Genetics, Vol. 151, 1459-1470, April 1999, Copyright © 1999

Dna2 Mutants Reveal Interactions with Dna Polymerase {alpha} and Ctf4, a Pol {alpha} Accessory Factor, and Show That Full Dna2 Helicase Activity Is Not Essential for Growth

Tim Formosaa and Thalia Nittisa
a Department of Biochemistry, University of Utah School of Medicine, Salt Lake City, Utah 84132

Corresponding author: Tim Formosa, Department of Biochemistry, University of Utah School of Medicine, 50 N. Medical Dr., Salt Lake City, UT 84132., formosa{at}medschool.med.utah.edu (E-mail)

Communicating editor: L. S. SYMINGTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Mutations in the gene for the conserved, essential nuclease-helicase Dna2 from the yeast Saccharomyces cerevisiae were found to interact genetically with POL1 and CTF4, which encode a DNA Polymerase {alpha} subunit and an associated protein, suggesting that Dna2 acts in a process that involves Pol {alpha}. DNA2 alleles were isolated that cause either temperature sensitivity, sensitivity to alkylation damage, or both. The alkylation-sensitive alleles clustered in the helicase domain, including changes in residues required for helicase activity in related proteins. Additional mutations known or expected to destroy the ATPase and helicase activities of Dna2 were constructed and found to support growth on some media but to cause alkylation sensitivity. Only damage-sensitive alleles were lethal in combination with a ctf4 deletion. Full activity of the Dna2 helicase function is therefore not needed for viability, but is required for repairing damage and for tolerating loss of Ctf4. Arrest of dna2 mutants was RAD9 dependent, but deleting this checkpoint resulted in either no effect or suppression of defects, including the synthetic lethality with ctf4. Dna2 therefore appears to act in repair or lagging strand synthesis together with Pol {alpha} and Ctf4, in a role that is optimal with, but does not require, full helicase activity.


THE Ctf4 protein binds to the catalytic subunit of DNA Polymerase {alpha} (Pol1 protein) from the yeast Saccharomyces cerevisiae either as the isolated purified Pol1 protein or as the endogenous Pol {alpha}/primase holoenzyme in cell extracts (MILES and FORMOSA 1992A Down, MILES and FORMOSA 1992B Down; WITTMEYER and FORMOSA 1997 Down). CTF4 is nonessential, but deletions cause defects in DNA metabolism, including elevated levels of chromosome loss and recombination, sensitivity to alkylation damage, synthetic defects in combination with pol1 mutants, and a strong checkpoint-dependent G2 delay. Ctf4 therefore interacts physically and genetically with Pol1 and plays an important but not an essential role in DNA metabolism. Potential homologs of Ctf4 have been identified in Aspergillus nidulans (SepB; HARRIS et al. 1994 Down; HARRIS and HAMER 1995 Down; HARRIS and KRAUS 1998 Down), Xenopus laevis (AND-1; KOHLER et al. 1997 Down), and Homo sapiens (AND-1; KOHLER et al. 1997 Down). This group of proteins shares similarity with the ß subunit of the G protein transducin (KOHLER et al. 1997 Down), which acts as a structural regulator of the catalytic {alpha} subunit (IIRI et al. 1998 Down). On the basis of these properties, we propose that Ctf4 might regulate the assembly or stability of complexes containing Pol {alpha} and other proteins. In this case, introducing mutations into other components of these complexes might make Ctf4 function essential, if two destabilizing effects could not be tolerated simultaneously. To further characterize the role of Ctf4 and to identify other proteins that might act with Pol {alpha}, we screened for mutations that are synthetically lethal with a ctf4 deletion.

