Genetics, Vol. 152, 1501-1512, August 1999, Copyright © 1999
Genetic Control of Telomere Integrity in Schizosaccharomyces pombe: rad3+ and tel1+ Are Parts of Two Regulatory Networks Independent of the Downstream Protein Kinases chk1+ and cds1+
Akira Matsuuraa,
Taku Naitoa, and
Fuyuki Ishikawaa
a Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsuta, Midori-ku, Yokohama 226-8501, Japan
Corresponding author:
Akira Matsuura, Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsuta, Midori-ku, Yokohama 226-8501, Japan., amatsuur{at}bio.titech.ac.jp (E-mail)
Communicating editor: G. R. SMITH
 | ABSTRACT |
|---|
The Schizosaccharomyces pombe checkpoint gene named rad3+ encodes an ATM-homologous protein kinase that shares a highly conserved motif with proteins involved in DNA metabolism. Previous studies have shown that Rad3 fulfills its function via the regulation of the Chk1 and Cds1 protein kinases. Here we describe a novel role for Rad3 in the control of telomere integrity. Mutations in the rad3+ gene alleviated telomeric silencing and produced shortened lengths in the telomere repeat tracts. Genetic analysis revealed that the other checkpoint rad mutations rad1, rad17, and rad26 belong to the same phenotypic class with rad3 with regard to control of the telomere length. Of these mutations, rad3 and rad26 have a drastic effect on telomere shortening. tel1+, another ATM homologue in S. pombe, carries out its telomere maintenance function in parallel with the checkpoint rad genes. Furthermore, either a single or double disruption of cds1+ and chk1+ caused no obvious changes in the telomeric DNA structure. Our results demonstrate a novel role of the S. pombe ATM homologues that is independent of chk1+ and cds1+.
THE chromosomes of eukaryotic cells are linear, and the telomeres located at the chromosomal ends are essential for the maintenance of genome integrity (BLACKBURN and GREIDER 1995
). Structural analysis of the telomere showed the presence of a specific nucleoprotein complex composed of specific repeat sequences and binding proteins (FANG and CECH 1995
). It is believed that the major role of the telomere is to stabilize the chromosomal ends with its special structure and to maintain the appropriate spatial alignment of the chromosomes within the nucleus.
Cytogenetic studies of the telomeres of the giant polytene chromosomes of Drosophila melanogaster have been carried out in detail. In spite of the absence of any heterochromatic features as determined by cytological criteria, Drosophila telomeres can induce a variegated position effect on the expression of genes in their vicinity, similar to that of heterochromatic regions (PARDUE 1995
). This phenomenon, called the telomeric silencing or the telomere position effect, has also been observed in yeasts (GOTTSCHLING et al. 1990
; NIMMO et al. 1994
). It has been proposed that the telomere consists of a heterochromatin-like structure that involves the nucleation of multimeric protein complexes that spread into adjacent regions (HECHT et al. 1995
).
The telomeric DNA of most eukaryotes consists of tandem arrays of repeated sequences (HENDERSON 1995
). The strand running 5' to 3' toward the end of the chromosome is dG-dT rich and is synthesized de novo by telomerase, a specialized DNA polymerase (GREIDER 1995
). As conventional DNA polymerases are unable to synthesize the very end of the linear DNA, the telomerase serves as a compensator for the loss of the chromosomal ends caused by successive cell proliferation.
Genetic studies using Saccharomyces cerevisiae have determined the genes critical for telomere structure and function (ZAKIAN 1995
). Ever-shorter-telomere (EST) mutations, which cause progressive shortening of the telomere repeat tracts and result in senescence, led to the identification of genes responsible for telomere replication (LUNDBLAD and SZOSTAK 1989
; SINGER and GOTTSCHLING 1994
; LENDVAY et al. 1996
). These include EST2 and TLC1, which encode the catalytic subunit and the RNA template of the telomerase, respectively (SINGER and GOTTSCHLING 1994
; LINGNER et al. 1997
), and EST1 and CDC13/EST4, which encode proteins possessing telomere-specific, single-strand DNA-binding activities (LIN and ZAKIAN 1996
; NUGENT et al. 1996
; VIRTA-PEARLMAN et al. 1996
). CDC13 is also considered to contribute to telomere end protection, as loss of this protein leads to rapid degradation of the dC-rich strand (GARVIK et al. 1995
; NUGENT et al. 1996
). The double-strand portion of the telomeric repeat tracts is recognized by the sequence-specific DNA binding protein Rap1 (LONGTINE et al. 1989
; CONRAD et al. 1990
; reviewed by SHORE 1994
). Carboxy-terminal mutations of the Rap1 protein lead to massive elongation of the telomere repeat tracts and to the loss of telomeric silencing (SUSSEL and SHORE 1991
; KYRION et al. 1992
; LIU et al. 1994
). These observations provide a model for telomere length regulation, which involves the positive and negative feedback of telomerase activity by the telomere binding proteins (NUGENT and LUNDBLAD 1998
). Rap1 binding proteins, such as Rif1 (HARDY et al. 1992
), Rif2 (WOTTON and SHORE 1997
), and Sir3 and Sir4 (PALLADINO et al. 1993
; MORETTI et al. 1994
; HECHT et al. 1995
), are also crucial for telomere function. The latter two proteins play a structural role in establishing and maintaining transcriptional repression through the formation of a telomere-specific protein complex called a telosome (COCKELL et al. 1995
; HECHT et al. 1995
; WRIGHT and ZAKIAN 1995
; GOTTA et al. 1996
).
TEL1 was identified in another genetic study that searched for mutants with shortened telomeres (LUSTIG and PETES 1986
). Structural analysis demonstrated that the carboxy-terminal half of the TEL1 gene product shared a highly conserved motif that was originally found in lipid kinases and proteins that function in cell cycle checkpoints and/or DNA repair (GREENWELL et al. 1995
; MORROW et al. 1995
). The human ATM gene, which is responsible for the disease ataxia telangiectasia, also belongs to this family (SAVITSKY et al. 1995
). Intriguingly, cells lacking ATM show chromosomal abnormalities, such as telomere-telomere fusion and accelerated loss of telomere length (METCALFE et al. 1996
; SMILENOV et al. 1997
; VAZIRI et al. 1997
). Therefore, there is speculation that ATM homologues have an evolutionarily conserved role in the maintenance of the telomere structure.
