Genetics, Vol. 152, 543-551, June 1999, Copyright © 1999

Positive Selection Drives the Evolution of the Acp29AB Accessory Gland Protein in Drosophila

Montserrat Aguadéa
a Departament de Genètica, Facultat de Biologia, Universitat de Barcelona, 08071 Barcelona, Spain

Corresponding author: Montserrat Aguadé, Facultat de Biologia, Universitat de Barcelona, Diagonal 645, 08071 Barcelona, Spain., aguade{at}porthos.bio.ub.es (E-mail)

Communicating editor: A. G. CLARK


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Nucleotide sequence variation at the Acp29AB gene region has been surveyed in Drosophila melanogaster from Spain (12 lines), Ivory Coast (14 lines), and Malawi (13 lines) and in one line of D. simulans. The ~1.7-kb region studied encompasses the Acp29AB gene that codes for a male accessory gland protein and its flanking regions. Seventy-seven nucleotide and 8 length polymorphisms were detected. Nonsynonymous polymorphism was an order of magnitude lower than synonymous polymorphism, but still high relative to other non-sex-related genes. In D. melanogaster variation at this region revealed no major genetic differentiation between East and West African populations, while differentiation was highly significant between the European and the two African populations. Comparison of polymorphism and divergence at synonymous and nonsynonymous sites showed an excess of fixed nonsynonymous changes, which indicates that the evolution of the Acp29AB protein has been driven by directional selection at least after the split of the D. melanogaster and D. simulans lineages. The pattern of variation in extant populations of D. melanogaster favors a scenario where the fixation of advantageous replacement substitutions occurred in the early stages of speciation and balancing selection is maintaining variation in this species.


A ratio of nonsynonymous to synonymous divergence (Ka/Ks) significantly higher than one has been considered good evidence of positive selection driving protein evolution. The first genes for which such a pattern was found were those encoding proteins that mediate self vs. nonself recognition, such as some genes of the major histocompatibility complex (MHC) in mammals (HUGHES and NEI 1988 Down, HUGHES and NEI 1990 Down) and self-incompatibility alleles in Solanaceae (CLARK and KAO 1991 Down). Also some proteins involved in gamete recognition in marine invertebrates, such as sperm lysin in abalone (LEE and VACQUIER 1995 Down) and sperm bindin in sea urchins (METZ and PALUMBI 1996 Down), appeared to be driven by positive selection.

In Drosophila some proteins involved in sexual reproduction, such as those mediating gamete recognition or sperm competition, seem to evolve relatively rapidly. CIVETTA and SINGH 1998 Down found that when closely related species of Drosophila (D. melanogaster and D. simulans) were compared, sex-related genes presented a high nonsynonymous to synonymous nucleotide substitution ratio relative to other genes. They argued that this high ratio was a result of directional selection and proposed that a burst of amino acid replacement substitutions accompanied the early phases of speciation. However, when the individual genes in that study are considered, in none of the comparisons between D. melanogaster and D. simulans is the Ka/Ks ratio significantly higher than one. For the Acp26Aa gene, which codes for a male accessory gland peptide that stimulates egg laying in mated D. melanogaster females during the first postmating day (HERNDORN and WOLFNER 1995 Down), this ratio is highest and close to one (AGUADE et al. 1992 Down). When the more distantly related species of the melanogaster group, D. yakuba and D. teissieri, were compared to D. melanogaster and D. simulans, this gene showed a Ka/Ks ratio significantly higher than one (TSAUR and WU 1997 Down).

Comparison of polymorphism and divergence at nonsynonymous and synonymous sites (MCDONALD and KREITMAN 1991 Down) has proved to be more powerful to detect adaptive protein evolution in closely related species than comparison of nonsynonymous (Ka) and synonymous (Ks) divergence. It has allowed detection of positive selection for the Acp26Aa gene in the D. melanogaster-D. simulans comparison (AGUADE 1998 Down; TSAUR et al. 1998 Down). However, this approach has not revealed a significant excess of nonsynonymous fixed changes for other genes that are also expressed in the male reproductive tract and whose products are transferred to the female as part of the seminal fluid: the Acp26Ab (AGUADE 1998 Down; TSAUR et al. 1998 Down), Acp70A (CIRERA and AGUADE 1997 Down), and Est-6 (KAROTAM et al. 1993 Down) genes.

In the present study nucleotide polymorphism and divergence have been analyzed at the Acp29AB gene (WOLFNER et al. 1997 Down), which is a male accessory gland protein gene encoding a 234-amino-acid-long protein. The mature peptide, composed of 213 amino acids, is transferred to the female during mating (O. LUNG, U. TRAM and M. F. WOLFNER, personal communication). Given that variation at this gene was associated with the ability of males to resist displacement by subsequent sperm, the protein could be involved in sperm competition (CLARK et al. 1995 Down). Unlike other Acp genes that showed a similar association with sperm competition in CLARK et al. 1995 Down, single strand conformation polymorphism (SSCP) analysis revealed only two variants at the Acp29AB region studied in the two samples from North America.

