Functional Overlap Between the mec-8 Gene and Five sym Genes in Caenorhabditis elegans

Corresponding author: Robert K. Herman, Department of Genetics and Cell Biology, University of Minnesota, 250 BioScience Ctr., 1445 Gortner Ave., St. Paul, MN 55108., bob-h{at}tc.umn.edu (E-mail)

Communicating editor: I. GREENWALD

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Earlier work showed that the Caenorhabditis elegans gene mec-8 encodes a regulator of alternative RNA splicing and that mec-8 null mutants have defects in sensory neurons and body muscle attachment but are generally viable and fertile. We have used a genetic screen to identify five mutations in four genes, sym-1–sym-4, that are synthetically lethal with mec-8 loss-of-function mutations. The phenotypes of sym single mutants are essentially wild type. mec-8; sym-1 embryos arrest during embryonic elongation and exhibit defects in the attachment of body muscle to extracellular cuticle. sym-1 can encode a protein containing a signal sequence and 15 contiguous leucine-rich repeats. A fusion of sym-1 and the gene for green fluorescent protein rescued the synthetic lethality of mec-8; sym-1 mutants; the fusion protein was secreted from the apical hypodermal surface of the embryo. We propose that SYM-1 helps to attach body muscle to the extracellular cuticle and that another gene that is dependent upon mec-8 for pre-mRNA processing overlaps functionally with sym-1. RNA-mediated interference experiments indicated that a close relative of sym-1 functionally overlaps both sym-1 and mec-8 in affecting muscle attachment. sym-2, sym-3, and sym-4 appear to provide additional functions that are essential in the absence of mec-8(+).

THE phenotype associated with null mutations of many Caenorhabditis elegans genes appears to be nearly wild type. It has been estimated that only 20–35% of all C. elegans genes are mutable to an obvious visible phenotype or to a lethal or sterile phenotype (JOHNSON and BAILLIE 1997 ; WATERSTON et al. 1997 ; C. ELEGANS SEQUENCING CONSORTIUM 1998; HODGKIN and HERMAN 1998 ). This estimate is based on an estimate of the total number of genes mutable to visible, lethal, or sterile phenotypes and an estimate of the total number of genes in the genome, derived from the C. elegans genome sequencing project. Earlier work indicated that the reversion of dominant gain-of-function mutations by what seemed to be intragenic knockout mutations often (4 out of 10 genes examined) resulted in a wild-type phenotype (PARK and HORVITZ 1986 ), and examples in which gene knockouts generated by reverse genetics cause no obvious phenotypic change are now accumulating (e.g., HARFE and FIRE 1998 ). The many genes with nearly silent null alleles may contribute in subtle but significant ways to the fitness of the worm in nature, perhaps under particular environmental conditions, but the mild effects of knockout mutations make it difficult to study the specific roles of these genes.

At least some genes with subtle effects appear to contribute redundantly to visible or essential functions (THOMAS 1993 ; COOKE et al. 1997 ). Redundancy is apparent when the simultaneous inactivation of two genes results in a strong phenotype that is not seen with either single gene knockout. Complete gene redundancy, in which two genes perform exactly the same role and either gene can be inactivated with no loss of fitness, may be rare (BROOKFIELD 1997 ), but partial gene redundancy seems to be common. Possible selective advantages of gene redundancy have been discussed (THOMAS 1993 ; COOKE et al. 1997 ); one idea, for example, is that partially redundant genes may together increase the fidelity of a biological process. Whatever the benefit of redundancy for the organism, there are obvious benefits to the researcher in studying redundant genes in appropriate double (or multiple) mutants.

Genes with functional overlaps have been identified in C. elegans. In one case, a new mutant was found to harbor two gene mutations, both of which were required to produce the mutant phenotype (FERGUSON and HORVITZ 1985 ). In a more directed approach, mutations affecting two members of a gene family were combined and found to cause a novel mutant phenotype (CULOTTI et al. 1981 ; JOHNSON et al. 1988 ; LAMBIE and KIMBLE 1991 ). In a third approach, mutations were sought that gave a phenotype only when a particular gene was also mutant (FERGUSON and HORVITZ 1989 ). In this paper, we describe an application of the latter approach, which was modeled after a scheme in yeast (BENDER and PRINGLE 1991 ) for identifying synthetic lethal mutations.

We chose to look for mutations that are synthetically lethal with a mec-8 loss-of-function mutation. The mec-8 gene encodes a protein that contains two RNA recognition motifs (RRMs), characteristic of RNA-binding proteins (LUNDQUIST et al. 1996 ). Synthetic lethality involving mec-8 and the unc-52 gene was studied previously (LUNDQUIST and HERMAN 1994 ). unc-52 encodes a family of basement membrane proteins homologous to perlecan (ROGALSKI et al. 1993 ). Null alleles of unc-52 are by themselves embryonic lethal (ROGALSKI et al. 1993 ; HRESKO et al. 1994 ; WILLIAMS and WATERSTON 1994 ), but viable unc-52 alleles have also been studied. Viable unc-52 mutants exhibit normal embryogenesis but suffer from a progressive disruption of body wall muscle during later larval development (GILCHRIST and MOERMAN 1992 ). The combination of a viable unc-52 allele with a loss-of-function mec-8 mutation results in a synthetic lethal phenotype very similar to the phenotype conferred by an unc-52 null mutation (LUNDQUIST and HERMAN 1994 ). The unc-52 viable mutations affect subsets of the unc-52-encoded isoforms generated by alternative RNA splicing (ROGALSKI et al. 1995 ). The accumulation of certain alternatively spliced products lacking the exons affected by unc-52 viable mutations is dependent on mec-8(+) function (LUNDQUIST et al. 1996 ). It was therefore proposed that the UNC-52 isoforms dependent on mec-8 and the UNC-52 isoforms affected by unc-52 viable mutations provide an overlapping function: the absence of either has little effect on embryogenesis, but the absence of both leads to embryonic arrest.

Mutation in mec-8 confers other mutant phenes, including defects in mechanosensation (CHALFIE and SULSTON 1981 ; CHALFIE and AU 1989 ) and chemosensation (PERKINS et al. 1986 ), which appear to be unrelated to unc-52 function (LUNDQUIST et al. 1996 ). It was therefore proposed that MEC-8 affects the processing of transcripts of additional genes. A synthetic lethal screen might identify other essential gene targets of mec-8-dependent RNA processing. With the example of unc-52 as a guide, however, we would expect that only a special allele of such a target would be synthetically lethal with mec-8. The synthetic lethal mutation would have to be in an essential gene, yet viable on its own, and it would affect a subset of isoforms that are not mec-8-dependent but that overlap in function with the mec-8-dependent isoforms. Such mutations may be rare. On the other hand, we can envision at least two other classes of mutation that might occur readily and be synthetically lethal with a mec-8 mutation. One would be in a gene that overlaps mec-8 function more directly, by encoding another RNA splicing factor that can work on the same essential target as MEC-8; in this case, both splicing factors would have to be inactivated by mutation to generate a lethal phenotype. Another hypothesized class of mutation that would be synthetically lethal with mec-8 would be a loss-of-function mutation in a gene that provides an essential function redundantly with a gene that depends on MEC-8 for proper RNA processing. With these considerations in mind, we embarked on a screen for synthetic lethal mutations with mec-8 hoping to expand the network of genes that are known to interact with mec-8.