One of the mutations identified was an allele of the essential gene DNA2. DNA2 is broadly conserved among eukaryotes, has helicase signature motifs and helicase activity, and is required for DNA synthesis in permeabilized cells, intact cells, and in nuclear extracts (BUDD et al. 1995 Down; BUDD and CAMPBELL 1995B Down; BRAGUGLIA et al. 1998 Down). These observations suggested that Dna2 might be responsible for promoting replication fork movement. However, dna2 mutants progress through S phase with normal kinetics (FIORENTINO and CRABTREE 1997 Down), and the helicase activity of purified Dna2 is quite weak (BUDD and CAMPBELL 1995B Down; BAE et al. 1998 Down). Purified Dna2 has recently been shown to have strong endonuclease activity that acts on single-stranded and double-stranded DNA, and the activity on dsDNA is ATP stimulated (BAE et al. 1998 Down). These properties and the interaction between Dna2 and the Rad27 flap endonuclease (BUDD and CAMPBELL 1997 Down) are more consistent with a role in Okazaki fragment maturation or damage repair. The results presented here link Dna2 to DNA polymerase {alpha}, strengthening the ties to lagging strand synthesis. We also find that mutations known or expected to diminish or obliterate the helicase function of Dna2 still allow growth but cause sensitivity to alkylation damage and inability to tolerate loss of Ctf4 function. These results further deemphasize the role of the helicase activity of Dna2 and suggest that Dna2 and Ctf4 proteins act together in some forms of damage repair.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Media and strains:
Media were as described (HARTWELL 1967 Down; ROSE et al. 1990 Down). Strains used are listed in Table 1.


 
View this table:
In this window
In a new window

 
Table 1. Strains used

Synthetic lethal screen:
A ctf4 synthetic lethal screen was performed essentially as described (BENDER and PRINGLE 1991 Down). Strains with ctf4, ade2, and ade3 mutations unable to survive loss of a YEp-CTF4-ADE3 plasmid (pTF90) were identified as red colonies without white sectors after irradiation with UV to ~7% survival. Strains that regained plasmid loss upon complementation with a normal strain or a YEp-CTF4 plasmid were examined further. Of ~22,000 clones screened, eight independent mutants that appear to make CTF4 essential were obtained.

Plasmids:
pTF90 was derived from pRS426 (CHRISTIANSON et al. 1992 Down) by insertion of an engineered BamHI fragment containing the CTF4 gene from nucleotides -487 to +3961 relative to the first codon, and insertion of a 3830-bp BamHI-EcoRI fragment containing ADE3. A low copy number genomic library in p366 (a generous gift from F. Spencer and P. Hieter, Johns Hopkins University) was screened to obtain pTF98 (YCp-DNA2) by complementation of one of the nonsectoring mutants. pTF106 is YIplac204 (GIETZ and SUGINO 1988 Down) with 844-bp BamHI-Sau3A and 2228-bp HindIII-BamHI fragments flanking DNA2 inserted. Digestion of pTF106 with BamHI and integration into the genome produced a deletion from 153 bp upstream to 166 bp downstream of the DNA2 reading frame [dna2-{Delta}2(::TRP1)], and also removed the last 10 residues of SOL3. pJB20 was derived from pTF98 by subcloning the 7960-bp BamHI fragment containing DNA2 into pHSS6 (HOEKSTRA et al. 1991 Down). pJB21, pTF118, and pTN3 have the 5709-bp EcoRI-PstI fragment containing DNA2 and no other complete gene inserted into YCplac33, YCplac111, and YEplac195 (GIETZ and SUGINO 1988 Down), respectively.

Site-directed mutagenesis:
The 2272-bp XbaI-PstI fragment containing the helicase domain of DNA2 was subcloned into pBlueScript II (Stratagene, La Jolla, CA) and mutagenized using the Quikchange system (Stratagene). GGAATGCCAGGGACTGGTACCACTACTGTTATCGCAG and its complement were used to introduce K1080T (and a KpnI site; mutation of this invariant lysine to any other residue destroys ATPase activity, so K1080T should be equivalent to the previously described K1080E allele; BUDD et al. 1995 Down; BAE et al. 1998 Down), and GTGATTTTGGCAGCTGCAAGTCAAATTTCAATGCCTGTCGCTTTGGG and its complement were used to introduce D1186A and E1187A (and a PvuII site). The altered XbaI-PstI fragments were then swapped for the normal fragment in pTF118. The final derivatives were sequenced from the XbaI site to the end of the Dna2 open reading frame (ORF) to confirm that only the expected mutations were introduced.

Transposons:
Tn1000 mutagenesis was performed as described (MORGAN et al. 1996 Down). A mini-Tn3(URA3) lacking EcoRI sites was used as described (HOEKSTRA et al. 1991 Down) to disrupt the insert in pJB20. Linear fragments were produced by EcoRI digestion of the resulting plasmids and used to transform strain 7236.

