Genetics, Vol. 153, 1193-1203, November 1999, Copyright © 1999

Drc1p/Cps1p, a 1,3-ß-Glucan Synthase Subunit, Is Essential for Division Septum Assembly in Schizosaccharomyces pombe

Jianhua Liua, Hongyan Wanga, Dannel McCollumb, and Mohan K. Balasubramaniana
a Cell Division Laboratory, Institute of Molecular Agrobiology, The National University of Singapore, Singapore 117604
b Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, Massachusetts 01605

Corresponding author: Mohan K. Balasubramanian, Institute of Molecular Agrobiology, The National University of Singapore, 1 Research Link, Singapore 117604, Republic of Singapore., mohan{at}ima.org.sg (E-mail)

Communicating editor: M. LICHTEN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Schizosaccharomyces pombe divides by medial fission through the use of an actomyosin-based contractile ring. A division septum is formed centripetally, concomitant with ring constriction. Although several genes essential for cytokinesis have been described previously, enzymes that participate in the assembly of the division septum have not been identified. Here we describe a temperature-sensitive mutation, drc1-191, that prevents division septum assembly and causes mutant cells to arrest with a stable actomyosin ring. Unlike the previously characterized cytokinesis mutants, which undergo multiple mitotic cycles, drc1-191 is the first cytokinesis mutant that arrests with two interphase nuclei. Interestingly, unlike drc1-191, drc1-null mutants proceed through multiple mitotic cycles, leading to the formation of large cells with many nuclei. drc1 is allelic to cps1, which encodes a 1,3-ß-glucan synthase subunit. We conclude that Drc1p/Cps1p is not required for cell elongation and cell growth, but plays an essential role in assembly of the division septum. Furthermore, it appears that constriction of the actomyosin ring might depend on assembly of the division septum. We discuss possible mechanisms that account for the differences in the phenotypes of the drc1-191 and the drc1-null mutants and also reflect the potential links between Drc1p and other cytokinesis regulators.


THE physical division of Schizosaccharomyces pombe is achieved by medial fission through the use of an actomyosin-based contractile ring. Late in anaphase, the actomyosin ring constricts and the division septum is deposited centripetally in coordination with ring constriction. The process of cytokinesis in S. pombe can be separated into at least five distinct steps: choice of the plane of cell division, assembly of the actomyosin ring, accumulation of F-actin patches at the division site, actomyosin ring constriction, and synthesis of the medial division septum (GOULD and SIMANIS 1997 Down). Genetic studies have identified mutants defective in a number of steps of this process (NURSE et al. 1976 Down; CHANG et al. 1996 Down; BAHLER and PRINGLE 1998 Down; BAHLER et al. 1998 Down; BALASUBRAMANIAN et al. 1998 Down).

The genes mid1, plo1, and pom1 are involved in selection of the division site (CHANG et al. 1996 Down; SOHRMANN et al. 1996 Down; BAHLER and PRINGLE 1998 Down; BAHLER et al. 1998 Down; BALASUBRAMANIAN et al. 1998 Down). Mid1p is nuclear during interphase and is a component of the actomyosin ring during mitosis and cytokinesis. Plo1p, a protein kinase, is thought to phosphorylate Mid1p at mitosis and cause the nuclear export of Mid1p to the cell cortex, where it might play a role in stabilizing the position of the actomyosin ring (BAHLER et al. 1998 Down). After the selection of the division site, the actomyosin ring is assembled. The genes cdc3, cdc4, cdc8, cdc12, rng2, rng3, rng4, myo2/rng5, and act1 (collectively referred to as rng genes) are required for the assembly of the actomyosin ring (MARKS et al. 1986 Down; CHANG et al. 1996 Down; ISHIGURO and KOBAYASHI 1996 Down; BALASUBRAMANIAN et al. 1998 Down). The identification of the products of the rng genes as F-actin cytoskeletal proteins and their intracellular localization patterns suggest that the products of the rng genes interact to promote actomyosin ring assembly (for a description of the rng genes refer to BALASUBRAMANIAN et al. 1997 Down; CHANG et al. 1997 Down; GOULD and SIMANIS 1997 Down; KITAYAMA et al. 1997 Down; MAY et al. 1997 Down; ENG et al. 1998 Down; NAQVI et al. 1999 Down). In addition, proteins such as Myp2p and Imp2p, which are not essential for cell viability but are components of the actomyosin ring, have also been identified (BEZANILLA et al. 1997 Down; MOTEGI et al. 1997 Down; DEMETER and SAZER 1998 Down). Following assembly of the actomyosin ring, the function of the ring component Cdc15p, a protein with SH3 and coiled-coil domains (FANKHAUSER et al. 1995 Down), is required for assembly of F-actin patches at the division site (BALASUBRAMANIAN et al. 1998 Down).

Whereas the products of the rng genes and Cdc15p are components of the F-actin cytoskeleton important for cell division, a second group of genes (collectively referred to as the sid genes) that regulates cytokinesis has also been identified (NURSE et al. 1976 Down; MARKS et al. 1986 Down; FANKHAUSER et al. 1995 Down; SCHMIDT et al. 1997 Down; BALASUBRAMANIAN et al. 1998 Down). The sid genes include cdc7, cdc11, cdc14, sid1, sid2, spg1/sid3, and sid4. The cdc7 (FANKHAUSER and SIMANIS 1994 Down), sid1 (D. MCCOLLUM, unpublished results), and sid2 genes encode protein kinases (BALASUBRAMANIAN et al. 1998 Down) and the spg1/sid3 gene encodes a GTPase (SCHMIDT et al. 1997 Down; BALASUBRAMANIAN et al. 1998 Down). Analysis of the products of the sid genes suggests that they act in a signaling cascade that controls septum deposition in response to signals originating from the spindle pole body (SOHRMANN et al. 1998 Down).