The fission yeast Schizosaccharomyces pombe has two ATM-homologous genes called rad3+ and tel1+. rad3+ is one of the checkpoint rad genes, and its mutation leads to defects in the response to DNA damage and to a block in DNA replication (BENTLEY et al. 1996
). We recently identified tel1+ (NAITO et al. 1998
) and have shown that it is involved in the maintenance of telomere integrity, together with the rad3+ gene, because the rad3 tel1 double mutant tends to lose functional telomeres after successive cell divisions and maintains its genome by circularization of all the chromosomes (NAITO et al. 1998
). In this article, we describe genetic studies that revealed the functional relationship between the checkpoint rad genes and the tel1+ gene in the regulation of telomere integrity in S. pombe. Here we present evidence that the checkpoint rad genes are not only important for the maintenance of telomere integrity, but that rad3+ is essential in this respect. We have shown that the telomere function of the rad gene products does not involve the two Rad3-regulated protein kinases Cds1 and Chk1. We have also shown that tel1+ contributes to telomere maintenance in parallel with the checkpoint rad genes.
 | MATERIALS AND METHODS |
|---|
Strains, media, and transformation:
The fission yeast strains used in this study are listed in Table 1. Cells were grown in the rich medium YPD (KAISER et al. 1994
) or Edinburgh minimal medium (EMM; ALFA et al. 1993
) supplemented with amino acids as required. FOA medium is the same as EMM, but with the addition of 5-fluoroorotic acid (5-FOA) to a final concentration of 0.1% and uracil to 50 µg/ml. Transformation of yeast cells was performed using the lithium acetate method (ALFA et al. 1993
). Disruption of the target genes was confirmed either by Southern blot analysis or by polymerase chain reaction (PCR).
Plasmids:
The plasmids used in this study are listed in Table 2. To construct the rad3::ura4+ plasmid, a 2.8-kb fragment encompassing the middle region of rad3+ was amplified by PCR using the primers CTTACTACGTAGCATCCTAATTTGG and AAATAGCTTTACGATGTTGCCCTTGA, and the product was then cloned into pT7Blue (Novagen) to generate pAMP66. The 1.8-kb HindIII-HindIII fragment of the ura4+ gene from pTL101 was inserted into the HpaI site of pAMP66 to obtain pAMP70, which harbors a rad3::ura4+ insertion allele. The rad3::LEU2 allele was constructed as follows: pAMP118, a rad3+ plasmid on a Supercos cosmid vector, was isolated from our cosmid library by colony hybridization. SalI sites were added to the 5' and 3' ends of the rad3+ open reading frame (ORF) by the long and accurate polymerase chain reaction (LA-PCR) method (CHENG et al. 1994
), and the full-length ORF was inserted into the SalI site of pUC119 to generate pAMP127. The 2.2-kb SalI-XhoI fragment of LEU2 was inserted into the NdeI-EcoRV sites of pAMP127. The resultant plasmid possesses a rad3::LEU2 allele, in which two-thirds of the rad3+ ORF has been replaced with the LEU2 marker. To construct the rad1::LEU2 plasmid, a plasmid that could rescue the rad1-1 methyl methanesulfonate (MMS) supersensitivity was isolated from a S. pombe library cloned on a pALSK vector that had been constructed by Dr. A. Toh-e. The isolated plasmid pAMP128 was digested with HindIII and BglII, and the 1.7-kb fragment containing the rad1+ ORF was inserted into pBluescript KS+ to obtain pAMP203. The EcoT14I-EcoT14I fragment was replaced with the 2.2-kb SalI-XhoI fragment of LEU2 to construct pAMP208, which harbors a rad1::LEU2 allele. To construct the chk1::ura4+ plasmid pAMP115, the EcoT14I-EcoT14I fragment of chk1+ was replaced with the 1.8-kb HindIII-HindIII ura4+ fragment. The rad26::ura4+ disruption plasmid pAMP201 was constructed by cloning of a 2.8-kb rad26+ fragment amplified by PCR into a pT7Blue vector following insertion of the 1.8-kb ura4+ fragment into the HpaI site.
To construct the rad3+ overexpression plasmids pAMP129 and pAMP136, the SalI-SalI fragment of rad3+ from pAMP127 was inserted into pREP41 and pREP42 (BASI et al. 1993
), respectively. The tel1+ overexpression plasmid pHA7 was constructed by connecting pREP2 (MAUNDRELL 1993
) with the tel1+ ORF after producing a NdeI site at the 5' end by PCR.
Construction of pAMP122, which harbors the ade6+-ura4+-telomere repeat tracts, was performed as follows: First, a 1.0-kb EcoRI-EcoRI fragment of pNSU70 containing the S. pombe telomere and subtelomere repeat sequences was inserted into the EcoRI site of pUC119. Second, the ApaI-SmaI fragment of the resultant plasmid pAMP1 was replaced with the ura4+ fragment to obtain pAMP121. Finally, the HindIII-SpeI fragment of ade6+ was inserted into the HindIII-XbaI sites of pAMP121.
Southern hybridization:
Chromosomal DNA was isolated using the glass bead-phenol chloroform method (KAISER et al. 1994
). Genomic DNA was digested with EcoRI, separated on a 1.2 or 1.5% agarose gel in 1x TAE buffer, and transferred to a GeneScreen nylon membrane (New England Nuclear, Boston) according to the manufacturer's instructions. The 1.0-kb fragment containing the telomeric repeat sequences and subtelomeric repeats, which was derived from pNSU70 (a gift of Dr. N. Sugawara), was labeled by nick-translation and was used as a probe. Hybridization was carried out at 42° in 50% formamide, 5x SSPE (SAMBROOK et al. 1989
), 5x Denhardt's solution (SAMBROOK et al. 1989
), and 0.5% SDS containing 20 µg/ml of sheared nonhomologous DNA. Filters were washed at 60° with 0.1x SSPE-0.1% SDS, and visualized using a BAS2000 image analyzer (Fuji, Tokyo, Japan).
Quantitative assay of telomeric silencing:
Expression of the ura4+ gene from the telomere-adjacent locus was examined by serial dilution spot assays. Colonies from fresh plates, grown in YPD medium for at least 100 generations from a spore, were inoculated in 2 ml of EMM supplemented with adenine, leucine, and uracil, and were grown overnight at 30°. A 1:5 serial dilution of the cell cultures was prepared in sterilized water, and 3-µl aliquots of each dilution were spotted onto the plates.
 | RESULTS |
|---|
Telomeric silencing is alleviated by the rad3-136 mutation:
Genes located at the chromosomal end in S. pombe are known to be transcriptionally repressed by a mechanism called telomeric silencing or the telomere position effect (NIMMO et al. 1994
). To facilitate the monitoring of telomeric silencing in S. pombe, the chromosome III-derived minichromosome Ch. 16 (NIWA et al. 1989
) was truncated at the ade6+ locus by introduction of the telomeric repeats and the ura4+ marker. In this strain, the ade6+ and ura4+ genes are located adjacent to the chromosomal end (Figure 1A). Cells that have a lesion in the ade6 gene accumulate adenine precursors inside the cells and form red colonies in the presence of limited adenine. The ura4+ gene product is required for uracil biosynthesis and can convert the drug 5-fluoroorotic acid (5-FOA) into a toxic compound. Thus, only cells defective in ura4 can grow in media containing 5-FOA. Therefore, we could use two distinct assays to monitor the expression of telomere-adjacent gene expression: colony color and colony formation on 5-FOA plates.

