 cln1 cln2 strains, indicating that Cln1 and Cln2 are responsible for most of the transcriptional activation of FLO11 in grr1 mutants. Diploid grr1 strains also have a higher level of FLO11 (Figure 3C). Again, Cln1 and Cln2 are responsible for much of the elevated FLO11 expression (Figure 3B). However, cln1/cln1 cln2/cln2 grr1/grr1 diploids still make elongated cells in both rich and starvation media (Figure 6A). Thus, other targets of Grr1, such as Gic1 and Gic2, must be important for the cell elongation aspect of pseudohyphal growth in grr1 mutants (BROWN et al. 1997 ; CHEN et al. 1997 ; JAQUENOUD et al. 1998 ).

View larger version (59K): In this window In a new window Download PPT slide   Figure 4. A mutation in GRR1 bypasses the requirement of Ste20 or Ste12 for FLO11 transcription. Northern analysis of FLO11 in ste12 and ste12 grr1 strains. (A) Ste12 is required for FLO11 transcription in wild-type cells. Haploid wild-type (HLY333) and ste12 (HLY362) strains were used for the Northern blot. (B) Ste12 is not required for FLO11 transcription in haploid and diploid grr1 strains. Strains used for B are: a grr1 (HLY1377), a grr1 ste12 (HLY1377), a/ wild-type (L5783), a/ grr1/grr1 (HLY1380), and a/ grr1/grr1 ste12/ste12 (HLY1327). (C) Ste20 is not required for FLO11 expression in grr1 cells. Strains used are haploid wild type (HLY333), ste20 (HLY435), grr1 (HLY1377), and grr1 ste20 (HLY1439). (D) Ste20 or Ste12 is not required for invasive growth in grr1 strains. Haploid strains shown clockwise are: wild type (HLY333), grr1 (HLY1377), ste12 (HLY362), ste12 grr1 (HLY1377), ste20 (HLY435), and grr1 ste20 (HLY1439).

View larger version (119K): In this window In a new window Download PPT slide   Figure 5. Flo11 is not required for cell elongation. (A) flo11/flo11 (HLY1883) cells are elongated on SLAD. Cell morphology and of indicated strains grown for 12 hr. (B) flo11/flo11 strains are unable to form filamentous colonies (LO and DRANGINIS 1998 ). (C) Smooth colonies formed by flo11/flo11 cells do not invade beneath the agar surface while pseudohyphal colonies of wild-type cells forage into the agar.

View larger version (84K): In this window In a new window Download PPT slide   Figure 6. clb2 mutants can bypass the requirement for CLN1 and CLN2 in filamentous growth, but not for invasive growth. (A) Requirement for CLN1, CLN2, and STE12 in cell elongation is bypassed in clb2 mutants. Cells of the genotypes shown were photographed after 12 hr of growth. Diploid strains shown are wild type (HLY447), clb2/clb2 (HLY1466), clb2/clb2 ste12/ste12 (HLY1527), clb2/clb2 cln1/cln1 cln2/cln2 (HLY1471), grr1/grr1 (HLY1380), grr1/grr1 cln1/cln1 cln2/cln2 (HLY1540). (B) A mutation in CLB2 does not suppress haploid invasion defect of cln1cln2 and ste12. Haploid strains shown clockwise for agar invasion are: wild type (HLY333), clb2 (HLY1401), cln1 cln2 (HLY871), cln1 cln2 clb2 (HLY1469), ste12 (HLY362), and ste12 clb2 (HLY1528).

Ste12 and Ste20 are required for FLO11 transcription but grr1 can bypass these requirements:
The FLO11 promoter has been shown to contain potential Ste12/Tec1 binding sites and overexpression of FLO11 suppresses the defect of invasive growth in haploid ste12 strains (LAMBRECHTS et al. 1996 ; LO and DRANGINIS 1998 ). Therefore, Ste12 was proposed to regulate the transcription of FLO11. Indeed, Northern hybridization of FLO11 revealed that FLO11 transcription is dramatically reduced in a haploid ste12 mutant strain (Figure 4A and RUPP et al. 1999 ).