Although advances have been made in identifying proteins important for actomyosin ring positioning, assembly, and the regulation of septum formation, several key aspects of cytokinesis remain poorly understood in S. pombe. For example, the links between the enzymes required for assembly of the division septum and the previously identified proteins that regulate cytokinesis are unknown. In this article, we present evidence that drc1/cps1, which encodes a 1,3-ß-glucan synthase (ISHIGURO et al. 1997 Down), is essential for assembly of the division septum, but not for cell elongation and cell growth. Drc1p appears to function downstream of the septum initiation defective gene products in effecting the assembly of the division septum.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Media, reagents, yeast techniques, and cytological methods:
The S. pombe strains used in this study and their relevant genotypes are shown in Table 1. Yeast cells were grown on YES medium or Edinburgh minimal medium (EMM) with appropriate supplements as described (MORENO et al. 1991 Down). Genetic crosses were performed by mixing appropriate strains of opposite mating type on YPD medium, and recombinant strains were obtained by tetrad dissection. In general, yeast transformations with plasmid DNA were carried out by electroporation (PRENTICE 1992 Down). In cases where cosmids were introduced into yeast cells, a spheroplast transformation method using lipofectin was used (ALLSHIRE 1990 Down). FACS analysis was performed as described in the world wide web site of the laboratory of Dr. Susan Forsburg (http://pingu.salk.edu/users/forsburg/lab.html). Lipofectin was obtained from GIBCO (Bethesda, MD). Fluorescence microscopy methods used were essentially as described previously (BALASUBRAMANIAN et al. 1997 Down). Formaldehyde fixation was used for visualization of F-actin using rhodamine-conjugated phalloidin, and methanol fixation was used for the detection of microtubules, Myo2p (NAQVI et al. 1999 Down), Cdc4p (MCCOLLUM et al. 1995 Down), and stainings involving antibodies against the hemagglutinin (HA) epitope.


 
View this table:
In this window
In a new window

 
Table 1. List of S. pombe strains used in this study

Isolation of the drc1-191 mutant, molecular cloning of drc1+, and mapping the drc1-191 mutation:
The drc1-191 mutant was identified in a screen for mutants capable of diploidization following a short heat pulse as described elsewhere (BALASUBRAMANIAN et al. 1998 Down). drc1-191, a previously undescribed mutant defective in cytokinesis obtained from this screen, was capable of growth and colony formation at 24°, but died as a result of failed cytokinesis at 36°. A positional cloning strategy was employed to clone drc1+. In short, drc1-191 was mapped to chromosome 2 and was found to be located 1.1 cM from cdc14+, to contig 14 based on the map of GARKAVTSEV and MIZUKAMI 1997 Down. Cosmids spanning contig 14 were donated by Drs. M. Yanagida (Kyoto University, Japan) and R. Gwilliam (Sanger Center, Cambridge, U.K.). The bacterial transposon Tn1000, contained as Tn1000 his7+ ars1 (MORGAN et al. 1996 Down), was a gift of Dr. P. Nurse, ICRF, London. Tn1000 was allowed to insert into these cosmids using standard techniques (SAMBROOK et al. 1989 Down). Cosmids marked with the his7+ gene were introduced into a drc1-191 his7-366 strain and selected for histidine prototrophy. Transformants were subsequently tested for their ability to form colonies at 36°. One cosmid, c145, allowed the drc1-191 his7-366 to form colonies at 36°. To identify the gene responsible for the rescue of drc1-191, transposon mutagenesis was employed and a bank of c145 with transposon insertions was generated and individual cosmids were introduced into drc1-191 his7-366. A cosmid containing an insertion at the presumed promoter region of the cps1 gene, which encodes a 1,3-ß-glucan synthase, was found to be incapable of rescuing drc1-191. Upon subcloning, the cps1+ gene carried on the plasmid vector pUR19 (BARBET et al. 1992 Down) was found to rescue drc1-191. Thus, drc1 is allelic with cps1. The mutation in the drc1-191 allele was mapped as follows: polymerase chain reaction was used to generate four PCR fragments from wild-type DNA that spanned the entire drc1+ gene (Figure 5A). The primers used in the PCR reactions were as follows: (1) 3h-A655, 5' ATTCATCATGGATCAGTATTGGCGTGAAC 3' and 3h-A2272c, 5' AGCACCCAAAAATCTGATAGAATCTGCC 3'; (2) 3h-B2139, 5' ATTTCACTCCGACCTCAAAAACAGGTGC 3' and 3h-B3612c, 5' GCATCGATCATTTGTACATATTCACCTC 3'; (3) 3h-C3388, 5' GCAAATTGCATATATGGATGAAGATCCTC 3' and 3h-C4750c, 5' ACTAATGCAAAGAGCAGTCAGCGTAATCC 3'; and (4) 3h-D4611, 5' CACTATTGTATTCTCGATTCTCTGGACC 3' and 3h-D5900c, 5' GAAATAAGCATCCACATCACACAAATCC 3'. These PCR fragments were introduced individually into drc1-191 and assessed for their ability to rescue the temperature-sensitive (ts) mutation by gene-conversion-mediated repair of the drc1-191 mutation. The 5' fragment (codons 1–450) rescued the drc1-191 mutation. Five subfragments spanning this region found capable of rescuing drc1-191 were introduced into drc1-191 and the mutation was further mapped to lie between codons 150 and 300. DNA sequence determination of the corresponding region from the drc1-191 mutant established that codon 277 was changed from GAT to AAT, resulting in the replacement of the aspartic acid residue at this position with an asparagine.



View larger version (108K):
In this window
In a new window
Download PPT slide
 
Figure 1. drc1-191 mutants are defective in division septum deposition and in maintenance of cell polarity. Samples were taken prior to shift to 36° (0 hr), as well as 4 and 8 hr after shift to 36°, fixed, and stained with calcofluor to visualize septa. Arrows point to the cell tips, whose diameter is comparable to that of wild-type cells.



View larger version (125K):
In this window
In a new window
Download PPT slide
 
Figure 2. drc1-191 mutants arrest with stable actomyosin rings. drc1-191 cells were grown at the permissive temperature (24°) to exponential phase and shifted to the restrictive temperature (36°). Samples were taken prior to shift to 36° (0 hr), as well as 4 and 8 hr after shift to 36°, fixed, and stained with rhodamine-conjugated phalloidin and DAPI to visualize F-actin and nuclei (labeled DNA), respectively.



View larger version (85K):
In this window
In a new window
Download PPT slide
 
Figure 3. (A) drc1-191 mutants arrest with interphase or postanaphase microtubule configuration. (B) drc1-191 mutants arrest predominantly with 4C DNA content. drc1-191 cells were grown at the permissive temperature (24°) to exponential phase and shifted to the restrictive temperature (36°). Samples were taken prior to shift to 36° (0 hr), as well as 4 and 8 hr after shift to 36°, fixed, and stained either with TAT1 antibodies and DAPI to visualize microtubules and chromosomal DNA or with propidium iodide, and processed for FACS analysis. In the FACS analysis, a wild-type haploid and a wild-type diploid strain were used as controls for the 2C and 4C DNA peaks, respectively.



View larger version (50K):
In this window
In a new window
Download PPT slide
 
Figure 4. Cdc7p is located at one SPB in drc1-191 cells at the restrictive temperature. A drc1-191 cdc7-HA3 strain grown at 24° was shifted to 36° for 4 hr, fixed, and stained with antibodies against the HA epitope and DAPI. Merged images with DNA in blue and Cdc7p in red are shown.