View larger version (41K):
In this window
In a new window
Download PPT slide
|
Figure 1.
Alleviation of telomeric silencing by the rad3-136 mutation. (A) Structure of a ura4+-marked telomere. The arrows indicate the direction of transcription of ade6+ and ura4+. EcoRI and ApaI sites used in Southern blot analysis are shown. (BD) Quantitative assay of the telomeric silencing. Cells were grown in EMM medium supplemented with adenine, leucine, and uracil, and the cultures were serially diluted 1:5 with sterilized water, and 3-µl aliquots of each dilution were spotted onto an EMM-Ura or FOA plate. Photographs were taken after 3 days of incubation at 30°. In D, cells of each strain were grown to 1.52 x 107 cells/ml in EMM medium supplemented with uracil at 30°, plated on EMM-Ura or FOA plates, and incubated at 30° for 3 days. Data are means from three different cultures of each strain. (B) Upper row: a wild-type strain with a marked telomere (PM2-4C-aUT: rad3+ ade6+-ura4+::telomere). Lower row: a rad3 strain with a marked telomere (PM14-1B-aUT: rad3-136 ade6+-ura4+::telomere). (C) Upper two rows: PM14-1B-aUT with the control vector pREP41. Lower two rows: PM14-1B-aUT with the rad3+ plasmid pAMP129.
|
|
During the construction of radiation-sensitive mutants with this truncated minichromosome by genetic crossing, we found that the development of the colonies' color depends on the genetic background. Colonies of wild-type cells showed a variety of colors, ranging from red to pink, whereas cells with a rad3-136 mutation formed colonies that were almost white (data not shown). We therefore examined the effect of the rad3 mutation on growth in a 5-FOA medium. As shown in Figure 1B, the mutant grew poorly on 5-FOA compared to the wild-type cells. To quantify the effect, the plating efficiency of these strains was examined after growing in EMM supplemented with adenine, uracil, and leucine (Figure 1D). In a medium lacking uracil, the rad3 mutant produced colonies 10 times as efficiently as the rad3+ cells, but the colony-forming fraction was reduced to one-tenth of the wild-type in the 5-FOA medium. This quantitative assay clearly showed that repression of ura4+ was partially liberated by the rad3 mutation. The derepression was due to the rad3 mutation, as it was complemented by introduction of a wild-type rad3+ plasmid (Figure 1C and Figure D). Northern blot analysis showed that expression of the telomere-linked ura4+ was significantly derepressed by the rad3 mutation, but that the expression of nontelomeric genes was unaffected (Figure 2). Based on these data, we concluded that the rad3 mutation alleviated silencing of the telomere-adjacent genes.

View larger version (42K):
In this window
In a new window
Download PPT slide
|
Figure 2.
Expression of telomere-adjacent ura4+ in a rad3-136 mutant. Cells were grown in an EMM + adenine-leucine-uracil medium to the exponential growth phase, and total RNAs were recovered. Northern blot analysis was performed using the 1.8-kb HindIII-HindIII fragment containing the ura4+ gene as a probe. The strains used are PM2-4C-aUT (rad3+ ade6+-ura4+:telomere) and PM14-1B-aUT (rad3-136 ade6+-ura4+::telomere).
|
|
rad3 mutations cause telomere shortening:
Several S. cerevisiae genes have been identified that regulate telomere length. In most cases, these genes also affect gene expression at the telomeric locus. We next examined whether the rad3-induced telomeric derepression was due to changes in the telomere length. All three fission yeast chromosomes contained EcoRI restriction sites at ~1.0 kb from the ends (SUGAWARA 1989
; Figure 1A). The four terminal fragments derived from both ends of chromosomes I and II comprise 700 bp of the telomere-associated sequence (TAS) and telomeric repeats (300 bp on average; Figure 1A). The other two fragments are from the ends of chromosome III, which is composed of a 700-bp fragment of the ribosomal RNA genes and the telomeric repeats.
Southern blot analysis showed a reduction in telomere length in rad3 mutants (Figure 3), as observed by DAHLEN et al. 1998
(). rad3-136 mutants possessed a telomere fragment significantly shorter than that of the wild-type cells, as determined from the length of the terminal EcoRI fragment [average sizes: 0.83 ± 0.02 kb (rad3-136) and 0.99 ± 0.04 kb (wild type)]. Digestion by ApaI, which liberated the telomeric repeat tracts from the subtelomeric sequence, revealed that this shortening was due to a reduction in the number of telomeric repeats (data not shown). To eliminate the possibility that the shortening is due to background mutations, we constructed an insertion (rad3::ura4+) and a deletion (rad3::LEU2) mutation in the rad3+ gene, and then compared the telomere lengths in wild-type and isogenic rad3
cells. All rad3
cells had telomeres that were, on average, 150 bp shorter than that of the wild type, confirming that loss of rad3+ function causes telomere shortening (Figure 3). The defect in telomere length was reversed by reintroducing the wild-type rad3+ gene on an ars plasmid (Figure 3). Therefore, the alteration in telomere structure produced by rad3 mutation is reversible.

View larger version (66K):
In this window
In a new window
Download PPT slide
|
Figure 3.
Telomere shortening caused by several rad3 alleles. Cells were grown in YPD, and genomic DNAs were recovered using the glass bead-phenol chloroform method. After digestion with EcoRI, the DNAs were fractionated on a 1.2% agarose gel and were subjected to Southern blot analysis using the S. pombe telomere fragment as a probe. The strains used are JY746 (WT), PM11-3A (rad3-136), PM1001 (rad3::ura4+), PM1002 (rad3::LEU2), PM1002 (rad3::LEU2) with pREP42 (control vector), or pAMP136 (ura4+ rad3+). The asterisk indicates bands derived from the telomere-associated sequence.
|
|
The spectrum of telomere phenotypes caused by various checkpoint rad mutations:
The rad3 mutant was originally isolated as a radiation-sensitive mutant, and recent studies revealed that the rad3+ gene is essential for cell-cycle checkpoint regulation (BENTLEY et al. 1996
). We suspect that defects in the cell-cycle checkpoint, such as incomplete DNA replication, are responsible for the shortened telomeres detected in the rad3 mutants. This possibility was examined by DAHLEN et al. 1998
, showing that some of the checkpoint rad mutations led to telomere shortening. We carefully reexamined the terminal telomere lengths in a series of checkpoint mutants.