We further investigated whether the Cln1- and Cln2-mediated activation of FLO11 transcription in grr1 mutants requires Ste12. FLO11 transcript levels in ste12 grr1 strains were analyzed by Northern hybridization. While Ste12 is required for FLO11 transcription in wild-type haploid cells, grr1 mutant haploid and diploid cells both express FLO11 in the absence of STE12 (Figure 4B). Thus, mutations in grr1 enhance FLO11 transcription and can bypass the requirement for Ste12. Similarly, Ste20 is necessary for FLO11 expression in wild-type cells while mutations in grr1 can bypass the requirement for Ste20 (Figure 4C). In agreement with their levels of FLO11 expression, both ste12 grr1 and ste20 grr1 strains have similar amounts of invasive growth as the grr1 mutant (Figure 4D). ste12 grr1 or ste20 grr1 cells are also as elongated as grr1 cells (data not shown). Because Cln1 and Cln2 are required for the elevated FLO11 transcription in grr1 strains and Ste20 and Ste12 are not, Cln1,2 and the STE pathway must act on independent pathways to regulate FLO11 transcription.

Cell elongation and invasive growth/cell-cell adhesion are separable:
Although grr1 mutants show both an elevated level of invasive growth and cell elongation, cell elongation does not always correlate with invasion. For example, diploid clb2/clb2 cells of 1278b background are highly elongated even on rich medium (AHN et al. 1999 ), but they do not have elevated invasive growth or greatly elevated levels of FLO11 transcription compared to wild-type cells (Figure 3B and Figure C). Therefore, Clb2 is more likely to be involved in the cell elongation aspect of filamentous growth in contrast to the cell-cell adhesion function. This is also suggested by phenotypes of flo11 mutants. Haploid flo11 cells are not invasive at all and diploid flo11 cells are unable to form pseudohyphal colonies (LAMBRECHTS et al. 1996 ; LO and DRANGINIS 1998 ). However, diploid flo11/flo11 cells are still able to undergo cell elongation under the nitrogen starvation condition (Figure 5A), forming smooth colonies of unconnected long cells that are incapable of invading underneath the agar surface (Figure 5B and Figure C). Therefore, Flo11 function is limited to processes involved with invasiveness and cell-cell adhesion.

clb2 mutations can bypass the requirement of Cln1,2/CDK activity for polarized growth, but not the requirement for invasive growth:
LEW and REED 1993 have shown that Clb1,2/Cdc28 promotes isotropic growth and has an opposite effect on cell morphogenesis from cln1,2/Cdc28. In agreement with this, a clb2 mutant in the 1278 strain background generates extremely long cells on both rich media and under nitrogen starvation conditions (AHN et al. 1999 ). However, further cell elongation upon nitrogen starvation was observed in clb1/clb2 cells (not shown), suggesting that the nitrogen starvation signal may not be mediated through Clb2/Cdk. To examine the relationship between Cln1,2 and Clb2 in regulating cell elongation during filamentous growth, we crossed the cln1 cln2 mutant strain to a clb2 strain and examined the cell morphology of double and triple mutants. If cln1/cln1 cln2/cln2 clb2/clb2 strains had a cell morphology similar to that of the cln1/cln1 cln2/cln2 strain, it would have suggested that Cln1,2/Cdks play a vital role in promoting cell elongation and the inhibitory function of Clb2/Cdk may be mediated through Cln1,2/Cdc28. Instead, we observed that diploid cln1/cln1 clb2/clb2 (not shown) and cln1/cln1 cln2/cln2 clb2/clb2 cells (Figure 6A) have the same elongated cell morphology as clb2/clb2 cells. The phenotype of the triple mutant suggests that either the inhibitory function of Clb2 is downstream of Cln1,2 function or that the Clb2/CDK kinase functions "in parallel" to the G1 cyclins in regulating polarized cell growth but Clb2 has a stronger effect on the process. However, caution is required in interpreting results with the clb2 mutant because the cell elongation phenotype in clb2/clb2 diploid strains is markedly different from that of normal pseudohyphal growth. clb2/clb2 cells are much larger in size as well as bigger at the base and narrower at the tip as compared to other pseudohyphae (compare clb2/clb2 with grr1/grr1 or wild type in Figure 6A).