The ~1.7-kb region studied includes the previously sequenced Acp29AB gene (WOLFNER et al. 1997 Down) and a newly sequenced fragment of both its 5' and 3' flanking regions. Nucleotide variation at this region has been studied in samples from one European and two African populations of D. melanogaster and one line of the sibling species D. simulans. Different subsamples of the same D. melanogaster populations had been surveyed for variation at the Acp26Aa and Acp26Ab gene regions (AGUADE 1998 Down), and they showed high levels of both synonymous and nonsynonymous variation in those genes. To test whether, as in the case of the Acp26Aa gene, the Acp29AB gene had been subject to strong positive selection, we compared nonsynonymous and synonymous variation in the coding region within and between species and also silent/synonymous variation across the region studied.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila stocks:
Twelve isofemale lines collected in Montblanc (Spain) in 1993 were isogenized for the second chromosome upon arrival in the laboratory by the corresponding series of crosses with a balancer stock. A subsample of 14 lines from Lamto (Ivory Coast) and 13 lines from Malawi, kindly provided by M. Veuille and V. Bénassi (see BENASSI et al. 1993 Down; BENASSI and VEUILLE 1995 Down), were used in the present study. African lines were used as previously described (AGUADE 1998 Down) except that the deficiency Df(2L)TE29Aa-11, which covers cytological positions 28E4 to 29C1, was used to obtain individuals hemizygous for the wild Acp29AB locus. The D. simulans line used for the interspecific analysis was collected in Montblanc (Spain) in 1993 and was sibmated for 10 generations upon arrival in the laboratory. Individuals of the D. melanogaster and D. simulans lines from Montblanc were frozen one or two generations after isogenization.

DNA extraction, PCR amplification, and sequencing:
DNA from the mst319.5 plasmid that includes the Acp29AB gene (WOLFNER et al. 1997 Down) was kindly provided by M. F. Wolfner. Genomic DNA from D. melanogaster and D. simulans was extracted from 1 or 10 adult flies by a modification of protocol 48 in ASHBURNER 1989 Down.

Primers T3 and T7 from the pBluescript (Stratagene, La Jolla, CA) vector polylinker were used to amplify by PCR the insert of plasmid mst319.5 (WOLFNER et al. 1997 Down). The flanking regions (~650 and 550 bp in each direction) were sequenced by primer walking, which started in the coding region. The PCR product was purified with a Qiaquick column (QIAGEN, Chatsworth, CA) and cycle sequenced using fluorescent dideoxy terminators according to the manufacturer's instructions (Perkin-Elmer, Norwalk, CT; Amersham, Arlington Heights, IL). After excess dye-terminators were removed by ethanol precipitation, the sequencing product was separated with an ABI 377 automated DNA Sequencer (Perkin-Elmer).

For each of the D. melanogaster lines, 20-nucleotide-long primers (5'AAAGAAGATGCCCTGGGATA3' and 5'GATGGCCGAGAGCAGAAGTT3') were used to amplify by PCR an ~1.8-kb region encompassing the Acp29AB gene and its 5' and 3' flanking regions. Primers (17 nucleotides long) spaced on average 350 nucleotides were used to sequence the purified PCR products as described above. The D. melanogaster primers were used to amplify by PCR the homologous region of D. simulans; in this case, however, the ~1.8-kb region was amplified in two overlapping fragments. The sequences newly reported in this article have been deposited in the EMBL sequence database library under accession nos. AJ240513–AJ240552.

Sequence analysis:
The SeqEd program (Perkin-Elmer) was used to assemble and align the sequences and also to check all variable sites. The MacClade version 3.0.6 program was used to edit the sequences for further analyses (MADDISON and MADDISON 1992 Down). The DnaSP version 2.92 program (ROZAS and ROZAS 1997 Down) was used for most intraspecific and some interspecific analyses.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Sequencing of the 5' and 3' flanking regions of the Acp29AB gene:
Sequencing of the 5' flanking region revealed that the Acp29AB gene lacks a consensus TATA box. Also, the promoter region of this gene did not present either the decamer (AATGCAAAAT) or the octamer (ATTGCAAT) motifs described for other genes expressed in male accessory glands (DIBENEDETTO et al. 1990 Down; SIMMERL et al. 1995 Down). The 5' flanking region had a high AT content (68%) and TTT was the most common trinucleotide (9.2%). No open reading frame longer than 100 residues was detected in this 5' region, while one at least 131 residues long was detected at the 3' flanking region. This open reading frame presumably extends beyond the region sequenced in this study, but no consensus promoter signals were associated with this putative reading frame. Both the 5' and 3' flanking regions are considered a priori as noncoding in the following analyses.

Nucleotide polymorphism:
In the Ivory Coast population, unlike in the other two studied populations, the In(2L)t inversion is present at a very high frequency (73% as reported in VEUILLE et al. 1998 Down). Although in the present study 11 of the 14 lines analyzed carried this inversion (M. VEUILLE, personal communication), lines were not separated according to gene arrangement. The reason is that the Acp29AB region is located rather centrally in the region affected by the inversion, and no genetic differentiation between inverted and noninverted chromosomes was found when different subsamples of this same population were surveyed for variation at other regions also located in central positions of the inversion (P6 or Fbp2, BENASSI et al. 1993 Down; Acp26A, AGUADE 1998 Down).