rad1+ and rad17+ encode a 3'5' exonuclease homologue and a replication factor C-related protein, respectively, and it has been proposed that they function upstream of rad3+ (LONG et al. 1994
; GRIFFITHS et al. 1995
). As disruption of rad26+ or rad3+ leads to the same phenotype, rad26+ is thought to function in association with, or in the vicinity of, rad3+ in checkpoint signal transduction (AL-KHODAIRY et al. 1994
; UCHIYAMA et al. 1997
; LINDSAY et al. 1998
). chk1+ and cds1+ encode protein kinases and are located downstream of rad3+ and rad26+ in the pathways responsive to DNA damage and DNA replication blocks, respectively (WALWORTH et al. 1993
; MURAKAMI and OKAYAMA 1995
; WALWORTH and BERNARDS 1996
; BODDY et al. 1998
; LINDSAY et al. 1998
; MARTINHO et al. 1998
). Southern blot analysis using the telomere probe confirmed that shortening of the terminal telomere length was observed in rad1, rad17, or rad26, but not in the chk1 or cds1 mutants (Figure 4 and Figure 5). In addition, we found that the checkpoint rad genes affected the telomere length to different degrees. rad1 and rad17 mutations affected telomere length significantly, though the extent of shortening was less than that induced by the rad3 mutation (average lengths of the EcoRI fragment are 0.94 kb in rad1 and rad17 and 0.84 kb in rad3; Figure 4). Disruption of the rad26+ gene shortened the telomeres to a degree comparable to that of the rad3 mutations (Figure 4). It remains possible that the less obvious effect seen in the rad1 or rad17 mutants is due to the leakiness of the mutations. However, this possibility is unlikely because the rad1-1 and rad17w alleles used in this study are phenotypically the same as the null alleles, and these produced no detectable levels of gene products (SUNNERHAGEN et al. 1990
; ROWLEY et al. 1992
; GRIFFITHS et al. 1995
). We also constructed a rad1 disruption allele, and confirmed that the telomeres were significantly shortened but were still longer than those of rad3 or rad26 (Figure 4). Based on these results, we concluded that checkpoint mutations that cause telomere length reduction can be classified into two classes: rad1 and rad17, which have a moderate effect, and rad3 and rad26, which have a more severe effect on the telomeric DNA structure.

View larger version (37K):
In this window
In a new window
Download PPT slide
|
Figure 4.
Telomere phenotypes in checkpoint rad mutants. (A) Southern blot analysis. Genomic DNAs of YPD-grown cells were recovered using the glass bead-phenol chloroform method. After digestion with EcoRI, the DNAs were fractionated on a 1.5% agarose gel and were subjected to Southern blot analysis. The strains used are the following: (A) JY746 (WT), PM10-1A (rad1-1), PM1003 (rad1::LEU2), PM15-1C (rad17), PM1002 (rad3::LEU2), and PM1004 (rad26::ura4+). (B) Densitometric analysis. Gel data obtained using an image analyzer BAS2000 (Fuji) was analyzed with NIH image 1.55. Peaks and distributions of the telomeric DNA-derived bands are shown.
|
|



View larger version (118K):
In this window
In a new window
Download PPT slide
|
Figure 5.
Effect of deletion or overexpression of chk1+ and cds1+ on the telomere-shortening phenotype. (A) Interaction of rad1+ with chk1+ and cds1+ in response to DNA damage and replication block. (B) Rescue of DNA damage and replication block supersensitivity by chk1+ and cds1+. A rad1-1 mutant strain (PM10-1A) was transformed with pNW3 (chk1+ overproducer) or pcL-cds1+ (cds1+ overproducer), and the resultant transformants were spread onto plates. In the UV experiment, a plate was treated with UV (150 J/m2). In the HU experiment, growth of cells on a plate supplemented with HU (2.5 mM) was examined. Photographs were taken after 4 days of incubation at 30°. Viability of cells after each treatment is scored and shown. (C) Southern blot analysis. Transformants were incubated in EMM + adenine-uracil medium for ~60 generations. Then the telomere lengths of each strain were examined by Southern blotting. The strains used are the following: (left) JY746 (WT), PM1002 (rad3), PM1003 (rad1), PM1009 (chk1), PM1010 (cds1), and PM1011 (cds1 chk1); (right) PM10-1A harboring pALSK (vector), pAMP128 (prad1+), pNW3 (pchk1+), or pcL-cds1+ (pcds1+). The asterisks indicate bands derived from the telomere-associated sequence. (D) Densitometric analysis. Gel data obtained using an image analyzer BAS2000 (Fuji) were analyzed with NIH image 1.55.
|
|
The telomere integrity pathway may not be mediated through downstream protein kinases:
As shown in the previous section, the deletion of chk1+ or cds1+ produced only a minor effect on the telomere. It was shown recently that cds1+ and chk1+ constitute two independent, but complementary, pathways downstream of the checkpoint rad group genes including rad3+ (LINDSAY et al. 1998
). Also, it was reported that the simultaneous disruption of these two genes leads to supersensitivity to several types of DNA damage that is phenotypically comparable to a rad26 disruptant. However, the telomere length of the double mutant did not differ significantly from either single mutant (Figure 5C).
Checkpoint defects in the rad1 mutant have been reported to be suppressed by the overexpression of the protein kinase chk1+ or cds1+ (WALWORTH et al. 1993
; MURAKAMI and OKAYAMA 1995
). Introduction of the chk1+ or cds1+ overexpression plasmid did not significantly alter the telomere-shortening phenotype of the rad1-1 mutant, although the sensitivity to UV or HU was relieved by the chk1+ and cds1+ plasmid, respectively, as reported previously (Figure 5B and Figure C). Taken together, these results are consistent with evidence that indicates that downstream protein kinases are nonessential for telomere maintenance. Our results further suggest that, in spite of their essential function for response to canonical DNA damage or a replication block, the protein kinase-regulated cell-cycle checkpoint system may not be involved in maintenance of the telomere integrity.
rad3+ pathway and tel1+ act independently on the maintenance of normal telomere structures:
We have isolated and characterized tel1+, a homologue of TEL1/ATM, from S. pombe (NAITO et al. 1998
). Disruption of the tel1+ gene produced no obvious phenotypes: the tel1 disruptant displayed normal levels of DNA damage sensitivity and showed no obvious defect in telomere maintenance. However, a combination of the tel1 mutation with rad3 impaired cellular growth and produced an extensive reduction in telomere length (NAITO et al. 1998
). To investigate the relationship between the genes involved in telomere maintenance, we constructed a series of double mutants and determined telomere length by Southern blot analysis.