We also examined whether the clb2 mutation can suppress the defect of the cln1 cln2 mutant in haploid invasive growth. As shown in Figure 3C, haploid and diploid clb2 mutants have normal invasive behavior as compared to the wild type. While the clb2 mutant can completely suppress the defect in cell elongation of cln1cln2 mutants, it did not suppress the defect in haploid invasion. cln1 cln2 clb2 haploid strains had the same level of reduced invasive growth as cln1 cln2 strains (Figure 6B). Similarly, the clb2 mutation can suppress the defect of filamentous growth in a diploid ste12 mutant completely, but it did not suppress the invasive growth defect in haploid ste12 clb2 strains (Figure 6A and Figure B).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Our results demonstrate that the S. cerevisiae G1 cyclins Cln1 and Cln2 are necessary for pseudohyphal whereas the third G1 cyclin Cln3 is inhibitory to filamentous growth. Furthermore, we found that a mechanism of Cln1 and Cln2 activation of filamentous growth is independent of the well-understood STE MAP kinase pathway. A schematic depiction of a model concerning cyclin function in filamentous growth based on our results is shown in Figure 7.

View larger version (21K): In this window In a new window Download PPT slide   Figure 7. A model for cyclin function in filamentous growth.

G1 cyclin mutants define a STE-independent pathway necessary for filamentous development:
No epistasis is observed between CLN1,2 and elements of the Kss1 MAP kinase pathway when assayed for pseudohyphal growth. Overexpression of CLN1 can partially suppress the defect in either ste7/ste7 or ste12/ste12 cells while activation of the filamentation MAP kinase pathway can also partially bypass the defect in cln1/cln1 cln2/cln2 mutants. The bidirectional nature of these epistasis studies indicates that Cln1,2 and the MAP kinase pathway function in parallel. By comparison, overexpression of the Ste12 transcription factor can bypass a ste11/stell mutant whereas an activated STE11-4 mutant cannot bypass a ste12/ste12 mutant, thereby indicating that Ste11 and Ste12 function in series (LIU et al. 1993 ).

The relationship between Cln1,2/Cdk and Ste20 is more complex. Ste20 is upstream of the MAP kinase pathway and is thought to have additional targets involved in cell morphogenesis. Cln1,2/Cdks are responsible for the cyclic phosphorylation of Ste20 (OEHLEN and CROSS 1998 ; WU et al. 1998 ). The timing of this modification correlates with the localization of Ste20 to the emerging bud and subsequent bud growth (WU et al. 1998 ). Genetic evidence also supports Cln1,2/Cdk functioning in budding and morphogenesis via Ste20, as mutations in STE20, CLN1, CLN2, and BEM1 (a gene that encodes a SH3-containing protein, which is required for polarized cell growth and budding) are synthetic lethal with cla4, a STE20 homologue (OEHLEN and CROSS 1998 ). These authors proposed that the G1 cyclin/Cdk-mediated phosphorylation of Ste20 is important for filamentous growth by modifying Ste20 from a kinase active in pheromone response pathway to a kinase active in morphogenic function through the MAP kinase pathways. Our finding that CLN1 overexpression cannot bypass ste20/ste20 mutants for cell elongation is in apparent agreement with this model.

However, the role for the Ste20 phosphorylation activity of Cln1,2/Cdk may be limited to the morphogenesis function of Ste20. There is no evidence that phosphorylation of Ste20 by Cln1,2/Cdk is necessary for transcriptional activation of invasive/pseudohyphal genes. On the other hand, while Cln1,2 are responsible for much of the elevated FLO11 transcription in grr1 mutants, deletion of neither STE20 nor STE12 in grr1 mutants blocks FLO11 transcription (Figure 4). This strongly suggests that the Cln1,2/Cdk-mediated transcriptional activation of FLO11, and probably other invasion/pseudohyphal genes, is through a STE-independent pathway. Therefore, there must be other important targets in addition to Ste20 for Cln1,2/Cdk during invasive and pseudohyphal growth.