Figure 1 summarizes the distribution of nucleotide sequence variation in the 1664-nucleotide region studied (excluding alignment gaps), including only 244 nucleotides of the detected 3' open reading frame. A total of 77 nucleotide and 8 length polymorphisms were detected. All length polymorphisms (not shown) were in noncoding regions. Four of these polymorphisms were single-base indels associated with runs of at least eight T's or eight A's and could be an artefact of the Taq polymerase; however, no such variation was detected in two similar runs of A's present in the coding region. Two other single-base indels can be considered part of complex mutations: TAAT to GAGTG and GTT to TAAA, starting at positions -117 and -71, respectively. The remaining two indels were 11 (see DISCUSSION) and 3 bp long.



View larger version (43K):
In this window
In a new window
Download PPT slide
 
Figure 1. Nucleotide polymorphisms at the Acp29AB gene region in three natural populations of D. melanogaster. Polymorphisms were numbered according to the sequence in WOLFNER et al. 1997 Down. Lines from Montblanc (Mo), Lamto (La), and Malawi (Ma) are presented sequentially. The thick-bordered box above the sequence information represents the amino acid coding region and the thick line the leader and trailer regions. Dots represent the same nucleotide as in the first sequence and asterisks indicate singletons. n, nonsynonymous; d, deletion. Complex mutational events that include both nucleotide changes and indels are shaded.

Table 1 gives the estimates of nucleotide variation for the whole region studied and for its different functional parts. The level of synonymous variation was generally higher than that of silent variation in the flanking regions. Nonsynonymous variation was an order of magnitude lower than synonymous variation, but still rather high as compared to that in other genes whose expression is not sex-related (CIVETTA and SINGH 1998 Down). In the sample from Montblanc, estimates of nucleotide variation were slightly lower than in the two African samples. Neither the Tajima test (TAJIMA 1989 Down) nor the Fu and Li tests (FU and LI 1993 Down) detected any departure from neutral expectations in any of the populations studied when the complete region was considered (results not shown).


 
View this table:
In this window
In a new window

 
Table 1. Nucleotide polymorphism

Population differentiation as revealed by variation at the Acp29AB region was analyzed, considering the complete region and its different functional parts (Table 2). The comparison between the two African populations showed the lowest Fst estimates, and although there was generally marginal statistical significance, in one case there was greater statistical support for differentiation (P = 0.014). However, the sample from Montblanc showed in all cases a significant differentiation from the African samples.


 
View this table:
In this window
In a new window

 
Table 2. Genetic differentiation

The Acp29AB gene is located in a region of high recombination (KLIMAN and HEY 1993 Down). In the ~1.7-kb region studied, the four-gamete test (HUDSON and KAPLAN 1985 Down) detected 7, 11, and 11 recombination events in the history of the samples from Montblanc, Lamto, and Malawi, respectively. Linkage disequilibrium between informative sites (for which the rarest variant is present more than once in the sample) was estimated separately for each population, as significant pairwise association between polymorphic sites can result from admixture of differentiated populations. The percentages of comparisons that showed a significant association using the {chi}2 test were 28, 16, and 8% for Montblanc, Lamto, and Malawi, respectively. Only in the sample from Montblanc was there some clustering of linkage disequilibria.

Silent nucleotide polymorphism and divergence:
Table 1 gives a summary of silent and/or synonymous nucleotide divergence. As in the case of polymorphism, the highest estimate corresponds to synonymous divergence and the lowest to the 3' flanking region. As shown in Figure 2, levels of silent polymorphism and divergence seem to vary concordantly along the region studied. The Hudson, Kreitman, and Aguadé (HKA) test (HUDSON et al. 1987 Down), which compares polymorphism and divergence in two regions, was applied to silent variation. The region studied was divided into 5' flanking and rest, 5' flanking and coding, and coding and 3' flanking; in none of the population samples did the different HKA tests reveal any departure from the neutral expectation of a direct relationship between levels of polymorphism and divergence (results not shown). Unlike the HKA test, the different tests of heterogeneity in the ratio of polymorphism to divergence across a given DNA region developed by MCDONALD 1996 Down, MCDONALD 1998 Down do not require any a priori partition of the region studied. When these tests were applied to the Acp29AB region, no heterogeneity was detected (results not shown).



View larger version (13K):
In this window
In a new window
Download PPT slide
 
Figure 2. Sliding window plot of silent polymorphism ({pi}) in the sample from Lamto and divergence (K) between this population and D. simulans, plotted using a window of 200 silent nucleotides. Silent polymorphism was multiplied by the time of divergence as estimated by the HKA test. The box on the x-axis represents the coding region. Nucleotide positions were numbered according to the sequence in WOLFNER et al. 1997 Down.

Amino acid replacement polymorphism and divergence:
Six replacement polymorphisms were detected in the Acp26AB protein (Figure 3). Three polymorphisms (at residues 59, 113, and 153) segregated in the three populations. Although they were all present at intermediate frequencies in the combined sample, only the two variants at residue 153 (Met/Lys) were present at similar frequencies in the three population samples: 0.33, 0.29, and 0.38 for the less frequent variant in Montblanc, Lamto, and Malawi, respectively. The two putative glycosylation sites (WOLFNER et al. 1997 Down) were monomorphic in D. melanogaster and conserved between species. In contrast, of the eight putative peptidase cleavage sites described in D. melanogaster (WOLFNER et al. 1997 Down), two were polymorphic in this species (at residues 29 and 113), and no putative cleavage sites were present in D. simulans at residues 29, 97, and 112.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 3. Amino acid replacement haplotypes and their absolute frequencies in three natural populations of D. melanogaster. Numbers in the first row indicate the amino acid residue in the D. melanogaster protein. Dots indicate same amino acid as in the first sequence. The bottom line shows the amino acids present in D. simulans in those sites. Mo, Montblanc; La, Lamto; Ma, Malawi; mel, D. melanogaster.