View larger version (57K):
In this window
In a new window
Download PPT slide
 
Figure 5. Molecular cloning and analysis of drc1+. (A) Positional cloning of drc1+, identification of the drc1 coding region, and mapping of the drc1-191 mutation. drc1-191 was found to be tightly linked to cdc14-118. Cosmids spanning this region were tagged with his7+ and introduced into a drc1-191 his7-366 strain. One cosmid, c145, was capable of rescuing drc1-191. An 8-kb HindIII-HindIII fragment from this cosmid was sufficient for the rescue of drc1-191. A previously described gene, cps1, which encodes a 1,3-ß-glucan synthase, was found to reside in this rescuing fragment. The mutation in drc1-191 was mapped as described in MATERIALS AND METHODS. The overlapping DNA fragments that contain the mutation are marked with an asterisk. (B) Alignment of predicted amino-acid sequence of drc1-191 with the corresponding region of other 1,3-ß-glucan synthases. Sp., S. pombe; Sc., Saccharomyces cerevisiae; Ca., Candida albicans; En., Emericilla nidulans; and Af., Aspergillus fumigatus. The site of mutation is marked with "277" over the predicted amino-acid sequence of Drc1-191p.

Construction and analysis of a drc1-null mutant:
To analyze the phenotype of the drc1-null mutant, a DNA molecule was created in which over 80% of the drc1/cps1 coding region was replaced with the ura4+ gene (Figure 6A). A plasmid carrying this construction was linearized and introduced into the uracil auxotrophic diploid MBY494, of the genotype ade6-M210/ade6-M216 leu1-32/leu1-32 his3-d1/his3-d1 ura4-D18/ura4-D18 h+/h-. Fifty uracil prototrophic colonies were screened by PCR and three were found to have undergone the expected gene replacement event. One of these, MBY507, of the genotype drc1+/drc1::ura4+ ade6-M210/ade6-M216 leu1-32/leu1-32 his3-d1/his3-d1 ura4-D18/ura4-D18 h+/h- was used for further characterization of the drc1-null phenotype. MBY507 was plated on EMM plates lacking adenine and uracil until the diploid cells had sporulated, and spores were prepared from the mixture of asci and cells by treatment with glusulase. Spore germination experiments were carried out either in liquid EMM medium lacking uracil, to allow only spores bearing the drc1::ura4+ allele to germinate, or in YES liquid medium as described in the legend to Figure 6C.



View larger version (93K):
In this window
In a new window
Download PPT slide
 
Figure 6. (A) Restriction map of the drc1::ura4 construction. Approximately 80% of the Drc1p coding region, contained between the two BglII sites, was deleted and replaced with a 1.8-kb BamHI fragment carrying the ura4+ gene. (B) Drc1p is essential for cell viability. Tetrads from a drc1::ura4+/drc1+ strain were dissected either on YES medium (Y) or YES medium containing 1.2 M sorbitol (YS) and incubated at 32°. (C) Terminal phenotype of drc1-null mutants. Spores prepared from the drc1::ura4+/drc1+ strain were inoculated in EMM lacking uracil (cells 1 and 2) or YES (the multinucleate cells), germinated for 18 hr (EMM) or 22 hr (YES), fixed, and stained with rhodamine-conjugated phalloidin and DAPI to visualize F-actin and nuclei, respectively.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

drc1-191 blocks division septum formation:
In a screen for mutants defective in cytokinesis, we isolated a temperature-sensitive mutant, drc1-191, that is defective in cell division. The drc1-191 mutation was found to be recessive, since cells of the genotype drc1+/drc1-191 resembled wild-type cells and were capable of colony formation under conditions in which the drc1-191 mutant was unable to form colonies (data not shown). To establish the stage of cytokinesis at which drc1-191 cells are defective, we first stained cells incubated at permissive and restrictive conditions with calcofluor. Under permissive conditions (24°) drc1-191 cells are capable of division and colony formation (Figure 1, 0 hr). Upon shift to the restrictive condition (36°) for 4 hr, however, cell proliferation was affected and cells arrested the cycle unable to form a division septum (Figure 1, 4 hr). In many cases, what appeared as an excessive deposition of cell wall material was detected at one or both ends of the cell. Upon prolonged incubation at 36°, cell morphology was affected severely and cells with cylindrical, spherical, and other abnormal morphologies accumulated (Figure 1, 8 hr). Although drc1-191 cells were capable of proliferation at 24°, morphological abnormalities were associated with the drc1-191 mutation even at the permissive temperature. We found that drc1-191 cells were unable to maintain constant cell diameter and a cylindrical morphology. drc1-191 cells were, however, not defective in initiating polarized growth (Figure 1, 0 hr, marked with arrows), since cell tips were approximately of the same diameter as wild-type cells. These observations established that drc1-191 is defective in division septum deposition and is unable to maintain wild-type cell morphology.

Actomyosin rings are unusually stable in drc1-191 mutant cells:
Numerous studies have shown that the assembly of the division septum requires a functional F-actin cytoskeleton (GOULD and SIMANIS 1997 Down). We therefore stained heat-arrested drc1-191 cells with rhodamine-conjugated phalloidin and 4',6-diamidino-2-phenylindole (DAPI) to visualize the F-actin cytoskeleton and chromosomes, respectively. To clearly assess whether cells were in interphase or in mitosis, heat-arrested drc1-191 cells were stained with TAT-1 antibodies to visualize the microtubule cytoskeleton. Under permissive conditions drc1-191 cells resembled wild-type cells in that ~15–20% of the cells were binucleate and the rest were uninucleate (Table 2). F-actin was visualized in patches in interphase cells and in rings in cells undergoing mitosis and cytokinesis (Figure 2, 0 hr). Under these conditions, as expected, most binucleate cells displayed a mitotic spindle (shown with an arrow in Figure 3A, 0 hr) and some binucleate cells displayed a postanaphase array of microtubules (shown with an arrowhead in Figure 3A, 0 hr). An interphase array of microtubules was visualized in all uninucleate cells that did not show detectable chromosome condensation.


 
View this table:
In this window
In a new window

 
Table 2. The percentage of uninucleate and binucleate cells of drc1-191 and wild-type cells at 24° and after a 4-hr shift to 36°

Upon shift to the restrictive condition for 4 hr, 70–80% of drc1-191 cells blocked with two interphase nuclei and F-actin was detected in a ring structure (Table 2 and Figure 2, 4 hr). The rest of the cells were found to be uninucleate. The unusually stable nature of the actomyosin ring in this mutant led to the gene name drc1-191 (defective in ring constriction). Microtubule staining confirmed that the drc1-191 cells were arrested in interphase since cells blocked predominantly either with interphase arrays of microtubules or with a postanaphase array of microtubules (Figure 3A, 4 hr). The medial ring in heat-arrested drc1-191 cells also contained other components associated with the actomyosin ring such as Cdc4p and Myo2p (data not shown). This percentage of cells blocked with actomyosin rings is abnormally high, given that actomyosin rings are detected only in ~15% of asynchronously growing cells. Upon prolonged incubation at the restrictive temperature (Figure 2, 8 hr), cells assumed a variety of shapes and ~20% of cells were found to contain four nuclei with actomyosin rings, whereas the rest of the cells (80%) still contained only two interphase nuclei and detectable actomyosin rings. Again, microtubule staining confirmed the interphase status of the majority of cells (Figure 3A, 8 hr). These observations suggested that the execution of Drc1p function was important for actomyosin ring constriction and/or disassembly and septation.