Our screen was successful: we identified five independent mutations in four genes that by themselves confer an essentially wild-type phenotype but that are lethal when combined with a mec-8 loss-of-function mutation. We have cloned one of the genes, sym-1, and characterized its pattern of expression. It reveals a new essential embryonic function that is involved in attachment of body wall muscle to the extracellular cuticle. We suggest that this function is provided redundantly by sym-1 and a gene whose transcripts are processed by MEC-8. Next to sym-1 on the X chromosome is a related gene. RNA-mediated interference experiments (GUO and KEMPHUES 1995 ; FIRE et al. 1998 ) indicate that the sym-1 relative, which we call sym-5, functionally overlaps both mec-8 and sym-1. The other three sym genes—sym-2, sym-3, and sym-4—appear to provide three additional functions that overlap with mec-8-dependent functions.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

General genetic methods, genes, and alleles:
Growth media and culture and mating techniques were as described by BRENNER 1974 and SULSTON and HODGKIN 1988 . Nematode strains were grown and mated at 20° unless otherwise noted. Nomenclature is standard (HORVITZ et al. 1979 ). All strains were derived from the wild-type stock N2. Previously identified genes and mutations used in this work were the following (HODGKIN 1997 ):

LG (linkage group) I: mec-8(e398, mn450, mn455, mn459, mn462, mn463, mn464, mn465, mn472, rh170, u74, u218, u303, u314, u391, u456).

LGII: dpy-10(e128), rol-6(su1006)—referred to as rol-6(d) because it confers a Rol phenotype dominantly, rol-6(e187)—confers a recessive Rol phenotype, mel-11(it26), unc-4(e120), sqt-1(sc13), unc-52(e444, e669).

LGIII: ncl-1(e1865), unc-36(e251).

LGV: him-5(e1490).

LGX: lon-2(e678), dpy-8(e130), mec-2(e75), unc-6(e78), unc-9(e101), unc-3(e151), unc-7(e139).

We also used the crossover suppressor mnC1(II), the duplication mnDp1(X;V) and the X-linked deficiencies mnDf1, mnDf2, mnDf11, and mnDf19. New mutations characterized below are sym-1(mn601) X, sym-2(mn617) II, sym-3(mn618) X, sym-4(mn619) X and sym-4(mn620) X. In this article, mec-8 and rol-6 without allele designations refer to mec-8(u74) and rol-6(e187), respectively. Two mec-8 mutant phenes, an insensitivity to touch (Mec) and a defect in the filling of amphid and phasmid neurons with fluorescent dye (Dyf), were monitored as described previously (HEDGECOCK et al. 1985 ; LUNDQUIST and HERMAN 1994 ).

The transgenic array mnEx2 was made by injecting mec-8 animals with an 8.5-kb XhoI genomic DNA restriction fragment containing mec-8(+) (LUNDQUIST et al. 1996 ) and the plasmid pRF4 (MELLO et al. 1991 ), which carries rol-6(d). Animals carrying mnEx2 are rescued for the mec-8 mutant phenes and generally roll. mnEx52 was made by injecting mec-8; ncl-1 unc-36 hermaphrodites with the ncl-1(+)-containing cosmid C33C3, the unc-36(+)-containing genomic clone R1p16 and the same mec-8(+)-containing fragment that was used for mnEx2. mnEx52 rescues all the mutant phenotypes conferred by mec-8, ncl-1, and unc-36.

Screen for mutations synthetically lethal with mec-8(u74):
mec-8 I; ncl-1 unc-36 III; mnEx52{mec-8(+) ncl-1(+) unc-36(+)] hermaphrodites were exposed to 50 mM ethyl methanesulfonate (EMS) for 4 hr (BRENNER 1974 ; SULSTON and HODGKIN 1988 ). (The ncl-1 genotype is irrelevant in this work and is hereafter ignored.) Mutagenized parents and their F₁ and F₂ self-progeny were picked to separate small (35-mm-diameter) plates. Self-progeny broods produced by F₂ hermaphrodites were inspected for the absence of viable Unc-36 animals, the expected consequence of a mutation that is lethal in the absence of mnEx52 (Figure 1). A total of 1750 F₁ animals were picked. One or two fertile progeny of each F₁ were scored, and we estimate that the average probability of identifying a homozygous mutant segregant of an F₁ heterozygote was ~0.4. We thus estimate that we screened the equivalent of ~1400 haploid genomes (assuming that mutations could have arisen in either the sperm or ovum lines).

View larger version (24K): In this window In a new window Download PPT slide   Figure 1. Outline of screen for mutations that are synthetically lethal with a mec-8 mutation. The extrachromosomal array mnEx52, which carries mec-8(+) and unc-36(+), is transmitted to 50% of the self-progeny of a hermaphrodite carrying the array. Progeny that do not receive the array are Mec Unc. The viability of mutants homozygous for a mutation that is synthetically lethal with mec-8, denoted sym, will depend on the presence of mnEx52; i.e., progeny that do not inherit mnEx52 will be inviable. Candidate sym mutants are recognized by the absence of viable Unc-36 self-progeny.

Candidate mutants with average brood sizes of less than ~20 were discarded. To eliminate the possibility that mnEx52 had become chromosomally integrated and homozygous, candidate mutants were mated with unc-36/+ males, and Unc-36 cross-progeny were identified. Next, we tried to replace mnEx52 in each candidate line with the extrachromosomal array mnEx2[mec-8(+) rol-6(d)]. Hermaphrodites of putative genotype mec-8; unc-36; sym; mnEx52 were mated with mec-8/+; mnEx2 males. Roller hermaphrodite progeny were picked, and animals homozygous for mec-8 and lacking mnEx52 were identified from their self-progeny. Rol (or Rol Unc) self-progeny were picked in an attempt to generate mec-8; sym; mnEx2 (or mec-8; unc-36; sym; mnEx2) strains, which were recognized by the absence of non-Rol self-progeny, owing to the synthetic lethality of mec-8 and sym. We succeeded in establishing mec-8; sym; mnEx2 lines for five independent mutants. For eight additional sym candidates, we failed to generate sym-bearing stocks from animals carrying mnEx2; the reasons for the failures were not explored, and these candidates were discarded. In practice, the rol-6(d) mutation in mnEx2 is not 100% penetrant, but when non-Rol progeny from each of our five independent mec-8; sym; mnEx2 stocks were picked, they invariably segregated Rol progeny, indicating that mnEx2 had in fact been present.

Genetic mapping of sym-1 by scoring male cross-progeny:
mec-8; unc-36; sym-1; mnEx2 hermaphrodites were mated with N2 males. Wild-type male progeny were picked and mated with mec-8; dpy-8 unc-3 hermaphrodites. Mec non-Dpy non-Unc hermaphrodite progeny were picked. Recombination in the mec-8; dpy-8 unc-3/sym-1 hermaphrodites was measured by mating them with mec-8; him-5 males, transferring the parents daily and scoring the viable male progeny with respect to the Dpy and Unc phenotypes. Among 1907 male progeny, 1471 were Dpy Unc, 416 were Unc, 19 were Dpy, and 1 was wild type. These data yield a dpy-8-unc-3 distance of 22.8 map units, which is in good agreement with earlier measurements (BRENNER 1974 ), and they place sym-1 1.0 map unit left of unc-3. Although they are also X-linked, the sym-3 and sym-4 mutations could not be mapped by this method because mec-8; sym progeny of mec-8; sym/+ hermaphrodites are viable (but exhibit a maternal effect lethal phenotype).

Genetic mapping of sym mutations by scoring hermaphrodite self-progeny:
Hermaphrodites of genotype mec-8; sym/a (or mec-8; sym/+; a/+), where a represents a visible recessive marker, were generated. Non-A-hermaphrodite self-progeny were picked to separate plates, and their self-progeny broods were scored for the presence of A animals. The proportion of fertile animals that segregated only wild-type (no A) progeny, R, was measured. Assuming that sym is recessive lethal in the mec-8 background, the frequency of recombination p between sym and a was derived from R as follows: p = {1 - [1 - 2(R + 1)R]^1/2}/(R + 1). For no linkage, R = ¹/₃ and p = ¹/₂. For very small R, p = R. This approach was used to assign sym-2 to linkage group II and to obtain two-factor map distances for all five sym mutations. Two-factor data are presented in Table 1. In an extension of this approach, mec-8; sym/a b hermaphrodites were used; two-factor distances from sym to a and sym to b were derived as above, but three-factor ordering was also straightforward; e.g., a brood that contained A but no B segregants was assumed to have been initiated by a mec-8; sym/a sym(+) b(+) recombinant. We also selected A non-B or B non-A recombinants from mec-8; sym/a b hermaphrodites and determined by progeny testing whether or not the recombinant chromosome carried the sym mutation. The results from the two methods were in agreement.