According to neutral predictions the ratio of nonsynonymous to synonymous changes should be the same within and between species. The McDonald and Kreitman (MK) test (MCDONALD and KREITMAN 1991 Down) contrasts this prediction by comparing the number of nonsynonymous and synonymous changes that are polymorphic within species and fixed between species. This test was applied separately to each population and to the combined data set (Table 3). In all cases there was an excess of fixed nonsynonymous changes, which was significant (for Montblanc and Lamto) or marginally significant (for Malawi and the complete data set).


 
View this table:
In this window
In a new window

 
Table 3. McDonald and Kreitman tests


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Nucleotide polymorphism and divergence:
As in previous studies of nucleotide variation that included African samples of D. melanogaster (BEGUN and AQUADRO 1993 Down, BEGUN and AQUADRO 1995 Down; AGUADE 1998 Down), variation at the Acp29AB region was higher in the African populations than in the European population, and this latter population showed a higher level of linkage disequilibrium. Also, genetic differentiation at this region was highly significant between the European population and any of the two African populations. In a similar way to the Acp26A region (AGUADE 1998 Down) but unlike that previously reported for the Adh region (BENASSI and VEUILLE 1995 Down; see, however, VEUILLE et al. 1998 Down), the African populations were either marginally or slightly differentiated.

The levels of silent polymorphism and divergence vary along the region studied (Figure 2). As reported for other genes, variation at synonymous sites of the Acp29AB gene was higher than in its flanking regions, which indicates stronger selective constraints in those regions. The 3' flanking region showed the lowest estimates even when only the 185 nucleotides between the Acp29AB coding region and the detected open reading frame were considered: {pi} = 0.0072 and K = 0.103. If this open reading frame was a functional gene, the intergenic region would not only contain the Acp29AB trailer but also some regulatory sequences of this new gene, which would also contribute to constraining variation at this region.

Nucleotide sequence variation and function:
Although function can only be established experimentally, studies of nucleotide sequence variation have been often used to implicate selection and functional constraint. Generally, those studies have involved comparison of distantly related species, and the presence of highly conserved sequences has been considered an indication of functional constraint and, therefore, of purifying selection acting on those regions. Here, we have compared sequences from the same species and from a very closely related species. Consequently, our approach was different, and we looked specifically for variation at putative functional sequences. Figure 4 shows three different sequences of the Acp29AB trailer region found in our survey. D. melanogaster populations segregate for an 11-bp deletion that includes the previously described polyadenylation signal (WOLFNER et al. 1997 Down). However, a new poly(A) addition signal results from this deletion (Figure 4), which is displaced three nucleotides from the polyadenylation signal described by WOLFNER et al. 1997 Down. Although D. simulans also presents an 8-bp deletion in that region relative to D. melanogaster, this deletion does not affect the polyadenylation signal.



View larger version (13K):
In this window
In a new window
Download PPT slide
 
Figure 4. Nucleotide and length changes affecting the polyadenylation signal in D. melanogaster (first two rows) and D. simulans (last row). Boxed nucleotides indicate the polyadenylation signal. Arrows on top of the first sequence indicate the extent of an 11-bp deletion segregating in D. melanogaster that causes a 3-bp displacement of the polyadenylation signal. Arrowheads below the first sequence indicate a deletion that differentiates D. simulans from D. melanogaster.

Some amino acid replacement changes affect putative peptidase cleavage sites both within and between species. Corresponding to the sites segregating in D. melanogaster (at residues 29 and 113), D. simulans has the less frequent variant in D. melanogaster, which at residue 29 is characterized by the loss of a peptidase cleavage sequence. In the case of residue 29, the loss-of-site variant is present only once in the sample from Malawi. In contrast, at residue 113 it segregates in all three populations and in the complete sample it is present at high frequency (61.5%). As D. simulans has lost the putative cleavage site at residue 112, it is tempting to speculate that in this species the cleavage site at residue 113 might be functional. On the other hand, in D. melanogaster the gain of function at residue 112 might compensate for the loss-of-function variant segregating at residue 113. Also, two of the changes fixed between species might be compensatory. In fact, in both D. melanogaster and D. simulans there is one additional but different putative cleavage site close to the conserved sites at residues 202 and 203: at residue 204 in D. melanogaster and at residue 201 in D. simulans. If these additional sites were functional and sites 202 and 203 were not, the loss in D. simulans of site 204 might compensate the gain of site 201.