Heat-arrested drc1-191 cells also appeared to be incapable of substantial cell elongation when compared with other cytokinesis mutants. To rigorously test the effect of the drc1-191 mutation on cell elongation, wild-type, drc1-191, and the cytokinesis-defective cdc7-24 cells (FANKHAUSER and SIMANIS 1994 Down) were grown at 24° and shifted to 36° for 6 hr and the length of 100 cells was measured (Table 3). Whereas 100% wild-type cells distributed in the 6–15 µm range, 44% of drc1-191 cells were found to be distributed between 6 and 15 µm and the rest were distributed between 16 and 25 µm. By contrast, cdc7-24 cells were distributed between 26–35 µm (10%), 36–45 µm (42%), and 46–55 µm (48%). This analysis clearly established that drc1-191 was defective in substantial cell elongation.


 
View this table:
In this window
In a new window

 
Table 3. The length distribution of wild-type, drc1-191, and cdc7-24 cells after a 6-hr shift to 36° from 24°

Given that drc1-191 mutants blocked with two interphase nuclei and an actomyosin ring, we asked if the interphase nuclei in arrested drc1-191 mutants had undergone DNA replication. To address this issue, the amount of DNA in drc1-191 cells arrested at 36° for 4 hr was quantitated by FACS analysis. As controls, a wild-type haploid strain and a wild-type diploid strain were also quantitated in a similar manner. As shown in Figure 3B, peaks characteristic of 2C and 4C DNA were seen in asynchronously growing wild-type haploid and wild-type diploid strains, respectively, consistent with the fact that the G1 and S phases of S. pombe are completed prior to cell division. Interestingly, consistent with the presence of 70% binucleate cells, ~70% of drc1-191 cells accumulated a 4C DNA peak (based on integration of the 2C and 4C peaks), suggesting that under the arrest conditions they were not impaired for DNA replication but were incapable of entry into mitosis.

Cdc7p is localized asymmetrically at the drc1-191 arrest point:
To further characterize the phenotype of the drc1-191 mutant, we investigated the localization of the septum-inducing Cdc7p-kinase (FANKHAUSER and SIMANIS 1994 Down). Cdc7p localizes to the spindle pole body (SPB) in early mitosis and is then found only on one SPB between anaphase B and completion of septum deposition. No distinct Cdc7p staining is visualized in uninucleate interphase cells and in cells that have completed septum formation (SOHRMANN et al. 1998 Down). To assess the localization of Cdc7p at the drc1-191 blockpoint, we constructed a drc1-191 strain whose chromosomal copy of the cdc7 gene was tagged with three copies of the HA epitope. Cdc7-HA3-tagged drc1-191 cells were arrested at the restrictive temperature for 4 hr, fixed, and stained with antibodies against the HA epitope. At the drc1-191 arrest point all binucleate cells were found to have Cdc7p staining localized at one SPB. Merged images of chromosomal staining with DAPI and Cdc7p staining with HA antibodies is shown in Figure 4. The drc1-191 mutant, therefore, arrests at a point in the cell cycle where the septum-promoting Cdc7p is located on one SPB. Thus, the function of the actomyosin ring assembly proteins (products of the rng genes; required for actomyosin ring assembly) and the septum initiation proteins (products of the sid genes; required for onset of actomyosin ring constriction and septum deposition) appear to be executed normally in the drc1-191 mutant.

drc1 is allelic with cps1 and encodes a 1,3-ß-glucan synthase subunit:
To understand the molecular nature of Drc1p, we attempted to clone drc1+ by complementation of the heat-sensitive colony formation defect of drc1-191. We failed to isolate drc1+ from a number of plasmid-borne S. pombe genomic libraries. As an alternative, therefore, we utilized a positional cloning approach to isolate drc1+. During the course of backcrosses performed following the mutagenesis we noticed that drc1-191 was linked to the leu1 and the mat loci, which are located near the centromere of chromosome II. In a cross between leu1-32 and drc1-191, 36 parental ditypes (PD), 19 tetratypes (TT), and 1 nonparental ditype (NPD) were obtained, placing the drc1 locus at a distance of 22.3 cM from leu1. From the same cross, we established that the drc1 locus was 12.5 cM from the mat locus (24 PD: 8 TT: 0 NPD). Finally, drc1 was found to be 1.1 cM from the cdc14 locus (45 PD: 1 TT: 0 NPD). To isolate the drc1+ gene, we then asked if cosmids spanning this region of the genome were capable of rescuing drc1-191 for colony formation at 36°. Of the six cosmids tested, one cosmid, c145, allowed drc1-191 to form colonies at 36° (Figure 5A). The reading frame conferring the Drc1+ phenotype was identified by the isolation of a derivative of c145 following transposon mutagenesis that failed to rescue drc1-191. Analysis of DNA sequences flanking the transposon showed that the transposon had inserted upstream of a gene encoding a 1,3-ß-glucan synthase subunit, previously identified as the product of the cps1+ gene (ISHIGURO et al. 1997 Down). Proof that drc1 was allelic with cps1 was obtained in two ways. First, a plasmid carrying cps1+ alone allowed drc1-191 cells to form colonies at 36°. Second, a single base change (G to A transition) was detected in the cps1 gene, when DNA sequence from drc1-191 was analyzed. This mutation caused the replacement of an aspartic acid residue at position 277, conserved in all 1,3-ß-glucan synthases, by an asparagine residue (Figure 5B). Thus, we conclude that drc1 is allelic with cps1 and encodes a 1,3-ß-glucan synthase subunit. Garnier analysis of the predicted amino acid sequence of Drc1p resulted in the identification of 14 potential transmembrane domains in this protein (data not shown). Sequence comparisons also identified two more genes in S. pombe that are predicted to encode 1,3-ß-glucan synthase subunits, which we refer to as pgs2 and pgs3 (for pombe glucan synthase). Pgs2p (ORF SPAC24C9.07) and Pgs3p (ORF SPCC1840.02c) are ~55% identical to Drc1p/Cps1p.

drc1/cps1 null mutants perform multiple nuclear cycles despite failed division septum deposition:
To test the phenotype resulting from the complete deletion of the drc1 gene, we constructed a strain of the genotype drc1::ura4/drc1+ (described in MATERIALS AND METHODS and Figure 6A). Upon meiosis and sporulation, spores bearing the drc1-null allele were found to be capable of germination and establishing polarized growth, but were incapable of performing cytokinesis and did not maintain polarity (Figure 6B). Similar results were obtained when spores bearing the drc1::ura4 allele were allowed to germinate on medium containing 1.2 M sorbitol, establishing that drc1::ura4 spores were not defective in general cell wall assembly (Figure 6B). We conclude that the drc1 gene product is not required for spore germination, polarity establishment, and cell elongation, but is required for division septum deposition and for maintenance of cell polarity.