Checkpoint rad mutations are epistatic to one another with respect to DNA damage sensitivity (AL-KHODAIRY and CARR 1992
; AL-KHODAIRY et al. 1994). This is also the case with telomere length control; a combination of rad3 with rad1, rad17, or rad26 did not enhance the telomere shortening (Figure 6). This is in sharp contrast to the tel1 mutation, which is synergistic with a rad26 or a rad3 mutation (Figure 6; NAITO et al. 1998
). tel1 did not significantly affect telomere shortening in the rad1 mutant. This result also suggests that rad1+ does not function in telomere regulation in the same way as its downstream regulators, rad3+ and rad26+. Furthermore, based on the genetic interaction described above, we concluded that fission yeast cells maintain normal telomere lengths through two independent pathways, one of which is mediated by the rad3+ and rad26+ gene products and the other by tel1+.

View larger version (50K):
In this window
In a new window
Download PPT slide
|
Figure 6.
Genetic interaction among checkpoint rad mutations and tel1. Cells were grown in YPD, and genomic DNAs were recovered using the glass bead-phenol chloroform method. After digestion with EcoRI, the DNAs were fractionated on a 1.2% agarose gel and were subjected to Southern blot analysis. Strains used are the following: (A) JY746 (WT), PM1001 (rad3::ura4+), PM1004 (rad26), PM1012 (rad26 tel1), PM1003 (rad1::LEU2), and PM1008 (rad1::LEU2 tel1); (B) JY746 (WT), PM1006 (rad3 rad17), PM1002 (rad3), PM1007 (rad3 rad26), and PM1005 (rad1 rad3). To confirm that DNA was present on the rad26 tel1 lanes, the ethidium-bromide-stained gel is shown in the bottom of A. The asterisks indicate bands derived from the telomere-associated sequence, which are often lost in the rad tel1 double mutants as shown in A. (CD) Densitometric analysis using the NIH Image. In C, densitometric profiles of WT, rad26, rad26 tel1, rad1, and rad1 tel1 mutants were overlaid, as were those of WT, rad3, rad1 rad3, rad3 rad17, and rad3 rad26 mutants in D.
|
|
tel1+ function may overlap with the checkpoint rad genes:
In S. cerevisiae, the two ATM-related PI-3 kinase homologues MEC1 and TEL1 are thought to be functionally related because introduction of an extra copy of TEL1 can overcome the DNA damage and replication block supersensitivity of mec1-1 (MORROW et al. 1995
). In S. pombe, a similar suppression of rad3 by tel1+ was not observed (our unpublished results). Another piece of evidence supporting the MEC1-TEL1 relationship is the synergistic interaction of tel1 and mec1-1 in their sensitivity to drugs causing DNA damages (MORROW et al. 1995
). Due to the impaired growth of the rad3 tel1 double mutant, we could not assess the synergism accurately. On the other hand, the double disruption of rad1 and tel1 did not affect cellular growth. Using the double mutant, we examined the possible relationship of tel1+ and the checkpoint rad genes.
As shown in Figure 7A, both rad1 and rad1 tel1 mutants were sensitive to high concentrations of MMS and HU, whereas a tel1 mutant showed wild-type levels of sensitivity. A reduction in drug concentration enabled the rad1 single mutant to grow; however, the double mutant still showed a reduced viability at these concentrations. Survival curves upon exposure to different concentrations of the drugs clearly indicated the synthetic effect of rad1 and tel1 mutations (Figure 7C). The supersensitivity of the double mutation was effectively relieved by introduction of the wild-type tel1+ plasmid (Figure 7B). These results suggest that S. pombe tel1+ function overlaps with the checkpoint rad gene pathway, as does its S. cerevisiae counterpart TEL1.

View larger version (32K):
In this window
In a new window
Download PPT slide
|
Figure 7.
Synergism of DNA damage and replication block supersensitivity in rad1 and tel1 mutations. (A) Cells of JY746 (wild type), PM1003 (rad1::LEU2), PM1008 (rad1::LEU2 tel1::ade6+), or PM1013 (tel1::ade6+) were grown in YPD medium, cultures were serially diluted 1:10 with sterilized water, and 3-µl aliquots of each dilution were spotted onto a YPD plate containing MMS or HU. Photographs were taken after 3 days of incubation at 30°. The drug concentrations are as follows: MMS low (0.0005%), high (0.0025%); HU low (1 mM), high (2.5 mM). (B) Cells of PM1008 (rad1::LEU2 tel1::ade6+) harboring the control vectors pREP2 (ura4+) or pHA7 (ura4+ tel1+) were grown in EMM-Ura, and cultures were serially diluted 1:10 with sterilized water, and 3-µl aliquots of each dilution were spotted onto YPD or YPD + 0.0005% MMS. Photographs were taken after 3 days of incubation at 30°. (C) Cells of JY746 (wild type), PM1003 (rad1::LEU2), PM1008 (rad1::LEU2 tel1::ade6+), or PM1013 (tel1::ade6+) were plated on YPD media containing MMS and HU. Surviving cells were grown up as colonies and counted after incubation at 30° for 6 days.
|
|
 | DISCUSSION |
|---|
Maintenance of chromosomes ensures that cells do not lose genetic information. The telomere is an essential chromosomal element, and the ATM family proteins are evolutionarily conserved regulators necessary for telomere integrity. We have previously established the essential role of the S. pombe ATM homologue rad3+ in telomere integrity together with tel1+, another ATM homologue (NAITO et al. 1998
). In this study, we carried out genetic studies to elucidate the roles of the checkpoint rad genes in telomere integrity control.
Two lines of evidence demonstrated the requirement for the rad3+ gene in telomere function. First, telomeric repression of the end of the minichromosome was partially alleviated by the rad3 mutation (Figure 1 and Figure 2). Second, the rad3 mutations affect the length of the telomere repeat sequences (Figure 3). Telomere shortening was invariably observed in all authentic chromosomal ends (Figure 3); thus, rad3+ gene function is required for the maintenance of the structure of wild-type telomeres in addition to the artificial chromosome we constructed in this study.
Previously, ALLSHIRE et al. 1995
reported that the expression of telomere-adjacent genes was drastically derepressed by mutations defective in the formation of heterochromatin structures such as clr4, rik1, or swi6. In contrast, the effect of the rad3 mutation on the telomeric silencing was significant but modest. These observations may imply that the effects of telomeric derepression are secondary to the telomere shortening. These two effects appear to be separable in S. cerevisiae, as both yku70 and mre11 mutations shorten telomeric DNA to a similar degree but only the yku70 mutation leads to the telomeric derepression (BOULTON and JACKSON 1998
). Whether Rad3 directly regulates the heterochromatin formation remains open at present.