Nonsynonymous variation and selection:
Unlike the case of the Acp26Aa gene where the Ka/Ks ratio was close to one in the D. melanogaster vs. D. simulans comparison, for the Acp29AB gene this ratio is lower than one. This would indicate that Acp29AB, like Acp26Ab and Acp70A, has more constraints on its variation than Acp26Aa. However, in the case of the Acp29AB gene the Ka/Ks ratio was threefold higher than the {pi}a/{pi}s ratio for the complete data set 0.327 and 0.09, respectively. As previously mentioned (see RESULTS), if variation in this region were neutral, one would expect this ratio to be the same. Meanwhile, the fixation of advantageous amino acid replacement changes would cause a deviation of this ratio from constancy due to a higher than expected nonsynonymous divergence. Similarly to synonymous polymorphism, the estimated synonymous divergence (Ks) between D. melanogaster and D. simulans lies on the upper part of the range of estimates for other genes, which indicates that the deviation from a constant ratio is due to a higher than expected nonsynonymous divergence (Ka). In fact, application of the MK test to the different populations surveyed and to the complete D. melanogaster sample revealed a significant or marginally significant excess of nonsynonymous fixed differences between D. melanogaster and D. simulans (Table 3). This indicates that at least after the split of the D. melanogaster and D. simulans lineages the evolution of the Acp29AB protein was driven by directional selection.

The Acp29AB gene is not, however, depauperate of genetic variation as would be expected a priori for a region having suffered the fixation of advantageous amino acid replacements. Different scenarios would be compatible with this observation. If as proposed by CIVETTA and SINGH 1998 Down the burst of amino acid replacements in sex-related genes occurred very close to speciation (2.5 mya), the time back to those selective sweeps would be longer than the expected time of coalescence of extant variation in D. melanogaster (EANES et al. 1996 Down; AGUADE 1998 Down). On the other hand, if as suggested by TSAUR et al. 1998 Down the fixation of amino acid replacement mutations were due to a weak advantage of such mutations, the extent of the region affected by the corresponding selective sweep might be rather short and its footprint on nucleotide diversity difficult to detect. Lack of the sequences of D. mauritiana and D. sechellia for the Acp29AB region has precluded unambiguous establishment of the ancestral state of the detected polymorphisms and, therefore, has prevented the test proposed by these authors on the frequency spectrum of new mutations. However, a preliminary analysis based on only the D. melanogaster-D. simulans comparison did not reveal any excess of sites with the new nucleotide in high frequency (analysis not shown).

There is one last scenario to be discussed, which complements the scenario proposed by CIVETTA and SINGH 1998 Down: the possibility of directional selection having driven the amino acid replacement fixations between species in the early stages of speciation and some sort of balancing selection maintaining variation in D. melanogaster populations. This would be a somewhat similar scenario to that for the Adh locus, where positive selection has driven the evolution of the Adh protein in the melanogaster group (MCDONALD and KREITMAN 1991 Down), and balancing selection is maintaining the AdhF/AdhS allozyme polymorphism in D. melanogaster populations (KREITMAN and AGUADE 1986 Down; KREITMAN and HUDSON 1991 Down; BERRY and KREITMAN 1993 Down). In the case of the Acp29AB gene, there is no clear evidence of its polymorphism being adaptive. There is, however, some indication in that sense from the study by CLARK et al. 1995 Down that showed a significant difference between males homozygous for the two SSCP morphs detected for this gene in their ability to defend against sperm displacement.

The possible involvement of Acp29AB in sperm displacement will have to be assessed by functional studies. If variation at this protein affected this or some other component of fitness, any of the three amino acid replacement polymorphisms that segregate in the three populations surveyed might be candidates for being the targets of selection. It is easy to speculate how changes in those residues might affect the function of the Acp29AB protein and, therefore, contribute to the detected differences of fitness. For example, residues 131–214 in the C-terminal part of the Acp29AB protein show similarity at the primary sequence and predicted tertiary structure levels with carbohydrate recognition domains (CRDs; W. SWANSON, personal communication). Two of the amino acids reported here as variable, residues 153 and 214, would map within this CRD. Perhaps changes at these positions are functionally important, modifying the CRD's carbohydrate recognition specificity. Interestingly, variants at residue 153 segregate at rather similar frequencies in the three populations, which might also suggest that this residue is a candidate for contributing to putative fitness differences.

If selection were acting to maintain an amino acid polymorphism, one would expect that variants surrounding that site were at linkage disequilibrium. Also, if selection were maintaining the same alleles in the whole distribution area of the species, the same clustering of linkage disequilibria would be expected in the different populations surveyed. However, the extent of the region exhibiting linkage disequilibrium might be rather short in a region of high recombination like the Acp29AB region (see above). This, together with the distribution of polymorphisms, might have hindered the detection of linkage disequilibrium in all three populations. Balancing selection leaves a characteristic footprint at linked neutral sites, causing a deviation in the frequency spectrum toward an excess of polymorphic sites with variants at intermediate frequencies. Also, an excess of synonymous polymorphism is expected to result from an old balanced polymorphism. Neither the HKA test nor the McDonald heterogeneity tests detected any excess of synonymous polymorphism in the Acp29AB coding region. The Tajima test and the Fu and Li tests, which contrast the frequency and distribution of variants, respectively, did not detect any deviation from neutral expectations when the whole region studied was considered. However, the test statistics presented negative nonsignificant values for the two flanking regions, while values for the coding region (both in Lamto and Malawi) were positive and in some cases significantly different from zero, an indication of variants maintained at intermediate frequencies. The scenario that combines positive selection at the early stages of speciation and balancing selection (either overdominant selection or frequency-dependent selection) would better explain most of the characteristics revealed by the present data on nucleotide variation at the Acp29AB region in conjunction with those by CLARK et al. 1995 Down.