To further characterize the terminal phenotype of the drc1-null mutants, drc1::ura4 spores were germinated, fixed, and stained to visualize F-actin and nuclei. drc1::ura4 mutants failed to form septa, although occasionally faint cell wall-like structures that did not stain with calcofluor were detected (shown with arrowhead in Figure 6C). Germinated drc1::ura4 spores were capable of polarity establishment (shown with arrows in Figure 6C), but appeared to be incapable of polarity maintenance, causing them to become spherical and highly enlarged (Figure 6C). Interestingly, unlike the drc1-191 mutant, drc1::ura4 underwent multiple nuclear division cycles causing arrested cells to accumulate up to 32 nuclei. Note that cell 1 in Figure 6C has two interphase nuclei following failed cytokinesis and has actin patches at the cell ends. However, cell 2 in Figure 6C is in mitosis (as seen by the presence of condensed chromosomes) and contains an actomyosin ring. Thus, actomyosin rings assemble in the drc1::ura4 mutants, but unlike the drc1-191 mutant, they disassemble following mitosis.

It remained possible that the phenotype associated with the drc1-null mutant was a peculiarity associated with spore germination. To determine whether this was the case, spores arising from mating and meiosis of a drc1-191 homothallic strain (spores of the genotype drc1-191) were germinated at 36°. After 24 hr of growth, similar to that observed with the vegetative drc1-191 cells, germinated drc1-191 spores were arrested predominantly with two nuclei (70%) and the rest had four nuclei (data not shown). We therefore conclude that in a strain depleted of Drc1p, septum assembly and cell polarity are affected, but nuclear cycles, assembly of actomyosin rings at mitosis, and disassembly of actomyosin rings at the end of mitosis happen normally.

Genetic interactions between drc1-191 and mutations affecting actomyosin ring assembly and placement:
To assess potential interactions between drc1-191 and mutations causing defective actomyosin ring assembly, placement, and function, we crossed drc1-191 to mid1-18, cdc3-124, cdc4-8, cdc8-110, cdc15-140, rng2-D5, rng3-65, and myo2-E1. The drc1-191 mutant showed strong negative interactions with cdc4-8, myo2-E1, and the rng2-D5 mutants. The drc1-191 myo2-E1 double mutant was unable to form colonies at 24°, a temperature at which both parental strains were capable of colony formation (data not shown). The drc1-191 rng2-D5 and drc1-191 cdc4-8 double mutants grew extremely poorly and showed cytokinesis defects at 24°, a temperature at which rng2-D5 and cdc4-8 single mutants grew healthily and resembled wild-type cells in morphology (Figure 7). In both double mutant combinations (drc1-191 cdc4-8 and drc1-191 rng2-D5) highly elongated cells with multiple nuclei were seen frequently. Significant genetic interactions were not detected in other combinations. Based on the interactions with actomyosin ring mutants, we conclude that Drc1p might interact with other actomyosin ring components to effect septum assembly.



View larger version (128K):
In this window
In a new window
Download PPT slide
 
Figure 7. drc1-191 shows strong negative interactions with cdc4-8 and rng2-D5. Cells of the genotypes drc1-191, cdc4-8, rng2-D5, drc1-191 cdc4-8, and drc1-191 rng2-D5 were grown at 24° (permissive for drc1-191, cdc4-8, and rng2-D5), fixed, stained with DAPI to visualize the DNA, and photographed under Nomarski optic settings.

The sid group of mutations are epistatic to drc1-191:
Previous studies have identified a large collection of mutants, referred to as the sid group of mutants, that are defective in septum deposition, even though F-actin rearrangements and nuclear cycles are not affected (MARKS et al. 1986 Down; FANKHAUSER et al. 1995 Down; BALASUBRAMANIAN et al. 1998 Down). Thus, sid mutants accumulate multiple nuclei and assemble actomyosin rings during mitosis, which disassemble following mitosis. Mutations in seven known genes lead to a Sid phenotype (MARKS et al. 1986 Down; SCHMIDT et al. 1997 Down; BALASUBRAMANIAN et al. 1998 Down). The major difference in the phenotype of drc1-191 and the sid mutations is that the drc1-191 mutant fails to elongate substantially (Table 3) and arrests with only two nuclei, whereas the sid mutants accumulate multiple nuclei and become highly elongated. To check for epistasis relationships, we combined drc1-191 with ts sid mutations. Double mutants of the genotypes cdc7-24 drc1-191, cdc11-119 drc1-191, cdc14-118 drc1-191, sid1-239 drc1-191, sid2-250 drc1-191, spg1-106 drc1-191, and sid4-A1 drc1-191 were constructed. To analyze the phenotypes of the double mutants, cells were grown to exponential phase, shifted to the restrictive temperature for 4 hr, fixed, and stained to visualize F-actin and DNA. The results obtained from characterizing one such double mutant, cdc7-24 drc1-191, are shown in Figure 8A. Interestingly, even though drc1-191 arrested with two nuclei and stable actomyosin rings, the cdc7-24 drc1-191 double mutants were indistinguishable from the cdc7-24 single mutant (Figure 8A). Nuclear cycles continued in the double mutants leading to the formation of elongated cells with up to four nuclei. Furthermore, actomyosin rings were detected only in mitotic cells and F-actin patches at the cell ends were seen in interphase cells. All sid drc1-191 double mutant combinations listed above resulted in similar phenotypes upon temperature shift (data not shown). We conclude that the sid mutant phenotype of elongated cells with multiple nuclei is epistatic to that of drc1-191. The double mutant analysis also suggested that the drc1-191 mutant is not defective in cell elongation, but that the blockpoint of drc1-191 prevents substantial cell elongation.