Stock constructions and complementation tests:
We showed that the duplication mnDp1(X/V), which carries unc-3(+) and unc-7(+) (HERMAN et al. 1976 ), also carries sym-1(+). A putative sym-1 unc-7 stock was derived from an Unc-7 non-Unc-3 recombinant segregating from a sym-1/unc-3 unc-7 hermaphrodite. Hermaphrodites from the sym-1 unc-7 stock were mated with mec-8/+; mnDp1/+; unc-3 unc-7/0 males. We identified mec-8/+; mnDp1/+; sym-1 unc-7/unc-3 unc-7 progeny, which ultimately yielded the balanced stock mec-8; mnDp1/+; sym-1 unc-7. The mnDp1 homozygotes are slow growing and sterile (HERMAN et al. 1976 ), and the Unc-7 segregants are all inviable because of the synthetic lethality of mec-8 and sym-1 (unc-7 and mec-8 are not synthetic lethal). The presence of unc-7 in the stock was confirmed by mating with N2 males to give many Unc-7 male progeny. Thus mnDp1 complements the mec-8; sym-1 synthetic lethality. Complementation tests between sym-1 and four deficiences that are deleted for the unc-7 gene and balanced by mnDp1 (MENEELY and HERMAN 1979 ) were conducted as follows: each mnDp1/+; Df stock was mated with N2 males, and the male progeny, mnDp1/+; Df/0, were mated with mec-8; mnDp1/+; sym-1 unc-7 hermaphrodites. Unc-7 hermaphrodite progeny (mec-8/+; mnDf/sym-1 unc-7) were picked, and their self-progeny were inspected for Mec (touch-insensitive) animals. We found Mec segregants in the cases of mnDf2 and mnDf11, but not mnDf1 and mnDf19. Although mnDf1 and mnDf19 failed to complement sym-1 for synthetic lethality with mec-8, in each case, mec-8/+; sym-1/Df animals were viable and fertile.

Mutations in mel-11 and sym-2 were shown to complement as follows. A sym-2 unc-4 stock, derived from an Unc non-Dpy recombinant progeny of a mec-8; dpy-10 unc-4/sym-2 hermaphrodite, was used to construct a mec-8; sym-2 unc-4/mnC1 dpy-10 unc-52 stock. (The first step in the construction involved mating sym-2 unc-4/+ + males with mec-8; unc-4/mnC1 dpy-10 unc-52 hermaphrodites; subsequent steps were straightforward.) This stock fails to segregate Dpy Unc-52 progeny because unc-52(e444) is synthetically lethal with mec-8 (LUNDQUIST and HERMAN 1994 ) and segregates very few Unc-4 progeny because of the synthetic lethality of sym-2 and mec-8. Male progeny of a cross between N2 males and mel-11 unc-4 sqt-1/mnC1 dpy-10 unc-52 hermaphrodites were crossed to mec-8; sym-2 unc-4/mnC1 dpy-10 unc-52 hermaphrodites. Unc-4 hermaphrodite progeny (mec-8/+; sym-2 unc-4/mel-11 unc-4 sqt-1) were readily identified. These animals were fertile, showing that sym-2 and mel-11 complement with respect to the maternal effect lethality conferred by mel-11, and they segregated many Mec non-Sqt self-progeny, showing that sym-2 and mel-11 complement with respect to synthetic lethality with mec-8.

Mutations in mec-2 and sym-3 were shown to complement with mec-8 with respect to synthetic lethality as follows. Non-Dpy non-Unc male progeny of a cross between N2 males and mec-8; sym-3/dpy-8 unc-6 hermaphrodites were mated with mec-8; lon-2 mec-2 hermaphrodites. The progeny of genotype mec-8; sym-3/lon-2 mec-2 were readily identified and found to be fertile.

Allelism between sym-4(mn619) and sym-4(mn620) was demonstrated as follows: sym-4/0 males for each allele were mated to mec-8; sym-4; mnEx2 hermaphrodites carrying the other allele. Hermaphrodites of genotype mec-8/+; mn619/mn620 were identified. None was able to segregate viable Mec self-progeny. Analogous crosses showed that sym-1 complemented both sym-4(mn619) and sym-4(mn620).

By the approaches described for sym-1, we made sym-4(mn619) unc-7 and sym-4(mn620) unc-7 stocks and, from these, corresponding mec-8; mnDp1/+; sym-4 unc-7 stocks. The latter segregated Unc-7 self-progeny that laid eggs that either failed to hatch or hatched to give arrested young larvae. We conclude that mnDp1 carries sym-4(+), the expression of which renders mec-8; sym-4 maternal-effect lethal. The mec-8; mnDp1/+; sym-4(mn619) stock was used, following the procedure already described for sym-1, to show that sym-4(mn619) complements mnDf19 with respect to synthetic lethality with mec-8.

Ascertaining synthetic lethality of sym mutations with other mec-8 alleles, unc-52(e669), and each other:
Most of these tests made use of stocks carrying a recessive visible marker near the sym mutation and can be illustrated as follows: mec-8(mn450)/+ males were crossed to sym-1 unc-7 hermaphrodites; mec-8/+; sym-1 unc-7/+ progeny were identified by virtue of their ability to segregate Mec progeny. Thirty Mec segregants were picked. None segregated one-quarter Unc-7 self-progeny, which indicates that mec-8(mn450) and sym-1 are synthetic lethal. Some plates segregated rare (~1%) Unc-7 animals, which were found to be fertile, showing that they carried a sym-1(+) unc-7 recombinant chromosome and that unc-7 is not synthetically lethal with mec-8(mn450). Analogous tests for the other sym genes made use of the following stocks: sym-2 unc-4, lon-2 sym-3, sym-4(mn619) unc-7, and sym-4(mn620) unc-7. For the sym-3 tests, we identified, by virtue of their Mec Lon phenotype, mec-8; lon-2 sym-3 segregants, which gave arrested self-progeny. The sym-4 tests were done similarly. To test for interaction between sym-1 and sym-2, hermaphrodites of genotype sym-2 unc-4/+; sym-1 unc-7/+ were generated. Twenty Unc-7 segregants were picked; 13 segregated about one-quarter viable Unc-4 self-progeny, which indicates that sym-1 and sym-2 are not synthetic lethal. Other sym sym double-mutant combinations were tested similarly.

Isolation of sym mutations away from mec-8(u74) and outcrossing:
Our general approach can be illustrated as follows: mec-8/+; sym-1/0 males were crossed to unc-3 hermaphrodites. Wild-type hermaphrodite progeny were picked. Among their progeny, hermaphrodites that segregated no Unc progeny were selected as putative sym-1 homozygotes. These were mated to N2 males to generate putative sym-1/0 male progeny, which were crossed again to unc-3 hermaphrodites. The final putative sym-1 line, outcrossed six times, was confirmed as sym-1 by crossing putative sym-1/0 males to mec-8; unc-3 hermaphrodites and picking wild-type hermaphrodite progeny, genotype mec-8/+; sym-1/unc-3; among 60 Mec non-Unc self-progeny of these animals, all segregated one-third Unc-3 progeny. Homozygous sym-4(mn619) and sym-4(mn620) stocks, each outcrossed four times, were generated by the same procedure. A sym-3 stock, outcrossed five times, was similarly constructed using dpy-8 unc-6 in trans to sym-3. A similar approach, making use of the visible marker unc-4, was used to generate a sym-2 stock outcrossed four times. Homozygous (and fertile) sym-2 II males were generated by heat shock (SULSTON and HODGKIN 1988 ).