Differential requirement for G1 cyclins in pseudohyphal growth:
Mutations in each of the three G1 cyclins have a different filamentous growth phenotype. Deletion of CLN1 in diploids confers a moderate defect in pseudohyphal development and cln2/cln2 mutants are apparently normal for pseudohyphal development, whereas cln3/cln3 strains generate better filaments. The functions of Cln1 and Cln2 are apparently overlapping, because a cln1/cln1 cln2/cln2 strain is completely defective in pseudohyphal development (Figure 1). Consistent with their null phenotypes, overexpression of CLN1 or CLN2 promotes cell elongation while the CLN3-1 dominant active mutation gave rise to small round cells under pseudohyphal growth-stimulating conditions. The inhibitory activity of Cln3 is most evident in cln3/cln3 cln1/cln1 diploid cells because they generate florid filaments whereas cln1/cln1 cells are defective in pseudohyphal growth. Epistasis analysis between the CLN1,2 pair and CLN3 is limited by the requirement for at least one of these G1 cyclins for viability. On the other hand, the phenotype of a cln3/cln3 ste12/ste12 double mutant indicates that Ste12 activity is required for pseudohyphal development in cln3/cln3 mutants (Figure 2). Interestingly, in a recent comprehensive study of cell-cycle-regulated genes, overexpression of CLN3 in cln1cln2 background was unexpectedly found to inhibit basal expression of many pheromone-responsive genes (SPELLMAN et al. 1998 ). Taken together, we suggest that the inhibitory effect of Cln3 in pseudohyphal growth may be mediated mostly through Ste12. The antagonistic effects by Cln1,2 and Cln3 on pseudohyphal growth support the existing notion that Cln3 and Cln1,2 have very different targets and are qualitatively different in function (TYERS et al. 1993 ; DIRICK et al. 1995 ; STUART and WITTENBERG 1995 ; LEVINE et al. 1996 ). Furthermore, their differential effects on filamentous growth are unlikely to occur via disturbances in cell cycle timing because Cln3 as well as Cln1,2 stimulates the G1 to S transition. Our genetic data provide another example of functional differences among G1 cyclins and could be used as a new biological assay to uncover targets specific to each Cln/Cdk.

Our observations also stress the differences between Cln1 and Cln2. We found that cln1 mutant strains are impaired in haploid invasive growth and filamentous growth while cln2 strains have no detectable phenotypes. It is possible that Cln1 and Cln2 have different targets while sharing some overlapping functions, considering that overexpression of CLN1 or CLN2 both promoted pseudohyphal growth (Figure 1). Unfortunately, CLN1 and CLN2 transcripts in nitrogen-starved diploid cells are not sufficiently abundant for an accurate detection by Northern blotting. Therefore, we are unable to determine whether this difference is due to variance in environment-specific expression between these two genes. Our findings are consistent with a number of other previous reports that distinguish between CLN1 and CLN2, such as the transcriptional repression of CLN1 by glucose and the inhibition of FUS1 expression by CLN2 overproduction in the presence of Far1 (BARONI et al. 1994 ; OEHLEN and CROSS 1994 ; TOKIWA et al. 1994 ).

Potential targets for Cln1,2 cyclins during filamentous development:
Invasion and cell elongation are distinct processes. Some mutants are defective in one or the other function, where other mutants are defective in both. For example, consider the phenotypes of flo11 mutants. Haploid flo11 cells are not invasive (thought to be a measure of cell-cell adhesion) at all (LO and DRANGINIS 1998 ), while diploid flo11/flo11 cells are still able to undergo cell elongation, forming a smooth colony of unconnected long cells under nitrogen starvation conditions (Figure 5). By comparison, hyperelongated clb2 mutants do not have an elevated level of FLO11 transcription, and mutations in CLB2 do not suppress the defect in invasive growth in ste12 or cln1cln2 strains. On the other hand, clb2 mutations can override the defect in cell elongation in both ste12 and cln1cln2 mutants. Therefore, Flo11 function is specific to invasion/adhesion, where Clb2 effects are limited to cell elongation.