All Acp genes surveyed to date for nucleotide variation in populations of D. melanogaster (Acp26Aa and Acp26Ab, AGUADE et al. 1992 Down; AGUADE 1998 Down; TSAUR et al. 1998 Down; Acp29AB, present work; and Acp70A, CIRERA and AGUADE 1997 Down) are located in this species in regions of high recombination. The level of silent/synonymous variation in those gene regions is rather high, but comparable to that of other non-sex-related genes also located in regions of high recombination. On the other hand, their level of nonsynonymous variation varies among genes, although in general it is higher than for other non-sex-related genes (CIVETTA and SINGH 1998 Down). For only the two longer genes (Acp26Aa and Acp29AB) has comparison of intra- and interspecific variation revealed that positive selection has driven the evolution of the corresponding proteins, i.e., that at least some of the amino acid replacements fixed after the split of the D. melanogaster and D. simulans lineages were adaptive and, therefore, fixed by directional positive selection. On the other hand, the level of nonsynonymous polymorphism is higher for the Acp26Aa than for the Acp29AB gene. We propose that the different pattern of amino acid replacement variation present in those genes in extant populations might be due to both different selective constraints on amino acid changes and balancing selection maintaining variation only in Acp-29AB.


*  ACKNOWLEDGMENTS

I thank Michel Veuille and Véronique Bénassi for the African lines and for sharing unpublished information on the chromosomal polymorphism of these lines, Julio Rozas for sharing version 2.92 of the DnaSP program, W. Swanson for comments on the manuscript and for sharing unpublished results, the Bowling Green Stock Center for the Df(2L)TE29Aa-11/CyO line, and Serveis Científico-Tècnics from Universitat de Barcelona for automated sequencing facilities. Special thanks are given to M. F. Wolfner for the mst319.5 plasmid and for sharing the Acp29AB gene sequence before publication, but mainly for her insightful comments on the manuscript; and to D. Salguero for his excellent technical assistance. This work was supported by grants PB94-0923 from Dirección General de Investigación Científica y Técnica, Spain, and 1997SGR-59 from Comissió Interdepartamental de Recerca i Tecnologia, Generalitat de Catalunya.

Manuscript received November 10, 1998; Accepted for publication February 22, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AGUADÉ, M., 1998  Different forces drive the evolution of the Acp26Aa and Acp26Ab genes in the melanogaster species complex. Genetics 150:1079-1089[Abstract/Free Full Text].

AGUADÉ, M., N. MIYASHITA, and C. H. LANGLEY, 1992  Polymorphism and divergence in the Mst26A male accessory gland gene region in Drosophila. Genetics 132:755-770[Abstract].

ASHBURNER, M., 1989 Drosophila, A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BEGUN, D. J. and C. F. AQUADRO, 1993  African and North American populations of Drosophila melanogaster are very different at the DNA level. Nature 356:519-520.

BEGUN, D. J. and C. F. AQUADRO, 1995  Molecular variation at the vermillion locus in geographically diverse populations of Drosophila melanogaster and D. simulans.. Genetics 140:1019-1032[Abstract].

NASSI, V. and M. VEUILLE, 1995  Comparative population structuring of molecular and allozyme variation of Drosophila melanogaster Adh between Europe, West Africa and East Africa. Genet. Res. 65:95-103[Medline].

NASSI, V., S. AULARD, S. MAZEAU, and M. VEUILLE, 1993  Molecular variation of Adh and P6 genes in African populations of Drosophila melanogaster and its relation to chromosomal inversions. Genetics 134:789-799[Abstract].

BERRY, A. and M. KREITMAN, 1993  Molecular analysis of an allozyme cline: alcohol dehydrogenase in Drosophila melanogaster on the east coast of North America. Genetics 134:869-893[Abstract].

CIRERA, S. and M. AGUADÉ, 1997  Evolutionary history of the sex-peptide (Acp70A) gene region in Drosophila melanogaster.. Genetics 147:189-197[Abstract].

CIVETTA, A. and R. S. SINGH, 1998  Sex-related genes, directional sexual selection, and speciation. Mol. Biol. Evol. 15:901-909[Abstract].

CLARK, A. G. and T.-U. KAO, 1991  Excess nonsynonymous substitutions at shared sites among self-incompatibility alleles of Solanaceae. Proc. Natl. Acad. Sci. USA 88:9823-9827[Abstract/Free Full Text].

CLARK, A. G., M. AGUADÉ, T. PROUT, L. HARSHMAN, and C. H. LANGLEY, 1995  Variation in sperm displacement and its association with accessory gland protein loci in Drosophila melanogaster.. Genetics 139:189-201[Abstract].

DIBENEDETTO, A. J., H. A. HARADA, and M. F. WOLFNER, 1990  Structure, cell specific expression, and mating-induced regulation of a Drosophila melanogaster male accessory gland gene. Dev. Biol. 139:134-148[Medline].