Measuring viable brood sizes, egg-hatching frequencies, and rates of development:
Viable brood sizes were measured by transferring hermaphrodites individually to fresh plates daily for 4 days, starting at the L4 stage, and counting viable progeny on each plate 3–4 days later. To measure egg-hatching frequencies, 10–15 egg-laying hermaphrodites were placed on a plate for 1–2 hr and then removed; eggs were immediately counted, and ~24 hr later, unhatched eggs and larvae were counted.

Phenotypic analysis:
Embryos were mounted on 4% agarose pads in sterile water under a sealed coverslip and inspected by differential interference contrast microscopy.

Immunohistochemistry:
Large-scale isolation and fixation of embryos were carried out according to the paraformaldehyde fixation procedure described by HRESKO et al. 1994 . Smaller numbers of embryos of a similar age were prepared by releasing embryos from dissected gravid adults in water and transferring them at the one- to four-cell stage to polylysine-subbed slides. A coverslip was mounted, and the embryos were incubated at 25°. When the embryos had reached the desired stage of elongation, the liquid was drawn out until the embryos were slightly squashed. The slides were frozen on dry ice for 5–10 min before the coverslip was removed with a razor blade, placed immediately in 100% methanol (-20°) for 5 min and acetone (-20°) for 5 min, and then air dried at room temperature.

Embryos that were prepared by either of the methods described above were treated the same for antibody localization. The embryos, either immobilized on a microscope slide or in a 1.5-ml tube, were incubated in a solution of PBS (150 mM NaCl, 10 mM sodium PO₄, pH 7.2), 1% BSA, 0.5% Tween-20 (Sigma, St. Louis) and left several hours at room temperature or overnight at 4°. The primary antibody was diluted in PBS, 0.5% Tween-20 and incubated with the embryos for either 2–4 hr at room temperature or overnight at 4°. The dilutions for the antibodies used were MH2, 1:500; MH4, 1:200; MH27, 1:200 (all provided by R. Waterston); and DM5.6, 1:1000 (provided by D. Miller). Embryos were washed three to four times in PBS, 0.5% Tween-20 for 10 min each time and then incubated with the secondary antibody [FITC-conjugated goat anti-mouse IgG, IgA, and IgM (Cappel)] diluted 1:200 in PBS, 0.5% Tween-20 for 2–3 hr at room temperature. Embryos were washed four more times, as before, and mounted under a coverslip in Vector Shield medium (Vector Laboratories, Burlingame, CA).

Molecular biology:
Standard molecular biology techniques (SAMBROOK et al. 1989 ) were used. All plasmid subcloning was done using pBluescript SK(-) (Stratagene, La Jolla, CA). DNA was sequenced by the dideoxy chain termination method (SANGER et al. 1977 ) using Sequenase Version 2.0 (United States Biochemical, Cleveland). Sequence analysis made use of the Genetics Computer Group (Madison, WI) sequence analysis package and the National Center for Biotechnology Information BLAST service (ALTSCHUL et al. 1997 ) cDNAs were isolated from a ZAP mixed-stage library provided by R. Barstead and R. Waterston.

Cloning of sym-1:
mec-8(u218ts); sym-1 animals were transformed with yeast artificial chromosomes (YACs) and cosmids containing C. elegans genomic DNA (provided by A. Coulson) from the region of the C. elegans physical map left of the known position of unc-3 (COULSON et al. 1995 ). Injected animals and Rol F₁ progeny were raised at 15°; F₂ Rol animals were shifted to 25° as larvae to test for rescue of the temperature-sensitive synthetic lethality among their progeny. YAC DNA was not purified away from the host yeast genomic DNA; instead, yeast genomic DNA from the yeast strain carrying the YAC was isolated from spheroplasts and purified by centrifugation in CsCl (STILES 1983 ). The mix of yeast genomic DNA and YAC DNA was coinjected at a concentration of 75–150 ng/µl with the dominant Rol marker carried by pRF4 (MELLO et al. 1991 ) at a concentration of 100 ng/µl. Cosmids were coinjected at a concentration of 20 ng/µl with pRF4 at 100 ng/µl. The YACs Y52C11, Y52F5, and Y39H3 and the overlapping cosmids C44H4 and T01F4 rescued the synthetic lethality. The nucleotide sequences of these cosmids have been determined by the C. elegans sequencing consortium (WATERSTON et al. 1997 ). Long PCR products were generated from purified C44H4 DNA templates using the Expand long template PCR system (Boehringer Mannheim, Indianapolis). The predicted open reading frames that the PCR products encompassed and the DNA oligonucleotide primers (5'–3') used were as follows:

• F1-R1: C44H4.1, C44H4.2, and C44H4.3 (CTGAATGGGTCAAGTGCTATGAGGG and ATGTTGCCGTAGTGGTCGACCATTAC)

• F2-R2: C44H4.3, C44H4.4, and C44H4.5 (CCAAGCACAAGGGAACAGTCTGTTG and AAAACCTCTATCTCGCCGTCCATCG)

• F3-R3: C44H4.5 and C44H4.6 (GCTCGTTTGATTTTCAACCACGAAGG and AAGAGATAGTGGCTGTACGGACGAGG).

Purified PCR product (20 ng/µl) was coinjected with pRF4 (50 ng/µl circular, 50 ng/µl SalI-digested linear). The PCR fragment F2-R2 was found to rescue. A subcloned 4.4-kb BamHI/PstI fragment, covering the predicted gene C44H4.3 (20 ng/µl), coinjected with pRF4 (100 ng/µl) was found to rescue the synthetic lethality of mec-8(u218); sym-1 animals.

A frameshift was introduced into the open reading frame of the C44H4.3 coding sequence by SphI digestion of the 4.4-kb BamHI/PstI fragment, removal of the single-stranded 3' overhang by T4 DNA polymerase, and self-ligation.

The region of the sym-1 gene from a sym-1(mn601)-bearing strain was amplified using PCR from purified genomic DNA with the forward primer for F2-R2 and the reverse primer for F1-R1 described above.

sym-1::gfp construct:
The tissue specificity of sym-1 expression was analyzed using a translational fusion of sym-1 with a green fluorescent protein (GFP) gene, gfp (CHALFIE et al. 1994 ). The 4.4-kb BamHI/PstI rescuing subclone in pBluescript SK(-) was used in the construction of sym-1::gfp, which consists of the gfp coding sequence in a translational fusion at the 3' end of the sym-1 coding sequence, immediately before the stop codon. An XbaI site was created at this position using PCR methods. A PCR-generated gfp-encoding fragment with XbaI sites at either end was cloned into the newly created XbaI. The sym-1::gpf construct was coinjected at a concentration of 2 ng/µl with pRF4 (100 ng/µl) into both N2 and mec-8(u218ts); sym-1 animals. The latter were raised at 15°; F₂ descendants carrying an extrachromosomal array were identified and moved to 25° to test for rescue of the synthetic lethality.

RNA-mediated interference:
Single-stranded RNA was synthesized from cDNA templates using MEGAscript in vitro transcription kits (Ambion, Austin, TX). T3 polymerase-transcribed and T7 polymerase-transcribed RNA strands were made separately and then combined and annealed at 65° for 20 min in injection buffer (MELLO and FIRE 1995 ). The double-stranded RNA was injected into the syncytial gonad of adult animals at a concentration of 0.5–0.7 µg/µl. When a combination of double-stranded RNAs was used, each was injected at a concentration in the range of 0.5–0.7 µg/µl. Injected animals were allowed to recover and lay eggs for 2–5 hr at 20° before being transferred to individual plates kept at 20°. The injected animals were transferred to new plates every 24 hr until they were no longer self-fertile. Progeny were assayed for viability 24 hr after the parent was removed.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Identification of mutations that are synthetically lethal with mec-8:
The extrachromosomal array mnEx52 carries mec-8(+) and unc-36(+) and is transmitted to 50% of the self-progeny of mec-8; unc-36; mnEx52 hermaphrodites. Animals lacking the array are Unc and Mec-8. Although the mechanosensory phene cannot be scored in an unc-36 background, the dye-filling defect conferred by mec-8 (PERKINS et al. 1986 ), called Dyf (LUNDQUIST and HERMAN 1994 ), is apparent. The array-bearing progeny are non-Unc and non-Dyf. Broods generated by the F₂ descendants of EMS-treated hermaphrodites were inspected for the absence of Unc animals, which would be the result of homozygosity for a recessive mutation that is synthetically lethal with mec-8, a class of mutation we refer to as sym (Figure 1).