View larger version (79K):
In this window
In a new window
Download PPT slide
 
Figure 8. Genetic interactions involving drc1-191 and the sid genes. (A) cdc7-24 is epistatic to the mitotic phenotype of drc1-191. Cells of the genotypes cdc7-24, drc1-191, and cdc7-24 drc1-191 were grown at the permissive temperature (24°) to exponential phase and shifted to the restrictive temperature (36°). Samples were taken 4 hr after shift to 36°, fixed, and stained with rhodamine-conjugated phalloidin and DAPI to visualize F-actin and nuclei (labeled DNA), respectively. (B) Negative interaction between drc1-191 and sid2-250. Cells of the genotype drc1-191 sid2-250 were fixed and stained with DAPI to visualize nuclei.

In the course of analysis of the sid drc1-191 double mutants, we found that drc1-191 showed a strong negative interaction with mutations in the sid2+ gene, which encodes a protein kinase related to the budding yeast Dbf2p and Dbf20p kinases (BALASUBRAMANIAN et al. 1998 Down). At 24°, the permissive temperature for sid2-250 and drc1-191, the double mutants grew very poorly. A high percentage of multinucleate cells that had failed to form a division septum were observed in the culture (Figure 8B). Thus, Sid2p might play an important role in the function of Drc1p.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drc1p/Cps1p, a protein essential for division septum deposition, is a 1,3-ß-glucan synthase subunit:
Previous studies of cytokinesis have identified a large collection of gene products that regulate various aspects of actomyosin ring function and division septum deposition (GOULD and SIMANIS 1997 Down; BALASUBRAMANIAN et al. 1998 Down). However, the mechanisms that link the gene products controlling cytokinesis to the proteins that participate in the physical assembly of the division septum are not understood. The division septum is assembled in two distinct phases in S. pombe. First, a primary septum, which reacts strongly with calcofluor, is formed centripetally concomitant with actomyosin ring constriction. Subsequently, secondary septa are formed on either side of the primary septum, leading to the formation of a three-layered septum. Finally, the primary septum is degraded to liberate the two daughter cells, with the secondary septa being localized at the ends formed as a result of cell division (JOHNSON et al. 1989 Down). The septa and cell wall of S. pombe are composed of three major types of polymers, 1,3-ß-glucan, 1,3-{alpha}-glucan, and {alpha}-galactomannan. Thus, enzymes that participate in the assembly of these polymers should be important for cell wall assembly, division septum deposition, and cell polarity. Recently, characterization of mok1/ags1, a gene encoding an {alpha}-glucan synthase has been reported (HOCHSTENBACH et al. 1998 Down; KATAYAMA et al. 1999 Down). Mok1p localizes to the growing end(s) of interphase cells and to the medial region of the cell during septation consistent with a role for Mok1p in cell elongation, polarity, and septation (KATAYAMA et al. 1999 Down).

In this study we describe drc1, a gene allelic to the previously described gene cps1, which encodes a 1,3-ß-glucan synthase subunit (ISHIGURO et al. 1997 Down). We have shown that Drc1p is essential for cell viability. Drc1p, together with Pgs2p and Pgs3p (J. LIU, H. WANG and M. K. BALASUBRAMANIAN, unpublished observations) represent three proteins encoded in the S. pombe genome that are related to 1,3-ß-glucan synthase subunits. Our identification of the amino-acid substitution in the temperature-sensitive mutant, drc1-191, should provide a basis to create similar mutations in other 1,3-ß-glucan synthases and also for structure-function studies of these enzymes.

A number of studies have demonstrated the involvement of the Rho family of GTPases in regulation of 1,3-ß-glucan synthases (ARELLANO et al. 1996 Down; DRGANOVA et al. 1996; QADOTA et al. 1996 Down; NAKANO et al. 1997 Down). Thus, a Rho GTPase pathway might regulate septum deposition in S. pombe.

Our characterization of drc1-191 and drc1-null mutants has shown that Drc1p is essential for the assembly of the division septum. At least two lines of evidence suggest that Drc1p might not be involved in cell wall assembly during cell elongation. First, drc1-null mutants are capable of spore germination, assembling cell wall, and growth and become highly enlarged, suggesting that general cell wall assembly is not defective in cells lacking Drc1p. Second, double mutants of the genotype sid- drc1-191 are elongated and are phenotypically similar to the sid single mutants (Figure 8A). Thus, we conclude that Drc1p is required for division septum assembly, but not for cell elongation. It is likely that the other proteins related to 1,3-ß-glucan synthases, such as Pgs2p and Pgs3p, participate in cell wall assembly for processes such as spore germination and cell elongation. drc1-null mutants assume a variety of cell morphologies. However, the diameter of cell tips of drc1-null mutants is similar to that of wild-type cells. Thus, Drc1p also appears to play a role in maintenance of cell shape, but not in the establishment of cell polarity. Again, Pgs2p and Pgs3p might be important for cell polarity establishment. Genetic interactions between the sid mutants and drc1-191 demonstrate that the sid gene products, which regulate septum deposition, function upstream of Drc1p. Temperature-sensitive mutations, in particular Sid2p, which show a strong negative interaction with drc1-191, might play an important role in Drc1p function.

Actomyosin ring constriction/disassembly in S. pombe:
The drc1-191 mutant arrests with stable actomyosin rings. This is the first mutant that we are aware of that displays the phenotype of highly stabilized actomyosin rings. Thus, it is possible that deposition of the division septum is important for disassembly/constriction of the actomyosin ring. Consistent with this idea, stable actomyosin rings are detected in reverting protoplasts treated with enzymes that degrade the cell wall. However, actomyosin rings constrict and division septa are laid down normally in reverting protoplasts not treated with cell wall-degrading enzymes (JOCHOVA et al. 1991 Down). Presently, it is unclear whether actomyosin constriction is powered by myosin II acting as a motor or whether cell wall secretion pushes the actomyosin ring, and the role of the actomyosin ring is only to guide and orient the direction of septum delivery. The previous studies do not address this question since Myo2p-ATPase (Myo2p is a type II myosin heavy chain) domain mutants fail to assemble proper actomyosin rings (NAQVI et al. 1999 Down). Isolation and characterization of ts Myo2p ATP-ase mutants will resolve this issue.