Cell-cell adhesion and invasive growth correlates with transcription of FLO11. Cln1 and Cln2 are required for normal expression of FLO11. FLO11 transcription level is low in cln1 cln2 mutants and high in grr1 mutants (Figure 3C). As discussed above, the elevated FLO11 transcription in grr1 strains requires Cln1 and Cln2, but not Ste20 or Ste12. Therefore, Cln1- and Cln2-mediated activation of pseudohyphal growth or FLO11 expression is independent of Ste12 and the Kss1 MAP kinase pathway. Other than Ste12, several transcriptional regulators, such as Tec1, Flo8, Msn1, and Mss11, have been shown to be required for FLO11 expression and filamentous growth (LAMBRECHTS et al. 1996 ; GAGIANO et al. 1999 ; RUPP et al. 1999 ). These proteins might be potential targets for Cln1,2/Cdk during invasive/filamentous growth.

cln/cln1 cln2/cln2 cells do not elongate under pseudohyphae inducing conditions. Therefore, Cln1,2/Cdk is necessary for both cell elongation during filamentous growth and cell adhesion/invasion. Given the complex nature by which cell elongation is regulated, Cln1,2/Cdk likely has multiple targets in promoting the cell elongation process during filamentous growth (Figure 7). One potential target could be a transcriptional regulator (or regulators) responsible for expression of proteins involved in cell elongation. This regulation may overlap with the transcriptional control of adhesion/invasion (pathways regulating FLO11) because many of the transcriptional factors required for FLO11 transcription also affect cell elongation (LIU et al. 1993 , LIU et al. 1996 ; MOSCH and FINK 1997 ; RUPP et al. 1999 ).

As discussed above, one of the other targets for Cln1,2/Cdk could be Ste20, a PAK kinase that functions upstream of the STE MAP kinase pathway. Other potential targets of Cln1,2/Cdk in promoting polarized growth include Cdc42 (LEW and REED 1995 ; JAQUENOUD et al. 1998 ) and the Pkc1 MAP kinase pathway (GRAY et al. 1997 ). The G2 phase Cdk could also be a potential target for regulating cell elongation during pseudohyphal growth. It has been proposed that polarized cell growth in pseudohyphal cells could be achieved by a delay in Clb1,2/Cdc28 activation (KRON and GOW 1995 ; LEW and REED 1995 ). Consistent with this, cells with a clb2 mutation are highly elongated (Figure 6). In addition, EDGINGTON et al. 1999 recently showed that mutations in CDC28 or regulators of Cdc28 affect cell elongation. Our data show that mutating CLB2 in either cln1cln2 or ste12 can generate cells as elongated as clb2 strains under the nitrogen starvation condition, indicating that Clb2/Cdk either is downstream of these pathways or has a stronger effect on cell elongation and thus overrides the requirement for these systems to affect cell elongation. Our genetic data cannot distinguish between these two possibilities.

G1 cyclins Cln1,2 may transmit nutrient availability information via Grr1:
Cln1 and Cln2 are regulated at the level of protein stability by CSF^Grr1 (LI and JOHNSTON 1997 ; SKOWYRA et al. 1997 ; KISHI and YAMAO 1998 ). Interestingly, Grr1 is a component in both glucose and amino acid sensing pathways and regulates transcription of diverse genes encoding nutrient transporters, including hexose transporters and amino acid permeases (FLICK and JOHNSTON 1991 ; OZCAN et al. 1994 ; IRAQUI et al. 1999 ). Thus Grr1 may link the regulation of Cln1,2 stability to nutrient availability and uptake (BARRAL et al. 1995 ). Interestingly, Grr1 must also have other targets involved in cell elongation, given the persistence of the hyperpseudohyphal phenotype in grr1/grr1 cln1/cln1 cln2/cln2 strains (Figure 6A). In contrast to Cln1,2, proteolysis of Cln3 is not regulated by CSF^Grr1 (BARRAL et al. 1995 ). Instead, Cln3 is degraded more rapidly in nitrogen-deprived cells and translation of CLN3 mRNA is also repressed under this condition (GALLEGO et al. 1997 ). The downregulation of Cln3 upon nitrogen deprivation correlates well with our finding that Cln3 is inhibitory to the pseudohyphal growth.