EANES, W. F., M. KIRCHNER, J. YOON, C. H. BIERMANN, and I-N. WANG et al., 1996  Historical selection, amino acid polymorphism and lineage-specific divergence at the G6pd locus in Drosophila melanogaster and D. simulans.. Genetics 144:1027-1041[Abstract].

FU, Y. X. and W-S. LI, 1993  Statistical tests of neutrality of mutations. Genetics 133:693-709[Abstract].

HERNDORN, L. A. and M. F. WOLFNER, 1995  A Drosophila seminal fluid protein, Acp26Aa, stimulates egg-laying in females for one day after mating. Proc. Natl. Acad. Sci. USA 92:10114-10118[Abstract/Free Full Text].

HUDSON, R. R. and N. L. KAPLAN, 1985  Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111:147-164[Abstract/Free Full Text].

HUDSON, R. R., M. KREITMAN, and M. AGUADÉ, 1987  A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159[Abstract/Free Full Text].

HUDSON, R. R., M. SLATKIN, and W. P. MADDISON, 1992a  Estimation of levels of gene flow from DNA sequence data. Genetics 132:583-589[Abstract].

HUDSON, R. R., D. D. BOOS, and N. L. KAPLAN, 1992b  A statistical test for detecting geographic subdivision. Mol. Biol. Evol. 9:138-151[Abstract].

HUGHES, A. L. and M. NEI, 1988  Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature 335:167-170[Medline].

HUGHES, A. L. and M. NEI, 1990  Positive darwinian selection promotes charge profile diversity in the antigen-binding cleft of Class I major-histocompatibility-complex molecules. Mol. Biol. Evol. 7:515-524[Abstract].

JUKES, T. H., and C. R. CANTOR, 1969 Evolution of protein molecules, pp. 21–120 in Mammalian Protein Metabolism, edited by H. M. MUNRO. Academic Press, New York.

KAROTAM, J., A. C. DELVES, and J. G. OAKESHOTT, 1993  Conservation and change in structural and 5' flanking sequences of esterase 6 in sibling species of Drosophila. Genetica 88:11-28[Medline].

KLIMAN, R. M. and J. HEY, 1993  Reduced natural selection associated with low recombination in Drosophila melanogaster.. Mol. Biol. Evol. 10:1239-1258[Abstract].

KREITMAN, M. and M. AGUADÉ, 1986  Excess polymorphism at the Adh locus in Drosophila melanogaster.. Genetics 114:93-110[Abstract/Free Full Text].

KREITMAN, M. and R. R. HUDSON, 1991  Inferring the evolutionary histories of the Adh and Adh-dup loci in Drosophila melanogaster from patterns of polymorphism and divergence. Genetics 127:565-582[Abstract].

LEE, Y. and V. D. VACQUIER, 1995  Positive selection is a general phenomenon in the evolution of abalone sperm lysin. Mol. Biol. Evol. 12:231-238[Abstract].

MADDISON, W. P., and D. R. MADDISON, 1992 MacClade: Analysis of Phylogeny and Character Evolution, version 3.0. Sinauer Associates, Sunderland, MA.

MCDONALD, J. H., 1996  Detecting nonneutral heterogeneity across a region of DNA sequence in the ratio of polymorphism to divergence. Mol. Biol. Evol. 13:253-260[Abstract].

MCDONALD, J. H., 1998  Improved tests for heterogeneity across a region of DNA sequence in the ratio of polymorphism to divergence. Mol. Biol. Evol. 15:377-384[Abstract].

MCDONALD, J. H. and M. KREITMAN, 1991  Adaptative protein evolution at the Adh locus in Drosophila. Nature 351:652-654[Medline].

METZ, E. C. and S. R. PALUMBI, 1996  Positive selection and sequence rearrangements generate extensive polymorphism in the gamete recognition protein bindin. Mol. Biol. Evol. 13:397-406[Abstract].

NEI, M., 1987 Molecular Evolutionary Genetics. Columbia University Press, New York.

ROZAS, J. and R. ROZAS, 1997  DnaSP version 2.0: a novel software package for extensive molecular population genetics analysis. Comput. Appl. Biosci. 13:307-311.

SIMMERL, E., M. SCHAFER, and U. SCHAFER, 1995  Structure and regulation of a gene cluster for male accessory gland transcripts in Drosophila melanogaster.. Insect. Biochem. Mol. Biol. 25:127-137[Medline].

TAJIMA, F., 1989  Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595[Abstract/Free Full Text].

TSAUR, S.-H. and C.-I. WU, 1997  Positive selection and the molecular evolution of a gene of male reproduction, Acp26Aa, of Drosophila. Mol. Biol. Evol. 14:544-549[Abstract].

TSAUR, S.-H., C.-T. TING, and C.-I. WU, 1998  Positive selection driving the evolution of a gene of male reproduction, Acp26Aa, of Drosophila. II. Divergence versus polymorphism. Mol. Biol. Evol. 15:1040-1046[Abstract].

VEUILLE, M., V. BÉNASSI, S. AULARD, and F. DEPAULIS, 1998  Allele-specific population structure of Drosophila melanogaster at the molecular level. Genetics 149:971-981[Abstract/Free Full Text].

WATTERSON, G. A., 1975  On the number of segregating sites in genetic models without recombination. Theor. Popul. Biol. 7:256-276[Medline].