We identified five independent sym mutations, each derived from a different mutagenized animal. We show below that the mutations are in four genes, sym-1–sym-4. The penetrances of the synthetic lethalities for all five mutations were >99%; i.e., the mec-8; unc-36; sym; mnEx52 hermaphrodites segregated <1% mid-to-late larval or adult Unc progeny (n > 500 for each mutation). All stocks segregated inviable embryos and, in the cases of sym-3 and sym-4, arrested young larvae. For each of the five mutants, we showed that the inability to segregate Unc progeny was not a consequence of homozygosity for a chromosomally integrated array and that mnEx52 could be replaced by a different mec-8(+)-bearing extrachromosomal array, mnEx2, which does not carry unc-36(+). For each mutant, the resultant mec-8; sym; mnEx2 line was dependent upon the presence of mnEx2 for viability (see MATERIALS AND METHODS). This proved that we were not dealing with mutations that are synthetically lethal with unc-36 or suppressors of unc-36 and that the apparent synthetic lethality is not dependent specifically on mnEx52 or mutant forms of mnEx52.

Mapping the sym mutations:
The five sym mutations were mapped genetically by mapping the recessive lethality conferred by each mutation in a homozygous mec-8 background; i.e., we monitored recombination in mec-8; sym +/+ a hermaphrodites between sym and a, where a refers to a recessive visible marker. Recombinants were usually identified among hermaphrodite self-progeny, but in the case of sym-1, we were able to score recombinant X chromosomes by mating mec-8; sym-1/dpy-8 unc-3 hermaphrodites with mec-8 males and scoring male cross progeny (see MATERIALS AND METHODS for details); the extreme rarity of non-Dpy non-Unc males indicated that the penetrance of the mec-8; sym-1/0 synthetic lethality is 100%. (The one wild-type male found among 1907 viable male progeny may well have arisen from a rare nondisjunctive nullo-X ovum.) Derived map positions for the five sym mutations are shown in Figure 2. During the course of the mapping experiments, we found that for sym-3 and both sym-4 alleles, mec-8; sym +/+ a hermaphrodites segregated some non-A self-progeny that segregated inviable eggs and arrested young larvae almost exclusively. We presumed that these animals were mec-8; sym double homozygotes and confirmed this point, as described below, by tagging the sym-bearing chromosomes with visible markers. This means that sym-3 and both sym-4 mutations, in combination with mec-8, behave at least partly as maternal-effect lethals when the hermaphrodite parent is mec-8; sym/+, but as zygotic lethals when the hermaphrodite parent is mec-8; sym; array[mec-8(+)].

View larger version (8K): In this window In a new window Download PPT slide   Figure 2. Genetic map positions of the sym genes and neighboring markers.

Complementation testing:
The mutations mn619 and mn620 (allele numbers were assigned after the gene assignments) mapped near one another and failed to complement (see MATERIALS AND METHODS); they were assigned to sym-4. Both complemented sym-1(mn601), which mapped near them. The different map positions of sym-1 and sym-4 were confirmed by complementation tests against mnDf19, which complemented sym-4 but not sym-1 (Figure 2). All three mutations were complemented by mnDp1(X;V). We found that sym-2 II complemented the closely linked mel-11 and that sym-3 X complemented the closely linked mec-2 (Figure 2).

Phenotypes conferred by sym mutations alone:
We isolated each sym mutation away from mec-8, outcrossed each mutation four to six times and confirmed that each outcrossed line retained a mutation mapping to the appropriate genetic region that was synthetically lethal with mec-8. The three criteria given in Table 2 were used to measure the effects of the sym mutations by themselves on development and reproduction. The striking result is that each mutation by itself results in a nearly wild-type phenotype. Brood sizes were in all cases somewhat less than wild type, but frequencies of egg hatching and development times were in each case close to the wild-type values. We also noted that >98% of larvae matured to adulthood. Finally, none of the mutants exhibited any of the following three phenes, which are conferred by mec-8 loss-of-function mutations (LUNDQUIST and HERMAN 1994 ): defect in response to light touch (Mec), defect in dye filling of amphid and phasmid neurons (Dyf), and incompletely penetrant, cold-sensitive embryonic and early larval arrest (30% arrest at 16° for the strongest mec-8 alleles).

All five sym mutations are synthetically lethal with different mec-8 alleles:
We characterized the molecular lesions associated with mec-8 mutations (Figure 3); 12 are GC-to-AT transitions, but five of these were probably reisolates of e398 because they were identified in a noncomplementation screen involving e398 and are identical to e398. In earlier genetic work, e398 seemed to behave as a slightly weaker allele than the others in this set (LUNDQUIST and HERMAN 1994 ); we speculate that the e398 stock may have acquired a suppressor mutation, but we have not pursued this point. The transition mutations u74 and mn459 were also identical, but they seem to be independent mutations. The temperature-sensitive allele u218 (CHALFIE and AU 1989 ) has a conservative alanine-to-threonine substitution in the second RRM, and the temperature-sensitive allele mn472 has the transposable element Tc1 inserted in the region between the two RRMs, which is rich in glutamine and alanine (Figure 3). Finally, rh170 and u456 are deletions of 100 and ~200 bp, respectively, and u391 is an uncharacterized rearrangement. We expect that mn450 and u314, which lead to early translational termination, are null, as was suggested from genetic criteria (LUNDQUIST and HERMAN 1994 ). The only alleles that are clearly not null are u218 and mn472, which are temperature sensitive with respect to both the Mec (CHALFIE and AU 1989 ) and Dyf (LUNDQUIST and HERMAN 1994 ) phenes.

View larger version (27K): In this window In a new window Download PPT slide   Figure 3. Summary of mec-8 mutations. (A) Boxes represent the four mec-8 exons. Hatched boxes represent the two RRMs, and the region denoted AQ has 41% alanine and glutamine residues. mn472 is an insertion of the transposable element Tc1 between base pairs 1526 and 1527 (numbered according to EMBL accession no. X95609). rh170 is a deletion that replaces base pairs 692–791 with GT. Two mec-8 mutations not shown in the figure are u456, a 200-bp deletion affecting exon 1, and u391, a complex rearrangement (LUNDQUIST et al. 1996 ). The mutations mn455 and mn462-mn465 described in LUNDQUIST and HERMAN 1994 are identical to e398 and most likely are reisolates of e398. (B) Alignment of the two mec-8 RRMs with an RRM consensus sequence (BIRNEY et al. 1993 ; LUNDQUIST et al. 1996 ) and the positions of mec-8 mutations within these RRM domains. u74 and mn459 result in an amino acid substitution at a highly conserved glycine residue. u218, a temperature-sensitive mutation, results in a conservative substitution of a conserved residue in the second RRM. The code for the consensus sequence is as follows: x, any amino acid; U, uncharged residues (L, I, V, A, G, F, W, Y, C, M); Z, U plus S and T.

All five sym mutations were synthetically lethal with the following mec-8 alleles: mn450, mn465 (or e398), rh170, u74, u303, u314, u391, and u456. Only two other mec-8 alleles were tested: u218ts and mn472ts, which were tested at 25°. sym-1, sym-3, and both sym-4 mutations were clearly synthetically lethal with both u218 and mn472 at 25°, but sym-2 was not obviously synthetically lethal with either, although we would not have detected moderate reductions in viability. This suggests that only sym-2 is rescued by a small amount of mec-8 function. The dye-filling assay has shown that neither u218 nor mn472 completely block mec-8 function at 25° (LUNDQUIST and HERMAN 1994 ).