In summary, we found that different G1 cyclins have various effects on pseudohyphal growth. Cln1and Cln2 are involved in normal invasive/pseudohyphal growth and the transcription of a pseudohyphal-specific gene in S. cerevisiae. These findings for S. cerevisiae are consistent with our studies in C. albicans. A Cln1,2-like G1 cyclin of C. albicans is involved in maintenance of hyphal development under certain hyphal inducing conditions and is required for transcription of hyphal-specific genes (LOEB et al. 1999 ). We also report that at least some of the filamentation-specific activity of Cln1,2/Cdk is independent of the filamentation MAP kinase pathway. By analogy to the MAP kinase pathway we suspect that G1 cyclins may participate in similar developmental processes in other fungi and higher organisms.

	ACKNOWLEDGMENTS

We are grateful to Steve Kron for helpful discussions and for generously sharing unpublished data and reagents. We also thank Drs. A. Amon, B. F. Cross, S. Reed, B. Futcher, M. Tyers, A. M. Dranginis, and H. U. Moesch for plasmids and yeast strains. This work was supported by National Institutes of Health grant GM-55155. H. Liu is a new investigator of Burroughs Wellcome Fund.

Manuscript received April 12, 1999; Accepted for publication July 16, 1999.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

AHN, S. H., A. ACURIO, and S. KRON, 1999  Regulation of G2/M progression by the STE MAP kinase pathway in budding yeast filamentous growth. Mol. Biol. Cell 10:3301-3316[Abstract/Free Full Text].

ANDREWS, B. and V. MEASDAY, 1998  The cyclin family of budding yeast: abundant use of a good idea. Trends Genet. 14:66-72[Medline].

BANUETT, F., 1992  Ustilago maydis, the delightful blight. Trends Genet. 8:174-180[Medline].

BARONI, M. D., P. MONTI, and L. ALBERGHINA, 1994  Repression of growth-regulated G1 cyclin expression by cyclic AMP in budding yeast. Nature 371:339-342. (see comments).[Medline].

BARRAL, Y., S. JENTSCH, and C. MANN, 1995  G1 cyclin turnover and nutrient uptake are controlled by a common pathway in yeast. Genes Dev. 9:399-409[Abstract/Free Full Text].

BLACKETER, M. J., P. MADAULE, and A. M. MYERS, 1995  Mutational analysis of morphologic differentiation in Saccharomyces cerevisiae.. Genetics 140:1259-1275[Abstract].

BROWN, J. L., M. JAQUENOUD, M. P. GULLI, J. CHANT, and M. PETER, 1997  Novel Cdc42-binding proteins Gic1 and Gic2 control cell polarity in yeast. Genes Dev. 11:2972-2982[Abstract/Free Full Text].

CHEN, G. C., Y. J. KIM, and C. S. CHAN, 1997  The Cdc42 GTPase-associated proteins Gic1 and Gic2 are required for polarized cell growth in Saccharomyces cerevisiae. Genes Dev. 11:2958-2971[Abstract/Free Full Text].

COOK, J. G., L. BARDWELL, and J. THORNER, 1997  Inhibitory and activating functions for MAPK Kss1 in the S. cerevisiae filamentous-growth signalling pathway. Nature 390:85-88[Medline].

CROSS, F. R., 1988  DAF1, a mutant gene affecting size control, pheromone arrest, and cell cycle kinetics of Saccharomyces cerevisiae. Mol. Cell. Biol. 8:4675-4684[Abstract/Free Full Text].

DIRICK, L., T. BOHM, and K. NASMYTH, 1995  Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae. EMBO J. 14:4803-4813[Medline].

EDGINGTON, N. P., M. J. BLACKETER, T. A. BIERWAGEN, and A. M. MYERS, 1999  Control of Saccharomyces cerevisiae filamentous growth by cyclin-dependent kinase Cdc28. Mol. Cell. Biol. 19:1369-1380[Abstract/Free Full Text].