WOLFNER, M. F., H. A. HARADA, M. J. BERTRAM, T. J. STELICK, and K. W. KRAUS et al., 1997  New genes for male accessory gland proteins in Drosophila melanogaster.. Insect. Biochem. Mol. Biol. 27:825-834[Medline].




This article has been cited by other articles:


Home page
Mol Biol EvolHome page
M. Aguade
Nucleotide and Copy-Number Polymorphism at the Odorant Receptor Genes Or22a and Or22b in Drosophila melanogaster
Mol. Biol. Evol., January 1, 2009; 26(1): 61 - 70.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Wong, S. N. Albright, J. D. Giebel, K. R. Ram, S. Ji, A. C. Fiumera, and M. F. Wolfner
A Role for Acp29AB, a Predicted Seminal Fluid Lectin, in Female Sperm Storage in Drosophila melanogaster
Genetics, October 1, 2008; 180(2): 921 - 931.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
Q. Zhou, G. Zhang, Y. Zhang, S. Xu, R. Zhao, Z. Zhan, X. Li, Y. Ding, S. Yang, and W. Wang
On the origin of new genes in Drosophila
Genome Res., September 1, 2008; 18(9): 1446 - 1455.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
F. C. Almeida and R. DeSalle
Evidence of Adaptive Evolution of Accessory Gland Proteins in Closely Related Species of the Drosophila repleta Group
Mol. Biol. Evol., September 1, 2008; 25(9): 2043 - 2053.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. A. McGraw, A. G. Clark, and M. F. Wolfner
Post-mating Gene Expression Profiles of Female Drosophila melanogaster in Response to Time and to Four Male Accessory Gland Proteins
Genetics, July 1, 2008; 179(3): 1395 - 1408.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Llopart and J. M. Comeron
Recurrent Events of Positive Selection in Independent Drosophila Lineages at the Spermatogenesis Gene roughex
Genetics, June 1, 2008; 179(2): 1009 - 1020.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. Wong, M. C. Turchin, M. F. Wolfner, and C. F. Aquadro
Evidence for Positive Selection on Drosophila melanogaster Seminal Fluid Protease Homologs
Mol. Biol. Evol., March 1, 2008; 25(3): 497 - 506.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
M. D. Dean, J. M. Good, and M. W. Nachman
Adaptive Evolution of Proteins Secreted during Sperm Maturation: An Analysis of the Mouse Epididymal Transcriptome
Mol. Biol. Evol., February 1, 2008; 25(2): 383 - 392.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
W. Haerty, S. Jagadeeshan, R. J. Kulathinal, A. Wong, K. Ravi Ram, L. K. Sirot, L. Levesque, C. G. Artieri, M. F. Wolfner, A. Civetta, et al.
Evolution in the Fast Lane: Rapidly Evolving Sex-Related Genes in Drosophila
Genetics, November 1, 2007; 177(3): 1321 - 1335.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. J. Wagstaff and D. J. Begun
Adaptive Evolution of Recently Duplicated Accessory Gland Protein Genes in Desert Drosophila
Genetics, October 1, 2007; 177(2): 1023 - 1030.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
M. K. N. Lawniczak and D. J. Begun
Molecular population genetics of female-expressed mating-induced serine proteases in Drosophila melanogaster
Mol. Biol. Evol., September 1, 2007; 24(9): 1944 - 1951.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. C. Fiumera, B. L. Dumont, and A. G. Clark
Associations Between Sperm Competition and Natural Variation in Male Reproductive Genes on the Third Chromosome of Drosophila melanogaster
Genetics, June 1, 2007; 176(2): 1245 - 1260.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Sanchez-Gracia and J. Rozas
Unusual Pattern of Nucleotide Sequence Variation at the OS-E and OS-F Genomic Regions of Drosophila simulans
Genetics, April 1, 2007; 175(4): 1923 - 1935.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Proschel, Z. Zhang, and J. Parsch
Widespread Adaptive Evolution of Drosophila Genes With Sex-Biased Expression
Genetics, October 1, 2006; 174(2): 893 - 900.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
L. M. Turner and H. E. Hoekstra
Adaptive Evolution of Fertilization Proteins within a Genus: Variation in ZP2 and ZP3 in Deer Mice (Peromyscus)
Mol. Biol. Evol., September 1, 2006; 23(9): 1656 - 1669.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J. A. Andres, L. S. Maroja, S. M. Bogdanowicz, W. J. Swanson, and R. G. Harrison
Molecular Evolution of Seminal Proteins in Field Crickets
Mol. Biol. Evol., August 1, 2006; 23(8): 1574 - 1584.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. J. Begun, H. A. Lindfors, M. E. Thompson, and A. K. Holloway
Recently Evolved Genes Identified From Drosophila yakuba and D. erecta Accessory Gland Expressed Sequence Tags
Genetics, March 1, 2006; 172(3): 1675 - 1681.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. J. Wagstaff and D. J. Begun
Molecular Population Genetics of Accessory Gland Protein Genes and Testis-Expressed Genes in Drosophila mojavensis and D. arizonae
Genetics, November 1, 2005; 171(3): 1083 - 1101.
[Abstract] [Full Text] [PDF]