We constructed a mec-8(u218ts); sym-1 strain, which was temperature sensitive for embryogenesis (Table 3). Neither sym-1 nor mec-8(u218) alone showed much inviability at either 16° or 25°. The mec-8(u218); sym-1 double mutant was maintained at 16°, although only 43% of eggs laid by the double mutant hatched, even at 16°. Essentially all hatched larvae matured and laid many eggs, even when shifted to 25° immediately after hatching, but <1% of the eggs they laid hatched at the higher temperature. Temperature-shift experiments indicated that the temperature-sensitive period corresponded to the first half of embryogenesis (data not shown).

The sym mutations do not interact with each other or with a viable unc-52 mutation:
Using a closely linked visible marker to tag each sym mutation (see MATERIALS AND METHODS), we generated all the possible sym sym double mutants except those involving the tightly linked genes sym-1 and sym-4. All seven double-mutant combinations tested (sym-1 sym-2, sym-1 sym-3, sym-2 sym-3, and each sym-4 mutation with sym-2 and sym-3) were clearly viable and fertile and yielded fertile self-progeny. Also in contrast to mec-8, all five sym mutations were viable and fertile with an unc-52 viable mutation, unc-52(e669).

Lethal phases of mec-8; sym progeny of mec-8; sym/+ hermaphrodites:
As noted in the section on mapping, 100% of the mec-8; sym-1/0 cross-progeny of mec-8; sym-1/+ parents were inviable. Similarly, the balanced stock mec-8 I; mnDp1[sym-1(+) unc-7(+)]/+ V; sym-1 unc-7 X gave no viable Unc-7 offspring, but instead yielded embryos that were arrested at the twofold stage of elongation (the unc-7 mutation did not affect the mec-1; sym-1 terminal phenotype; we observed the same embryonic arrest in a mec-8; mnDp1/+; sym-1 stock). The embryos appeared to develop normally until about the 1.5-fold stage of elongation. Wild-type embryos at this stage display muscle twitching, and shortly later, when they reach the twofold stage of elongation, wild-type embryos roll their bodies coordinately in the egg shell. In contrast, mec-8; sym-1 embryos showed muscle twitching but rarely or ever exhibited coordinated movement and did not elongate beyond the twofold stage, although other tissues such as the pharynx continued to develop normally. This phenotype has been described by WILLIAMS and WATERSTON 1994 as a mild Pat (paralyzed and arrested at the twofold stage of elongation) phenotype and is often found in mutants with defects in muscle function or structure.

The balanced stock mec-8 I; mnC1 dpy-10 unc-52/sym-2 unc-4 II segregated no Unc-52 (or Dpy or Dpy Unc-52) self-progeny because mec-8 and unc-52 are synthetic lethal with 100% penetrance (LUNDQUIST and HERMAN 1994 ; mnC1 suppresses crossing over in the dpy-10 unc-52 region), but six viable Unc-4 segregants were found among 1074 non-Unc siblings. This corresponds to a penetrance of 99% for the lethality of the mec-8; sym-2 unc-4 segregants, since the ratio of Unc-4 to non-Unc self-progeny of mec-8; mnC1 dpy-10 unc-52/unc-4 hermaphrodites was 0.50. The rare escapers grew to adulthood and produced many eggs that arrested at the twofold stage of embryonic elongation and about one escaper per escaper parent. About one-quarter of the eggs laid by mec-8; sym-2/rol-6 unc-4 hermaphrodites, presumably the mec-8; sym-2 embryos, arrested during embryogenesis at the twofold stage of elongation, with a mild Pat phenotype very similar to that described above for mec-8; sym-1.

Hermaphrodites of genotype mec-8 I; lon-2 sym-3/dpy-8 unc-6 X segregated one-quarter Lon self-progeny, which when picked, laid eggs that either failed to hatch or hatched to give arrested L1 progeny. The most prominent feature of the arrested larvae derives from an enlargement of the hypodermis around the buccal cavity, a bulbous nose phenotype. The maternal-effect lethality was not strict: mec-8; lon-2 sym-3 hermaphrodites yielded viable and fertile progeny when mated with N2 males, sym-3 males, or mec-8 males (although all progeny were hermaphrodites when mec-8 males were used, as expected because of the X linkage of sym-3). Thus, oocytes produced by mec-8; lon-2 sym-3 progeny of mec-8; lon-2 sym-3/+ parents can be rescued by either mec-8(+) or sym-3(+) sperm.

For both alleles of sym-4, we made balanced stocks of genotype mec-8 I; mnDp1/+ V; sym-4 unc-7 X, and in each case, viable Unc-7 segregants were generated at a frequency of ~60% the frequency of Unc-7 segregants from mec-8; mnDp1/+; unc-7 parents. The mec-8; sym-4 unc-7 animals laid eggs that either failed to hatch or hatched to give arrested L1 animals with bulbous noses. The two sym-4 alleles behaved identically in all respects and similarly to sym-3 in male mating tests; i.e., cross progeny were readily produced when mec-8; sym-4 unc-7 hermaphrodites were mated with N2 males, sym-4 males or mec-8 males (only hermaphrodite progeny were produced when mec-8 males were used).

As already noted, neither mec-8; sym-3; mnEx52[mec-8(+)] nor mec-8; sym-4; mnEx52[mec-8(+)] hermaphrodites gave adult mec-8; sym self-progeny. In addition, neither mec-8/+; lon-2 sym-3 nor mec-8/+; sym-4 unc-7 hermaphrodites segregated adult Mec self-progeny (data not shown).

mec-8; sym-1 arrested embryos have detached muscle quadrants:
mec-8(u218ts); sym-1 embryos fertilized and raised at 25° exhibited the mild Pat phenotype, which is also similar to the cold-sensitive, incompletely penetrant lethality conferred by strong mec-8 mutations; in mec-8 null mutant embryos (but not mec-8(u218ts) embryos) raised at 16°, body wall muscle was often found detached from the overlying hypodermis (LUNDQUIST and HERMAN 1994 ). To investigate the development and integrity of body muscle in the mec-8(u218ts); sym-1 embryos, we used the following monoclonal antibodies (Figure 4): DM5.6, which recognizes myosin heavy chain in body wall muscle (MILLER et al. 1983 ); MH4, which stains intermediate filaments in hemidesmosomes in the hypodermis adjacent to body wall muscle (FRANCIS and WATERSTON 1991 ); MH27, which stains the adherens junctions on the apical surface of the hypodermis (FRANCIS and WATERSTON 1991 ); and MH2, which recognizes UNC-52 (perlecan) in the basement membrane between the hypodermis and muscle (FRANCIS and WATERSTON 1991 ; ROGALSKI et al. 1993 ).

View larger version (125K): In this window In a new window Download PPT slide   Figure 4. Muscle detachment phenotype of mec-8(u218ts); sym-1 arrested embryos, as assayed by immunofluorescence antibody staining and confocal microscopy. (A, C, E, and G) Wild-type; (B, D, F, and H) mec-8(u218); sym-1(mn601). E and F show 1.5-fold embryos; A–D, G, and H show embryos of equivalent age, the wild-type embryos threefold in length and the mec-8; sym-1 embryos arrested at twofold. All embryos were raised at 25°. In addition to the antibodies described below, the embryos in B and D–H were stained with MH27 (FRANCIS and WATERSTON 1991 ), an antibody that recognizes an epitope in the adherens junctions and is useful for highlighting the boundaries of hypodermal cells. Embryos in A and B were stained with DM5.6 (MILLER et al. 1983 ), an antibody against body muscle myosin heavy chain; embryos in C and D were stained with MH2 (FRANCIS and WATERSTON 1991 ), which recognizes UNC-52 (ROGALSKI et al. 1993 ) present in the basement membrane between the hypodermis and muscle; embryos in E–H were stained with the antibody MH4 (FRANCIS and WATERSTON 1991 ), which recognizes intermediate filaments. (A) Confocal projection of a wild-type embryo showing the four longitudinal muscle strips, which are attached to the surrounding hypodermis. (B) Confocal projection of an arrested mec-8; sym-1 embryo showing three of the four muscle strips. The two outer strips are detached from the hypodermis, which is visible by MH27 staining. (C) Confocal projection of a wild-type embryo showing UNC-52 localization in the basement membrane between the muscle and hypodermis. (D) Confocal projection of a mec-8; sym-1 arrested embryo showing abnormal UNC-52 localization. UNC-52 localized to the basement membrane above one of the outer muscle strips is separated from the hypodermis. (E and G) Confocal projections of wild-type embryos showing intermediate filament structure in the hypodermis during elongation (E) and near the completion of elongation (G). The intermediate filaments are localized within the hypodermis above the muscle strips and become organized in a pattern that is perpendicular to the length of the muscle. (F and H) Confocal projections of mec-8; sym-1 embryos before and after arrest at the twofold stage. The intermediate filaments in the hypodermis become localized to the region above the muscle strips, but they do not organize into the fine perpendicular structure seen in a wild-type embryo. The strips of staining are often narrower than in wild type (exaggerated slightly by the difference in angles between the embryos in E and F). Most arrested mec-8; sym-1 embryos have a level of intermediate filament organization that is less structured than that seen in the embryo in H.