In a previous study, the checkpoint rad genes, including rad1+, rad17+, rad3+, and rad26+, were shown to be involved in controlling telomere length in S. pombe (DAHLEN et al. 1998
). It was suggested that rad1+ may be an essential component of this regulation system, based on the observation that overexpression of rad1+ caused elongation of the telomeric repeats. However, the result was not reproduced in our S. pombe strains (data not shown). In addition, our studies indicated that, instead of rad1+ and rad17+, the downstream elements rad3+ and rad26+ play a more crucial role in the regulation of telomere length. Although rad1 and rad17 mutations shortened the telomeres, the reduction was less than that caused by rad3 and rad26 (Figure 4 and Figure 5). In addition, rad3 mutations reduced repression of the telomere-adjacent gene expression, but we observed no similar defect in the rad1 mutant (data not shown). Further, deletion of the tel1+ gene had little effect on the telomere of the rad1 mutant, which is in sharp contrast with the enhanced effect observed in the rad3 or rad26 mutant (Figure 6; NAITO et al. 1998
). It has been shown that the checkpoint rad genes belong to the same phenotypic class with respect to their sensitivities to several kinds of DNA-damaging reagents (AL-KHODAIRY and CARR 1992
; AL-KHODAIRY et al. 1994). This is also true with the telomere-shortening phenotype: rad1 rad3, rad3 rad17, and rad3 rad26 cells possessed telomere repeat sequences comparable to a rad3 or a rad26 single mutant (Figure 6). Taken together, these data indicate that rad3+ is a key component of telomere maintenance in S. pombe.
The roles of the rad1+ and rad17+ gene products in the regulation of the Rad3 protein kinase have not yet been elucidated. They may be required to retain Rad3 basal activity, although we have observed that overexpression of rad3+ by the nmt1 promoter did not relieve DNA damage supersensitivity nor telomere insufficiency of the rad1 mutant (our unpublished observations). It is also possible that rad1 and rad17 determine the correct location of the rad3+ gene product. Biochemical data suggest that rad1, rad17, and certain other checkpoint rad gene products may form a complex in S. pombe (KOSTRUB et al. 1998
), and the same type of complex is formed by the corresponding gene products of S. cerevisiae (PACIOTTI et al. 1998
; KONDO et al. 1999
; reviewed by WEINERT 1998
) Further biochemical analyses of these gene products may reveal the regulation of Rad3 activity responsible for telomere integrity control.
The protein kinases Chk1 and Cds1 are under the control of the rad3+ gene product (WALWORTH and BERNARDS 1996
; BODDY et al. 1998
; LINDSAY et al. 1998
). As other researchers have shown previously (DAHLEN et al. 1998
), we also found that a single mutation in chk1+ or cds1+ did not obviously affect the telomere structure. It remains possible, however, that this is due to the complementary function of these protein kinases in the DNA damage response and that each single gene defect may be relieved by the residual activity of the other intact gene. However, this study confirmed that they are nonessential for telomere integrity. Simultaneous disruption of cds1+ and chk1+ resulted in a normal telomere length (Figure 5), and in spite of the multiple copy effect of chk1+ or cds1+ on the DNA damage or replication block supersensitivity of the rad1 mutation, they did not rescue the telomere shortening of the same mutation (Figure 5). Therefore, we have identified a novel role of rad3+ in S. pombe that does not require chk1+ and cds1+, which suggests the presence of other downstream factors. Interestingly, it was recently proposed that mammalian Atm and S. pombe Rad3 may have two functions that respond to DNA damage: a control of cell-cycle progression to prevent cells with damaged DNA from dividing, and the repair of specific subsets of lesions (JEGGO et al. 1998
). Thus, the telomere integrity control of rad3+ may be mediated by the latter process. We are attempting to collect specific alleles of rad3+ that will shed light on the regulation of the telomeres by the checkpoint rad genes.
S. pombe cells possess a set of ATM family genes, rad3+ and tel1+ (NAITO et al. 1998
). Such duplication in ATM-related genes has been discovered in other organisms, such as mammals (ATR and ATM; KEEGAN et al. 1996
) and S. cerevisiae (MEC1 and TEL1; MORROW et al. 1995
). Functional redundancy of these proteins in S. cerevisiae has been reported; thus, we examined S. pombe for the same phenomenon. Deletion of tel1+ did not affect sensitivity to DNA damage or replication block. We showed, however, that double mutations of tel1 with rad3 or rad26 generated extensive telomere shortening. This result implies that tel1+ is important for the maintenance of telomeres in genetic backgrounds defective in the checkpoint rad genes. In addition, we showed that tel1 enhanced sensitivity to DNA-damaging reagents in the rad1 background. Taking into account previous results that show that the checkpoint rad gene products function in the same pathway (AL-KHODAIRY and CARR 1992
; AL-KHODAIRY et al. 1994), the two ATM homologues may be functionally redundant in S. pombe not only in the telomere regulation but also in the DNA damage checkpoint mechanism. However, we observed that neither the checkpoint defect nor the telomere defect of the rad3 mutant was suppressible by overexpression of tel1+ (our unpublished results). All these results suggest that the functions of tel1+ and rad3+ are related, but not interchangeable. Each of two Atm-related kinases may possess a specific substrate(s) that is essential for their downstream regulatory network. Alternatively, the activities of these two proteins may be regulated separately, for example, by different signals and/or proteins. The latter possibility is consistent with the observation that the mammalian Rad3 counterpart ATR is activated by UV-induced DNA lesions but ATM, the Tel1 counterpart, is not (TIBBETTS et al. 1999
).
The mechanism by which the length of the telomere repeat sequences is maintained constant is still not clear. Recent studies of a variety of telomere-repeat binding proteins from yeasts to humans have provided a clue to solve this problem. Mutations in S. cerevisiae RAP1, S. pombe taz1+, and human TRF1 cause telomere elongation (SUSSEL and SHORE 1991
; KYRION et al. 1992
; LIU et al. 1994
; COOPER et al. 1997
; VAN STEENSEL and DE LANGE 1997
), which suggests that these factors negatively regulate telomerase activity. In addition, direct evidence for telomere length regulation, obtained by counting the number of the telomere-binding proteins on each telomere, has been presented (MARCAND et al. 1997
). We observed a reduction in the telomere DNA tracts in several S. pombe checkpoint mutants. An interesting feature of the telomere phenotype of these mutants is that telomere length decreases as cells continue dividing, and once the reduction reaches a threshold, the length remains constant at the new equilibrium (DAHLEN et al. 1998
). These genes may function in telomere regulation to induce the activity of the repair system for shortened telomeres. Alternatively, the checkpoint gene products may make a direct contribution to the counting mechanism, and deletion of these genes may disrupt the regulation. Identification of telomere-specific targets of the Atm homologues will clarify this issue.
 | ACKNOWLEDGMENTS |
|---|
We thank Drs. N. Sugawara, J. Kohli, M. Yamamoto, Y. Iino, H. Murakami, H. Okayama, K. Maundrell, and D. Beach for their gifts of the plasmids and strains used in this study. We also thank Drs. O. Niwa, K. Okazaki, and M. Shimanuki for strains, plasmids, and stimulating discussions. We thank Dr. E. A. Kamei for critical reading of the manuscript. We thank Dr. Toh-e for providing plasmids and the S. pombe library. We are grateful to H. Ariyoshi for constructing the plasmid pHA7. This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports, and Culture of Japan (grant no. 08280104).