Actomyosin rings are assembled at the onset of mitosis and disassembled during mitotic exit in drc1-null mutants. However, actomyosin rings are stable in drc1-191 mutants at the restrictive temperature. These findings suggest that Drc1p might interact intimately with the ring to regulate its stability during septation. Thus, in mutants devoid of Drc1p, the actomyosin ring might simply collapse at the end of mitosis. Consistent with this, we have identified genetic interactions between drc1-191 and mutations affecting Myo2p (KITAYAMA et al. 1997 Down; MAY et al. 1997 Down; BALASUBRAMANIAN et al. 1998 Down), Cdc4p, a light chain of Myo2p (NAQVI et al. 1999 Down), and Rng2p, a protein related to IQGAP (ENG et al. 1998 Down), all of which affect actomyosin ring function.

drc1-191, a novel cytokinesis mutant that arrests with only two nuclei:
The drc1-191 mutant is the first cytokinesis mutant that we are aware of that blocks with two interphase nuclei. The previously characterized cytokinesis mutants were either defective in assembling proper actomyosin rings (rng mutants) or destabilized the actomyosin ring at the end of anaphase (sid mutants). By contrast, the drc1-191 mutant arrests with a stable actomyosin ring. A possibility is that the presence of a stable actomyosin ring arrests cells at a point at which further cell elongation and cell mass increase are rendered inactive. Thus, arrested drc1-191 cells might not grow sufficiently to allow the two interphase nuclei to undergo mitosis. An alternative possibility is that the presence of the actomyosin ring in an interphase cell (generated due to failed cytokinesis) might prevent entry of the two G2 nuclei into the M phase. The findings that multiple rounds of mitoses occur in drc1-null mutants and drc1-191 cdc7-24 double mutants is consistent with both possibilities, since actomyosin ring destabilization at the end of anaphase and cell growth occur in the drc1-null mutant as well as in the drc1-191 cdc7-24 double mutant. Further quantitative and physiological studies of drc1-191 single mutants and drc1-191 in combination with other mutations affecting nuclear cycle progression will be necessary to firmly establish the molecular basis of arrest of the drc1-191 mutants with two G2 nuclei.


*  ACKNOWLEDGMENTS

We especially thank Dr. Kathy Gould in whose laboratory the drc1-191 mutant was isolated. We thank Dr. P. Nurse for providing the TnHis7-transposon system, Dr. K. Gull for TAT-1 antibody, Dr. V. Simanis for the cdc7-HA3 strain, and Drs. M. Yanagida and R. Gwilliam for providing ordered S. pombe cosmids used in this study. Many thanks are due to Drs. N.-H. Chua, M. Glotzer, K. Gould, A. Munn, N. Naqvi, K. Sampath, V. Sundaresan, U. Surana, S. Vaidyanathan; to S. Naqvi, S. Rajagopalan, and K. Wong; and to all other members of the IMA yeast laboratories for discussion, encouragement, and/or critical reading of the manuscript. This work was supported by research funds from the National Science and Technology Board, Singapore, to M.K.B.; D.M. was supported by a National Institutes of Health grant.

Manuscript received April 21, 1999; Accepted for publication July 23, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ALLSHIRE, R. C., 1990  Introduction of large linear minichromosomes into Schizosaccharomyces pombe by an improved transformation procedure. Proc. Natl. Acad. Sci. USA 87:4043-4047[Abstract/Free Full Text].

ARELLANO, M., A. DURAN, and P. PEREZ, 1996  Rho 1 GTPase activates the (1-3)beta-D-glucan synthase and is involved in Schizosaccharomyces pombe morphogenesis. EMBO J. 15:4854-4891.

BAHLER, J. and J. R. PRINGLE, 1998  Pom1p, a fission yeast protein kinase that provides positional information for both polarized growth and cytokinesis. Genes Dev. 12:1356-1370[Abstract/Free Full Text].

BAHLER, J., A. B. STEEVER, S. WHEATLEY, Y. WANG, and J. R. PRINGLE et al., 1998  Role of polo kinase and Mid1p in determining the site of cell division in fission yeast. J. Cell Biol. 143:1603-1616[Abstract/Free Full Text].

BALASUBRAMANIAN, M. K., D. MCCOLLUM, and K. L. GOULD, 1997  Cytokinesis in fission yeast Schizosaccharomyces pombe.. Methods Enzymol. 283:494-506[Medline].

BALASUBRAMANIAN, M. K., D. MCCOLLUM, L. CHANG, K. C. WONG, and N. I. NAQVI et al., 1998  Isolation and characterization of new fission yeast cytokinesis mutants. Genetics 149:1265-1275[Abstract/Free Full Text].

BARBET, N., W. J. MURIEL, and A. M. CARR, 1992  Versatile shuttle vectors and genomic libraries for use with Schizosaccharomyces pombe.. Gene 114:59-66[Medline].

BEZANILLA, M., S. L. FORSBURG, and T. D. POLLARD, 1997  Identification of a Second Myosin-II in Schizosaccharomyces pombe.. Mol. Biol. Cell 8:2693-2705[Abstract/Free Full Text].

CHANG, F., A. WOOLLARD, and P. NURSE, 1996  Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile actin ring. J. Cell Sci. 109:131-142[Abstract].

CHANG, F., D. DRUBIN, and P. NURSE, 1997  cdc12p, a protein required for cytokinesis in fission yeast, is a component of the cell division ring and interacts with profilin. J. Cell Biol. 137:169-182[Abstract/Free Full Text].

DEMETER, J. and S. SAZER, 1998  imp2, a new component of the actin ring in the fission yeast Schizosaccharomyces pombe.. J. Cell Biol. 143:415-427[Abstract/Free Full Text].

DRGONOVA, J., T. DRGON, K. TANAKA, R. KOLLAR, and G. C. CHEN et al., 1996  Rho1p, a yeast protein at the interface between cell polarization and morphogenesis. Science 272:277-279[Abstract].

ENG, K., N. I. NAQVI, K. C. WONG, and M. K. BALASUBRAMANIAN, 1998  Rng2p, a protein required for cytokinesis in fission yeast, is a component of the actomyosin ring and the spindle pole body. Curr. Biol. 8:611-621[Medline].

FANKHAUSER, C. and V. SIMANIS, 1994  The cdc7 protein kinase is a dosage dependent regulator of septum formation in fission yeast. EMBO J. 13:3011-3019[Medline].

FANKHAUSER, C., A. REYMOND, L. CERUTTI, S. UTZIG, and K. HOFMANN et al., 1995  The S. pombe cdc15 gene is a key element in the reorganization of F-actin at mitosis. Cell 82:435-444[Medline].

GARKAVTSEV, I. and T. MIZUKAMI, 1997  Integrated map of the Schizosaccharomyces pombe genome. Chromosoma 106:254-265[Medline].

GOULD, K. L. and V. SIMANIS, 1997  The control of septum formation in fission yeast. Genes Dev. 11:2939-2951[Free Full Text].

HOCHSTENBACH, F., F. M. KLIS, H. VAN DEN ENDE, E. VAN DONSELAAR, and P. J. PETERS et al., 1998  Identification of a putative alpha-glucan synthase essential for cell wall construction and morphogenesis in fission yeast. Proc. Natl. Acad. Sci. USA 95:9161-9166[Abstract/Free Full Text].

ISHIGURO, J. and W. KOBAYASHI, 1996  An actin point-mutation neighboring the `hydrophobic plug' causes defects in the maintenance of cell polarity and septum organization in the fission yeast Schizosaccharomyces pombe.. FEBS Lett. 392:237-241[Medline].