FLICK, J. S. and M. JOHNSTON, 1991  GRR1 of Saccharomyces cerevisiae is required for glucose repression and encodes a protein with leucine-rich repeats. Mol. Cell. Biol. 11:5101-5112[Abstract/Free Full Text].

GAGIANO, M., D. VAN DYK, F. F. BAUER, M. G. LAMBRECHTS, and I. S. PRETORIUS, 1999  Msn1p/Mss10p, Mss11p and Muc1p/Flo11p are part of a signal transduction pathway downstream of Mep2p regulating invasive growth and pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Microbiol. 31:103-116[Medline].

GALLEGO, C., E. GARI, N. COLOMINA, E. HERRERO, and M. ALDEA, 1997  The Cln3 cyclin is down-regulated by translational repression and degradation during the G1 arrest caused by nitrogen deprivation in budding yeast. EMBO J. 16:7196-7206[Medline].

GIMENO, C. J., P. O. LJUNGDAHL, C. A. STYLES, and G. R. FINK, 1992  Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68:1077-1090[Medline].

GRAY, J. V., J. P. OGAS, Y. KAMADA, M. STONE, and D. E. LEVIN et al., 1997  A role for the Pkc1 MAP kinase pathway of Saccharomyces cerevisiae in bud emergence and identification of a putative upstream regulator. EMBO J. 16:4924-4937[Medline].

GREENBERG, M. E., 1987 Preparation and analysis of RNA, p. 13.12.1 in Current Protocols in Molecular Biology, edited by F. M. AUSUBEL, R. BRENT, R. E. KINSTON, D. D. MOORE, J. G. SEIDMAN, J. H. SMITH and K. STRUHL. John Wiley & Sons, New York.

HADWIGER, J. A., C. WITTENBERG, H. E. RICHARDSON, M. DE BARROS LOPES, and S. I. REED, 1989  A family of cyclin homologs that control the G1 phase in yeast. Proc. Natl. Acad. Sci. USA 86:6255-6259[Abstract/Free Full Text].

IRAQUI, I., S. VISSERS, F. BERNARD, J. O. DE CRAENE, and E. BOLES et al., 1999  Amino acid signaling in Saccharomyces cerevisiae: a permease-like sensor of external amino acids and F-Box protein Grr1p are required for transcriptional induction of the AGP1 gene, which encodes a broad-specificity amino acid permease. Mol. Cell. Biol. 19:989-1001[Abstract/Free Full Text].

JAQUENOUD, M., M. P. GULLI, K. PETER, and M. PETER, 1998  The Cdc42p effector Gic2p is targeted for ubiquitin-dependent degradation by the SCFGrr1 complex. EMBO J. 17:5360-5373[Medline].

KISHI, T. and F. YAMAO, 1998  An essential function of Grr1 for the degradation of Cln2 is to act as a binding core that links Cln2 to Skp1. J. Cell Sci. 111:3655-3661[Abstract].

KRON, S. J. and N. A. GOW, 1995  Budding yeast morphogenesis: signalling, cytoskeleton and cell cycle. Curr. Opin. Cell Biol. 7:845-855[Medline].

KRON, S. J., C. A. STYLES, and G. R. FINK, 1994  Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae. Mol. Biol. Cell 5:1003-1022[Abstract].

KUBLER, E., H. U. MOSCH, S. RUPP, and M. P. LISANTI, 1997  Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism. J. Biol. Chem. 272:20321-20323[Abstract/Free Full Text].

LAMBRECHTS, M. G., F. F. BAUER, J. MARMUR, and I. S. PRETORIUS, 1996  Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast. Proc. Natl. Acad. Sci. USA 93:8419-8424[Abstract/Free Full Text].

LEBERER, E., K. ZIEGELBAUER, A. SCHMIDT, D. HARCUS, and D. DIGNARD et al., 1997  Virulence and hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p. Curr. Biol. 7:539-546[Medline].