Manuscript received November 18, 1998; Accepted for publication April 19, 1999.
 | LITERATURE CITED |
|---|
AL-KHODAIRY, F. and A. M. CARR, 1992 DNA repair mutants defining G2 checkpoint pathways in Schizosaccharomyces pombe.. EMBO J. 11:1343-1350[Medline].
AL-KHODAIRY, F., E. FOTOU, K. S. SHELDRICK, D. J. GRIFFITHS, and A. R. LEHMANN et al., 1994 Identification and characterization of new elements involved in checkpoint and feedback controls in fission yeast. Mol. Biol. Cell 5:147-160[Abstract].
ALFA, C., P. FANTES, J. HYAMS, M. MCLEOD and E. WARBRICK (Editors), 1993 Experiments with Fission Yeast: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
ALLSHIRE, R. C., E. R. NIMMO, K. EKWALL, J. P. JAVERZAT, and G. CRANSTON, 1995 Mutations derepressing silent centromeric domains in fission yeast disrupt chromosome segregation. Genes Dev. 9:218-233[Abstract/Free Full Text].
BASI, G., E. SCHMID, and K. MAUNDRELL, 1993 TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123:131-136[Medline].
BENTLEY, N. J., D. A. HOLTZMAN, G. FLAGGS, K. S. KEEGAN, and A. DEMAGGIO et al., 1996 The Schizosaccharomyces pombe rad3 checkpoint gene. EMBO J. 15:6641-6651[Medline].
BLACKBURN, E. H., and C. W. GREIDER (Editors), 1995 Telomeres. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BODDY, M. N., B. FURNARI, O. MONDESERT, and P. RUSSELL, 1998 Replication checkpoint enforced by kinases Cds1 and Chk1. Science 280:909-912[Abstract/Free Full Text].
BOULTON, S. J. and S. P. JACKSON, 1998 Components of the Ku-dependent non-homologous end-joining pathway are involved in telomeric length maintenance and telomeric silencing. EMBO J. 17:1819-1828[Medline].
CHENG, S., C. FOCKLER, W. M. BARNES, and R. HIGUCHI, 1994 Effective amplification of long targets from cloned inserts and human genomic DNA. Proc. Natl. Acad. Sci. USA 91:5695-5699[Abstract/Free Full Text].
COCKELL, M., F. PALLADINO, T. LAROCHE, G. KYRION, and C. LIU et al., 1995 The carboxy termini of Sir4 and Rap1 affect Sir3 localization: evidence for a multicomponent complex required for yeast telomeric silencing. J. Cell Biol. 129:909-924[Abstract/Free Full Text].
CONRAD, M. N., J. H. WRIGHT, A. J. WOLF, and V. A. ZAKIAN, 1990 RAP1 protein interacts with yeast telomeres in vivo: overproduction alters telomere structure and decreases chromosome stability. Cell 63:739-750[Medline].
COOPER, J. P., E. R. NIMMO, R. C. ALLSHIRE, and T. R. CECH, 1997 Regulation of telomere length and function by a Myb-domain protein in fission yeast. Nature 385:744-747[Medline].
DAHLEN, M., T. OLSSON, G. KANTER-SMOLER, A. RAMNE, and P. SUNNERHAGEN, 1998 Regulation of telomere length by checkpoint genes in Schizosaccharomyces pombe.. Mol. Biol. Cell 9:611-621[Abstract/Free Full Text].
FANG, G., and T. R. CECH, 1995 Telomere proteins, pp. 69105 in Telomeres, edited by E. H. BLACKBURN and C. W. GREIDER. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
GARVIK, B., M. CARSON, and L. HARTWELL, 1995 Single-stranded DNA arising at telomeres in cdc13 mutants may constitute a specific signal for the RAD9 checkpoint. Mol. Cell. Biol. 15:6128-6138[Abstract].
GOTTA, M., T. LAROCHE, A. FORMENTON, L. MAILLET, and H. SCHERTHAN et al., 1996 The clustering of telomeres and colocalization with Rap1, Sir3, and Sir4 proteins in wild-type Saccharomyces cerevisiae.. J. Cell Biol. 134:1349-1363[Abstract/Free Full Text].
GOTTSCHLING, D. E., O. M. APARICIO, B. L. BILLINGTON, and V. A. ZAKIAN, 1990 Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63:751-762[Medline].
GREENWELL, P. W., S. L. KRONMAL, S. E. PORTER, J. GASSENHUBER, and B. OBERMAIER et al., 1995 TEL1, a gene involved in controlling telomere length in S. cerevisiae, is homologous to the human ataxia telangiectasia gene. Cell 82:823-829[Medline].
GREIDER, C. W., 1995 Telomerase biochemistry and regulation, pp. 3568 in Telomeres, edited by E. H. BLACKBURN and C. W. GREIDER. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
GRIFFITHS, D. J., N. C. BARBET, S. MCCREADY, A. R. LEHMANN, and A. M. CARR, 1995 Fission yeast rad17: a homologue of budding yeast RAD24 that shares regions of sequence similarity with DNA polymerase accessory proteins. EMBO J. 14:5812-5823[Medline].
HARDY, C. F., L. SUSSEL, and D. SHORE, 1992 A RAP1-interacting protein involved in transcriptional silencing and telomere length regulation. Genes Dev. 6:801-814[Abstract/Free Full Text].
HECHT, A., T. LAROCHE, S. STRAHL-BOLSINGER, S. M. GASSER, and M. GRUNSTEIN, 1995 Histone H3 and H4 N-termini interact with SIR3 and SIR4 proteins: a molecular model for the formation of heterochromatin in yeast. Cell 80:583-592[Medline].
HENDERSON, E., 1995 Telomere DNA structure, pp. 1134 in Telomeres, edited by E. H. BLACKBURN and C. W. GREIDER. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
JEGGO, P. A., A. M. CARR, and A. R. LEHMANN, 1998 Splitting the ATM: distinct repair and checkpoint defects in ataxia-telangiectasia. Trends Genet. 14:312-316[Medline].