Before their developmental arrest at the twofold stage of embryonic elongation, mec-8(u218ts); sym-1 embryos reared at 25° showed correctly positioned muscle quadrants. After developmental arrest, however, muscle quadrants were often detached from the hypodermis (Figure 4). The myofilament lattice of the muscle appeared to be formed correctly, but the position of the muscle relative to the hypodermis was abnormal. UNC-52 was also often separated from the hypodermis, suggesting that at least some components of the basement membrane adjoin the unattached muscle quadrants. The force of contracting muscle is normally transmitted through the hypodermis to the external cuticle via the intermediate filament-containing hemidesmosomes on the inner surfaces of both the apical and basal hypodermal membranes (FRANCIS and WATERSTON 1991 ). The intermediate filaments, as assayed by the MH4 antibody, appeared to be organized in strips that were narrower than those found in wild-type embryos at the time in development when the mutant phenotype was first detectable and appeared disorganized after the animal had arrested its development. In sum, our immunofluorescence images support the view that muscle attachments to hypodermis and cuticle are abnormal in arrested mec-8; sym-1 embryos. Control immunofluorescence experiments with mec-8(u218ts) embryos and sym-1 embryos did not show abnormal muscle attachments.

Positional cloning of the sym-1 gene:
The temperature-sensitive lethality of mec-8(u218ts); sym-1 at 25° was rescued by transformation with YACs, cosmids, and PCR products from the region of the physical map just to the left of the known position of unc-3 (Figure 5). The ability to rescue by transformation was narrowed to a 4.4-kb BamHI/PstI fragment encompassing the Genefinder-predicted (EECKMAN and DURBIN 1995 ) gene C44H4.3. We confirmed that C44H4.3 is sym-1 by two methods. A frameshift was introduced at the SphI site of the 4.4-kb BamHI/PstI fragment. Translation of the frameshifted gene would result in a protein of only 33 amino acids. Transformation of mec-8(u218ts); sym-1 animals with this construct failed to rescue the synthetic lethality. The DNA sequence of a C44H4.3-containing fragment amplified by PCR from the mec-8(u218ts); sym-1(mn601) strain grown at 16° revealed a mutation (CAA-TAA) that changes the codon for a glutamine at amino acid position 275 to a premature stop codon.

View larger version (23K): In this window In a new window Download PPT slide   Figure 5. Positional cloning of sym-1. Physical map of the sym-1 genomic region from the X chromosome left of unc-3. Shown are genomic DNA-containing YACs and cosmids, as well as PCR-generated fragments and subcloned DNA fragments that were tested by DNA transformation for the ability to rescue the temperature-sensitive synthetic lethality of mec-8(u218); sym-1(mn601). The number of stable transformed lines that rescued the synthetic lethality for each tested fragment or combination of fragments is indicated on the right. Fragments shown in boldface type could rescue the lethality. sym-1 was localized to the overlap between the cosmids C44H4 and T01F4. C44H4 has been sequenced by the C. elegans sequencing consortium. The positions and orientations of five predicted genes on C44H4 are shown. The ability to rescue the synthetic lethality was localized to a 4.4-kb BamHI/PstI fragment that covers only the predicted gene C44H4.3. A frameshift introduced in the fragment destroyed its rescuing ability.

The putative SYM-1 protein contains an N-terminal signal sequence, 15 contiguous leucine-rich repeats and a domain rich in threonines and glutamines:
cDNAs from the region of the sym-1 gene were isolated using a long PCR product covering the predicted genes C44H4.3 (sym-1), C44H4.4, and C44H4.5 as a probe. cDNAs representing sym-1 were then identified using the 4.4-kb BamHI/PstI fragment, which is referred to above, as a probe. The sequences of two sym-1 cDNAs were compared to the genomic sequence and to the 5' and 3' sequences of eight other sym-1 cDNAs identified by Y. Kohara (cited by WATERSTON et al. 1997 ). The nucleotide sequences of all the sym-1 cDNAs examined were identical, except for differences of a few nucleotides in the transcription start sites and polyadenylation sites. Reverse transcription PCR experiments detected no evidence of trans splicing at the 5' end of the message. 5' RACE (FROHMAN 1990 ) experiments suggested multiple transcription start sites between positions 1 and 47 (Figure 6). Northern blots indicated that sym-1 produces an ~2.5-kb transcript and that its accumulation is unaffected by mec-8 mutation (data not shown).

View larger version (57K): In this window In a new window Download PPT slide   Figure 6. sym-1 cDNA sequence (EMBL accession no. AJ242473) and predicted gene product. (A) The nucleotide sequence of the 2.3-kb sym-1 cDNA and the predicted protein product. The sym-1 mRNA shows no evidence of trans splicing to a splice leader sequence; transcription begins between positions 1 and 47 in this sequence (corresponding to nucleotides 10,884 and 10,930 in the sequence of the cosmid C44H4 generated by the C. elegans sequencing project, EMBL accession no. Z79598). The arrows above the cDNA sequence mark the positions of the six sym-1 introns, which are 51, 48, 52, 45, 50, and 68 nucleotides in length, respectively. The putative polyadenylation signal is underlined. Below the cDNA sequence is the predicted amino acid sequence of SYM-1 (C44H4.3, EMBL protein accession no. 1515126). The italicized amino acids are the predicted N-terminal signal sequence. The positions of the 15 LRRs are marked with vertical lines. An asterisk marks the position of the mn601 mutation, which creates a premature translational stop codon at amino acid position 275 (TAA in place of CAA). (B) Structural domains of the predicted SYM-1 protein. The 17-amino-acid signal peptide is stippled. The 15 LRRs are hatched. The final third of the protein is rich in threonine (24%) and glutamic acid (20%).

The amino acid sequence of the putative SYM-1 protein is shown in Figure 6. SYM-1 appears to be a secreted protein, with a predicted N-terminal hydrophobic signal sequence and no predicted transmembrane domains. A large domain following the signal sequence contains 15 consecutive leucine-rich repeats (LRRs). LRRs are 24 amino acid residues long on average and consist of regularly spaced leucine residues (reviewed by KOBE and DEISENHOFER 1994 ; KAJAVA 1998 ). LRRs are present in proteins with diverse functions and are involved in protein-protein interactions. A C-terminal domain is rich in threonine and glutamic acid residues, which is reminiscent of a mucin-like domain (HILKENS et al. 1992 ), although there are no regularly spaced prolines characteristic of other mucin-like domains.