LEVINE, K., K. HUANG, and F. R. CROSS, 1996  Saccharomyces cerevisiae G1 cyclins differ in their intrinsic functional specificities. Mol. Cell. Biol. 16:6794-6803[Abstract].

LEW, D. J. and S. I. REED, 1993  Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins. J. Cell Biol. 120:1305-1320[Abstract/Free Full Text].

LEW, D. J. and S. I. REED, 1995  Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Genet. Dev. 5:17-23[Medline].

LI, F. N. and M. JOHNSTON, 1997  Grr1 of Saccharomyces cerevisiae is connected to the ubiquitin proteolysis machinery through Skp1: coupling glucose sensing to gene expression and the cell cycle. EMBO J. 16:5629-5638[Medline].

LIU, H., J. KRIZEK, and A. BRETSCHER, 1992  Construction of a GAL1-regulated yeast cDNA expression library and its application to the identification of genes whose overexpression causes lethality in yeast. Genetics 132:665-673[Abstract].

LIU, H., C. A. STYLES, and G. R. FINK, 1993  Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 262:1741-1744[Abstract/Free Full Text].

LIU, H., C. A. STYLES, and G. R. FINK, 1996  Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 144:967-978[Abstract].

LO, H. J., J. R. KOHLER, B. DIDOMENICO, D. LOEBENBERG, and A. CACCIAPUOTI et al., 1997  Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949[Medline].

LO, W. S. and A. M. DRANGINIS, 1996  FLO11, a yeast gene related to the STA genes, encodes a novel cell surface flocculin. J. Bacteriol. 178:7144-7151[Abstract/Free Full Text].

LO, W. S. and A. M. DRANGINIS, 1998  The cell surface flocculin Flo11 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae. Mol. Biol. Cell 9:161-171[Abstract/Free Full Text].

LOEB, J. D., M. SEPULVEDA-BECERRA, I. HAZAN, and H. LIU, 1999  A G1 cyclin is necessary for maintenance of filamentous growth in Candida albicans. Mol. Cell. Biol. 19:4019-4027[Abstract/Free Full Text].

LORENZ, M. C. and J. HEITMAN, 1997  Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO J. 16:7008-7018[Medline].

MADHANI, H. D. and G. R. FINK, 1997  Combinatorial control required for the specificity of yeast MAPK signaling. Science 275:1314-1317[Abstract/Free Full Text].

MADHANI, H. D. and G. R. FINK, 1998  The control of filamentous differentiation and virulence in fungi. Trends Cell Biol 8:348-353[Medline].

MADHANI, H. D., C. A. STYLES, and G. R. FINK, 1997  MAP kinases with distinct inhibitory functions impart signaling specificity during yeast differentiation. Cell 91:673-684[Medline].

MENDENHALL, M. D. and A. E. HODGE, 1998  Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 62:1191-1243[Abstract/Free Full Text].

MOSCH, H. U. and G. R. FINK, 1997  Dissection of filamentous growth by transposon mutagenesis in Saccharomyces cerevisiae. Genetics 145:671-684[Abstract].

MOSCH, H. U., R. L. ROBERTS, and G. R. FINK, 1996  Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 93:5352-5356[Abstract/Free Full Text].

NASMYTH, K. and L. DIRICK, 1991  The role of SW14 and SW16 in the activity of G1 cyclins in yeast. Cell 66:995-1013[Medline].

OEHLEN, L. J. and F. R. CROSS, 1994  G1 cyclins CLN1 and CLN2 repress the mating factor response pathway at Start in the yeast cell cycle. Genes Dev. 8:1058-1070[Abstract/Free Full Text].

OEHLEN, L. J. and F. R. CROSS, 1998  Potential regulation of Ste20 function by the Cln1-Cdc28 and Cln2-Cdc28 cyclin-dependent protein kinases. J. Biol. Chem. 273:25089-25097[Abstract/Free Full Text].

OZCAN, S., F. SCHULTE, K. FREIDEL, A. WEBER, and M. CIRIACY, 1994  Glucose uptake and metabolism in grr1/cat80 mutants of Saccharomyces cerevisiae. Eur. J. Biochem. 224:605-611