ISHIGURO, J., A. SAITOU, A. DURAN, and J. C. RIBAS, 1997  cps1+, a Schizosaccharomyces pombe gene homolog of Saccharomyces cerevisiae FKS genes whose mutation confers hypersensitivity to cyclosporin A and papulacandin B. J. Bacteriol. 179:7653-7662[Abstract/Free Full Text].

JOCHOVA, J., I. RUPES, and E. STREIBLOVA, 1991  F-actin contractile rings in protoplasts of the yeast Schizosaccharomyces.. Cell Biol. Int. Rep. 15:607-610[Medline].

JOHNSON, B., M. MIYATA and H. MIYATA, 1989 Morphogenesis of Fission Yeast. Academic Press, San Diego.

KATAYAMA, S., D. HIRATA, M. ARELLANO, P. PEREZ, and T. TODA, 1999  Fission yeast {alpha}-glucan synthase Mok1 requires the actin cytoskeleton to localize the sites of growth and plays an essential role in cell morphogenesis downstream of protein kinase C function. J. Cell Biol. 144:1173-1186[Abstract/Free Full Text].

KITAYAMA, C., A. SUGIMOTO, and M. YAMAMOTO, 1997  Type II myosin heavy chain encoded by the myo2 gene composes the contractile ring during cytokinesis in Schizosaccharomyces pombe.. J. Cell Biol. 137:1309-1319[Abstract/Free Full Text].

MARKS, J., I. M. HAGAN, and J. S. HYAMS, 1986  Growth polarity and cytokinesis in fission yeast: the role of the cytoskeleton. J. Cell Sci. Suppl. 5:229-241[Medline].

MAY, K. M., T. Z. WIN, and J. S. HYAMS, 1997  Type II myosin involved in cytokinesis in the fission yeast Schizosaccharomyces pombe.. Cell Motil. Cytoskeleton 38:385-396[Medline].

MCCOLLUM, D., M. K. BALASUBRAMANIAN, L. E. PELCHER, S. M. HEMMINGSEN, and K. L. GOULD, 1995  Schizosaccharomyces pombe cdc4+ gene encodes a novel EF-hand protein essential for cytokinesis. J. Cell Biol. 130:651-660[Abstract/Free Full Text].

MORENO, S., A. KLAR, and P. NURSE, 1991  Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.. Methods Enzymol. 194:795-823[Medline].

MORGAN, B. A., F. L. CONLON, M. MANZANARES, J. B. MILLAR, and N. KANUGA et al., 1996  Transposon tools for recombinant DNA manipulation: characterization of transcriptional regulators from yeast, Xenopus, and mouse. Proc. Natl. Acad. Sci. USA 93:2801-2806[Abstract/Free Full Text].

MOTEGI, F., K. NAKANO, C. KITAYAMA, M. YAMAMOTO, and I. MABUCHI, 1997  Identification of Myo3, a second type-II myosin heavy chain in the fission yeast Schizosaccharomyces pombe.. FEBS Lett. 420:161-166[Medline].

NAKANO, K., R. ARAI, and I. MABUCHI, 1997  The small GTP-binding protein Rho1 is a multifunctional protein that regulates actin localization, cell polarity, and septum formation in the fission yeast Schizosaccharomyces pombe.. Genes Cells 2:679-694[Abstract].

NAQVI, N. I., K. ENG, K. L. GOULD, and M. K. BALASUBRAMANIAN, 1999  Evidence for F-actin-dependent and -independent mechanisms involved in assembly and stability of the medial actomyosin ring in fission yeast. EMBO J. 18:854-862[Medline].

NURSE, P., P. THURIAUX, and K. NASMYTH, 1976  Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe.. Mol. Gen. Genet. 146:167-178[Medline].

PRENTICE, H. L., 1992  High efficiency transformation of Schizosaccharomyces pombe by electroporation. Nucleic Acids Res. 20:621[Free Full Text].

QADOTA, H., C. P. PYTHON, S. B. INOUE, M. ARISAWA, and Y. ANRAKU et al., 1996  Identification of yeast Rho1p GTPase as a regulatory subunit of 1,3-beta-glucan synthase. Science 272:279-281[Abstract].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHMIDT, S., M. SOHRMANN, K. HOFMANN, A. WOOLLARD, and V. SIMANIS, 1997  The Spg1p GTPase is an essential, dosage-dependent inducer of septum formation in Schizosaccharomyces pombe.. Genes Dev. 11:1519-1534[Abstract/Free Full Text].

SOHRMANN, M., C. FANKHAUSER, C. BRODBECK, and V. SIMANIS, 1996  The dmf1/mid1 gene is essential for correct positioning of the division septum in fission yeast. Genes Dev. 10:2707-2719[Abstract/Free Full Text].

SOHRMANN, M., S. SCHMIDT, I. HAGAN, and V. SIMANIS, 1998  Asymmetric segregation on spindle poles of the Schizosaccharomyces pombe septum-inducing protein kinase Cdc7p. Genes Dev. 12:84-94[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
JCBHome page
Y. Huang, H. Yan, and M. K. Balasubramanian
Assembly of normal actomyosin rings in the absence of Mid1p and cortical nodes in fission yeast
J. Cell Biol., December 15, 2008; 183(6): 979 - 988.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
T.-H. Loo and M. Balasubramanian
Schizosaccharomyces pombe Pak-related protein, Pak1p/Orb2p, phosphorylates myosin regulatory light chain to inhibit cytokinesis
J. Cell Biol., December 1, 2008; 183(5): 785 - 793.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
O. Hachet and V. Simanis
Mid1p/anillin and the septation initiation network orchestrate contractile ring assembly for cytokinesis
Genes & Dev., November 15, 2008; 22(22): 3205 - 3216.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
D. M. Clifford, B. A. Wolfe, R. H. Roberts-Galbraith, W. H. McDonald, J. R. Yates III, and K. L. Gould
The Clp1/Cdc14 phosphatase contributes to the robustness of cytokinesis by association with anillin-related Mid1
J. Cell Biol., April 3, 2008; 181(1): 79 - 88.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Dischinger, A. Krapp, L. Xie, J. R. Paulson, and V. Simanis
Chemical genetic analysis of the regulatory role of Cdc2p in the S. pombe septation initiation network
J. Cell Sci., March 15, 2008; 121(6): 843 - 853.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
V. Wachtler, Y. Huang, J. Karagiannis, and M. K. Balasubramanian
Cell Cycle-dependent Roles for the FCH-Domain Protein Cdc15p in Formation of the Actomyosin Ring in Schizosaccharomyces pombe
Mol. Biol. Cell, July 1, 2006; 17(7): 3254 - 3266.
[Abstract] [Full Text] [PDF]