KAISER, C., S. MICHAELIS and A. MITCHELL (Editors), 1994 Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
KEEGAN, K. S., D. A. HOLTZMAN, A. W. PLUG, E. R. CHRISTENSON, and E. E. BRAINERD et al., 1996 The Atr and Atm protein kinases associate with different sites along meiotically pairing chromosomes. Genes Dev. 10:2423-2437[Abstract/Free Full Text].
KONDO, T., K. MATSUMOTO, and K. SUGIMOTO, 1999 Role of a complex containing Rad17, Mec3, and Ddc1 in the yeast DNA damage checkpoint pathway. Mol. Cell. Biol. 19:1136-1143[Abstract/Free Full Text].
KOSTRUB, C. F., K. KNUDSEN, S. SUBRAMANI, and T. ENOCH, 1998 Hus1p, a conserved fission yeast checkpoint protein, interacts with Rad1p and is phosphorylated in response to DNA damage. EMBO J. 17:2055-2066[Medline].
KYRION, G., K. A. BOAKYE, and A. J. LUSTIG, 1992 C-terminal truncation of RAP1 results in the deregulation of telomere size, stability, and function in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:5159-5173[Abstract/Free Full Text].
LENDVAY, T. S., D. K. MORRIS, J. SAH, B. BALASUBRAMANIAN, and V. LUNDBLAD, 1996 Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes. Genetics 144:1399-1412[Abstract].
LIN, J. J. and V. A. ZAKIAN, 1996 The Saccharomyces CDC13 protein is a single-strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere behavior in vivo. Proc. Natl. Acad. Sci. USA 93:13760-13765[Abstract/Free Full Text].
LINDSAY, H. D., D. J. GRIFFITHS, R. J. EDWARDS, P. U. CHRISTENSEN, and J. M. MURRAY et al., 1998 S-phase-specific activation of Cds1 kinase defines a subpathway of the checkpoint response in Schizosaccharomyces pombe.. Genes Dev. 12:382-395[Abstract/Free Full Text].
LINGNER, J., T. R. HUGHES, A. SHEVCHENKO, M. MANN, and V. LUNDBLAD et al., 1997 Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276:561-567[Abstract/Free Full Text].
LIU, C., X. MAO, and A. J. LUSTIG, 1994 Mutational analysis defines a C-terminal tail domain of RAP1 essential for telomeric silencing in Saccharomyces cerevisiae.. Genetics 138:1025-1040[Abstract].
LONG, K. E., P. SUNNERHAGEN, and S. SUBRAMANI, 1994 The Schizosaccharomyces pombe rad1 gene consists of three exons and the cDNA sequence is partially homologous to the Ustilago maydis REC1 cDNA. Gene 148:155-159[Medline].
LONGTINE, M. S., N. M. WILSON, M. E. PETRACEK, and J. BERMAN, 1989 A yeast telomere binding activity binds to two related telomere sequence motifs and is indistinguishable from RAP1. Curr. Genet. 16:225-239[Medline].
LUNDBLAD, V. and J. W. SZOSTAK, 1989 A mutant with a defect in telomere elongation leads to senescence in yeast. Cell 57:633-643[Medline].
LUSTIG, A. J. and T. D. PETES, 1986 Identification of yeast mutants with altered telomere structure. Proc. Natl. Acad. Sci. USA 83:1398-1402[Abstract/Free Full Text].
MARCAND, S., E. GILSON, and D. SHORE, 1997 A protein-counting mechanism for telomere length regulation in yeast. Science 275:986-990[Abstract/Free Full Text].
MARTINHO, R. G., H. D. LINDSAY, G. FLAGGS, A. J. DEMAGGIO, and M. F. HOEKSTRA et al., 1998 Analysis of Rad3 and Chk1 protein kinases defines different checkpoint responses. EMBO J. 17:7239-7249[Medline].
MAUNDRELL, K., 1993 Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123:127-130[Medline].
METCALFE, J. A., J. PARKHILL, L. CAMPBELL, M. STACEY, and P. BIGGS et al., 1996 Accelerated telomere shortening in ataxia telangiectasia. Nat. Genet. 13:350-353[Medline].
MORETTI, P., K. FREEMAN, L. COODLY, and D. SHORE, 1994 Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev. 8:2257-2269[Abstract/Free Full Text].
MORROW, D. M., D. A. TAGLE, Y. SHILOH, F. S. COLLINS, and P. HIETER, 1995 TEL1, an S. cerevisiae homolog of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MEC1.. Cell 82:831-840[Medline].
MURAKAMI, H. and H. OKAYAMA, 1995 A kinase from fission yeast responsible for blocking mitosis in S phase. Nature 374:817-819[Medline].
NAITO, T., A. MATSUURA, and F. ISHIKAWA, 1998 Circular chromosome formation in a fission yeast mutant defective in two ATM-homologues. Nat. Genet. 20:203-206[Medline].
NIMMO, E. R., G. CRANSTON, and R. C. ALLSHIRE, 1994 Telomere-associated chromosome breakage in fission yeast results in variegated expression of adjacent genes. EMBO J. 13:3801-3811[Medline].
NIWA, O., T. MATSUMOTO, Y. CHIKASHIGE, and M. YANAGIDA, 1989 Characterization of Schizosaccharomyces pombe minichromosome deletion derivatives and a functional allocation of their centromere. EMBO J. 8:3045-3052[Medline].
NUGENT, C. I. and V. LUNDBLAD, 1998 The telomerase reverse transcriptase: components and regulation. Genes Dev. 12:1073-1085[Free Full Text].
NUGENT, C. I., T. R. HUGHES, N. F. LUE, and V. LUNDBLAD, 1996 Cdc13p: a single-strand telomeric DNA-binding protein with a dual role in yeast telomere maintenance. Science 274:249-252[Abstract/Free Full Text].
PACIOTTI, V., G. LUCCHINI, P. PLEVANI, and M. P. LONGHESE, 1998 Mec1p is essential for phosphorylation of the yeast DNA damage checkpoint protein Ddc1p, which physically interacts with Mec3p. EMBO J. 17:4199-4209[Medline].
PALLADINO, F., T. LAROCHE, E. GILSON, A. AXELROD, and L. PILLUS et al., 1993 SIR3 and SIR4 proteins are required for the positioning and integrity of yeast telomeres. Cell 75:543-555[Medline].
PARDUE, M. L., 1995 Drosophila telomeres: another way to end it all, pp. 339370 in Telomeres, edited by E. H. BLACKBURN and C. W. GREIDER. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
ROWLEY, R., S. SUBRAMANI, and P. G. YOUNG, 1992 Checkpoint controls in Schizosaccharomyces pombe: rad1.. EMBO J. 11:1335-1342[Medline].
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SAVITSKY