SYM-1::GFP is secreted apically by the hypodermis:
The 4.4-kb BamHI/PstI rescuing fragment was used to create a fusion of sym-1 and the gfp gene, which encodes GFP. The sym-1::gfp fusion construct has gfp placed in frame immediately before the stop codon of sym-1. Microinjection of the construct led to rescue of the mec-8(u218); sym-1 synthetic lethality. Transformants carrying sym-1::gfp (as an extrachromosomal array) showed GFP expression beginning at the time of elongation. The GFP was found predominantly outside the embryo, essentially bathing it (Figure 7). Embryos showed cytoplasmic localization of the GFP in hypodermal cells in addition to the extraembryonic localization. In larvae, GFP was detected in the cytoplasm and on the apical surface of all hypodermal cells. In regions of the hypodermis that were not adjacent to body wall muscle, GFP appeared in a punctate pattern. Where the hypodermis was adjacent to body wall muscle, GFP was apparent in circumferential rings that were probably coincident with the cuticular annuli, which are circumferential furrows in the cuticle. There was greater GFP fluorescence in the hypodermal regions that were not adjacent to muscle, but this may have been caused by the increased thickness of the hypodermis in such regions.

View larger version (102K): In this window In a new window Download PPT slide   Figure 7. sym-1::gfp gene expression studies. All images are of living animals. (A and B) Confocal optical sections, (C and E) GFP fluorescence micrographs, and (D and F) differential interference contrast (DIC) micrographs. Larval animals in C–F have twisted bodies resulting from the presence of the transformation marker rol-6(d). sym-1::gfp is expressed in all hypodermal cells throughout development, beginning before enclosure of the embryos by the hypodermis and continuing into young adulthood. (A–C) At all stages, SYM-1::GFP is present in the cytoplasm of hypodermal cells. (A and B) During embryogenesis, SYM-1::GFP builds up in the extraembryonic fluid surrounding the embryo, suggesting that it is secreted apically from the hypodermal cells. (C and E) During the larval stages, most of the SYM-1::GFP is in regions of the hypodermis that do not overlie the longitudinal muscle quadrants. (C) Mid-L4 larva. SYM-1::GFP expression is shown in the hypodermal seam cells and less strongly in the syncytial hyp7 cell. SYM-1::GFP is also expressed in the dorsal and ventral hypodermis (shown with an apical focal plane in E). (D) DIC micrograph of the same animal as in C at a similar plane of focus. (E) Mid-L3 larva. During larval stages, SYM-1::GFP is present in a punctate pattern on the apical surface of the hypodermal cells in the regions of the hypodermis that are not overlying the longitudinal muscle quadrants (compare GFP localization with same animal in F, where a muscle quadrant is visible). In the region where the hypodermis does overlie the muscle, faint circumferential stripes of SYM-1::GFP are visible on the apical surface of the hypodermis. (F) DIC micrograph of the same animal as in E at the same apical focal plane.

RNA-mediated interference experiments and a fifth sym gene:
The two genes immediately upstream of sym-1 are both predicted to encode LRR-containing proteins with high similarity to sym-1. The putative protein encoded by C44H4.2, the closest sym-1 neighbor, was more similar to SYM-1 than to any other protein or predicted protein found in database searches by BLAST analysis (ALTSCHUL et al. 1997 ). Comparisons of the LRR domains of the three adjacent genes are given in Figure 8. There are no significant similarities among the three predicted proteins outside the leucine-rich domains. We tested the possibility that one or the other of the two upstream genes functionally overlaps with sym-1 by using RNA-mediated interference (RNAi; GUO and KEMPHUES 1995 ; FIRE et al. 1998 ) to perturb their functions in wild-type, sym-1, and mec-8 backgrounds (Table 4). We found that injection of RNA specific for C44H4.2 led to 27% lethality in wild-type animals, but to nearly 100% lethality in both sym-1 and mec-8 animals. The observed synthetic lethality with sym-1 and mec-8 implies that C44H4.2, which we hereafter refer to as sym-5, has an essential role that partially overlaps that of sym-1 and mec-8 (or probably a gene whose expression is controlled by mec-8, see DISCUSSION). A Northern blot indicated that sym-5 produces an ~2.7-kb transcript, the accumulation of which is unaffected by mec-8 mutation (data not shown). Our experiments with C44H4.1, on the other hand, gave no evidence for a functional overlap between C44H4.1 and either sym-1 or mec-8. The sequence similarity between sym-1 and sym-5 (47% identical in nucleotide sequence across the 1074-bp region that codes for the LRRs) raised the possibility that RNAi with the sym-5 sequence might affect sym-1 expression; however, we found no effect on the apparent levels of expression of sym-1::gfp after RNAi with sym-5.

View larger version (96K): In this window In a new window Download PPT slide   Figure 8. Comparison of the LRR regions of the adjacent genes sym-1, C44H4.2 (sym-5), and C44H4.1. The predicted proteins for each gene have been aligned with respect to a consensus sequence for a typical LRR (KOBE and DEISENHOFER 1994 ; KAJAVA 1998 ). Amino acid identity between at least two of the three sequences or one sequence and the LRR consensus have been shaded in black. Amino acids that are similar have been shaded only at positions that are conserved in the LRR consensus. Within the region shown, amino acid identity between SYM-1 and C44H4.2 and C44H4.1 is 36 and 24%, respectively. C44H4.1 and C44H4.2 share 23% identity within the region shown.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Probably more sym genes remain to be discovered:
Our screen for mutations that are synthetically lethal with a mec-8 mutation yielded five mutations in four genes. Two calculations suggest that additional sym genes remain to be discovered. First, we screened the equivalent of ~1400 haploid genomes after an EMS treatment that has been estimated to mutate an average gene at a frequency of ~1 per 2000 haploid genomes (BRENNER 1974 ). Applying the Poisson distribution to a mutation frequency of 0.7 indicates that an average gene would have had a 50% chance of being missed in our screen. The second calculation makes use of the ratio of multiply mutant genes (one) to total genes identified by mutation (four), and it assumes a Poisson distribution of mutations per gene to estimate (MENEELY and HERMAN 1979 ) the number of unidentified genes, which in this case works out to be about five. Both these calculations are likely to underestimate the number of undiscovered genes because both assume Poisson distributions despite the fact that some genes are less mutable than others.

The sym mutations are loss-of-function mutations:
All five sym mutations are recessive and showed no allele specificity in their interactions with mec-8 mutations, most of which appear by genetic and molecular evidence to be null. We therefore suggest that the sym mutations are all loss-of-function mutations. Indeed, we have evidence suggesting that sym-1(mn601) is null. First, the phenotype of sym-1(mn601) over a noncomplementing deficiency seemed no stronger than that of a sym-1(mn601) homozygote, i.e., viable and fertile unless the animal was homozygous for mec-8. More telling, mn601 is a nonsense mutation only 40% of the way through the coding region.

Possible modes of synthetic lethality involving mec-8:
We shall assume that MEC-8 promotes the processing of the transcripts from several (perhaps many) genes. As already noted, one target gene is unc-52, the transcripts of which are alternatively spliced, with the accumulation of particular splice products requiring a functional mec-8 (LUNDQUIST et al. 1996 ). The genes mec-2 (M. HUANG and M. CHALFIE, personal communication) and mec-8 (E. LUNDQUIST, R. HERMAN and J. SHAW, unpublished results) may also be targets of MEC-8 control because Northern blots of RNA extracted from wild-type and mec-8 animals show clear differences when probed with sequences specific to these loci. Null alleles of unc-52, but not of mec-2 or mec-8, are lethal. No essential target is entirely dependent on mec-8 because mec-8 null mutations are not unconditionally lethal. The idea that mec-8 affects the processing of transcripts from several genes raises the interesting evolutionary question of how a single RNA-processing factor can acquire so many different functions. Part of the answer may be that the mechanisms of MEC-8's action on different transcripts need not be the same. It would obviously be useful to identify several targets of MEC-8 action and then to elucidate the molecular mechanisms by which MEC-8 affects the processing of the different transcripts.

We can imagine several modes by which an extragenic loss-of-function mutation could be synthetically lethal with a mec-8 loss-of-function mutation (Figure 9). The first possibility (gene A in Figure 9) is represen