Isolation of additional dna2 mutants:
pTF98 (YCp, DNA2, LEU2) was treated with 1 M hydroxylamine for 20–40 min at 75° as described (SIKORSKI and BOEKE 1991 Down). Strain 7577-1-3 pJB21 [dna2-{Delta}2(::TRP1) with a low copy DNA2 plasmid marked with URA3] was transformed with the mutagenized pTF98. Transformants were replica plated to medium containing 5-fluoro-orotic acid (5-FOA; BOEKE et al. 1987 Down) and isolates lacking pJB21 were then tested for ability to grow on YEPD agarose at 13°, 23°, 36°, and 23° with 0.01% methanesulfonic acid methyl ester (MMS; Sigma, St. Louis). The pTF98 derivative was recovered from candidates by transformation into Escherichia coli, and retransformed into 7577-1-3 pJB21 for retesting. For a subset of the mutations, strain 7687 [dna2-{Delta}3(::URA3)] with a mutated pTF98 plasmid was screened for spontaneous conversion of the genomic deletion by plating on medium containing 5-FOA and testing isolates for loss of the plasmid. Southern blots were used to confirm clean conversion of the genomic locus. These strains (7720-x) contained the dna2-x mutations in a normal genomic context.

Telomere lengths:
DNA was extracted from saturated cultures as described (ROSE et al. 1990 Down), digested with XhoI, then electrophoresed through 0.7% agarose gels and transferred to Nytran (Schleicher and Schuell, Keene, NH). Telomere repeats were detected with a poly d(GT)·poly d(AC) probe (Pharmacia, Piscataway, NJ) labeled with [{alpha}-32P]dCTP and random primers as described (CARSON and HARTWELL 1985 Down; AUSUBEL et al. 1994 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

A mutation that is synthetically lethal with a deletion of CTF4 maps to DNA2:
A mutation that caused the Pol {alpha}-binding protein Ctf4 to be essential for viability was identified and found to segregate as a single locus. A low copy number plasmid containing DNA2 and two other genes was found to complement this lethality (Figure 1). A series of transposon insertions demonstrated that complementation was due to DNA2 (Figure 1). The synthetically lethal mutation was therefore either in DNA2 or was suppressed by a low copy DNA2 plasmid.



View larger version (13K):
In this window
In a new window
Download PPT slide
 
Figure 1. The DNA2 region. A 9300-bp genomic fragment in pTF98 that restored sectoring to a ctf4 synthetic lethal mutant was found to contain DNA2 and two other complete ORFs (arrows). Tn1000 disruptions in this plasmid destroyed or retained complementation (+ or -) as shown. A URA3-marked mini-Tn3 (HOEKSTRA et al. 1991 Down) was also introduced into pJB20, and these linear fragments were transplaced into the diploid 7236. The ability to produce viable Ura+ haploids after sporulation was scored as shown. A portion of SOL3 was replaced with LEU2 in WT or dna2-2 strains yielding the sol3-{Delta}(::LEU2) and dna2-2 sol3-{Delta}(::LEU2) alleles. Restriction sites shown are B (BamHI), P (PstI), R (EcoRI), and X (XbaI).

Mini-Tn3(URA3) transposon disruptions of the DNA2 region (HOEKSTRA et al. 1991 Down) were inserted into the genome. Consistent with previous results indicating that DNA2 is essential (BUDD and CAMPBELL 1995B Down), disruptions within this gene were lethal (Figure 1). Disruptions downstream of DNA2 were viable, and one of these was crossed to a strain with the original ctf4 synthetic lethal mutation. Haploid spores derived from this cross revealed that the marked transposon segregated in every case with the ability to lose the CTF4-ADE3 plasmid. The synthetic lethal mutation was therefore linked to the DNA2 locus and was therefore designated dna2-2.

To facilitate identification of dna2-2 in subsequent crosses, the adjacent gene SOL3 (SHEN et al. 1996 Down) was deleted and replaced with LEU2 in dna2-2 and DNA2 strains (Figure 1). After three backcrosses of dna2-2 marked this way, a cross to a ctf4 strain was performed. No double mutants with ctf4 were observed in 32 viable haploids from 12 tetrads, while the parallel cross with sol3-{Delta}(::LEU2) adjacent to the normal DNA2 gene produced eight double mutants among 36 viable spores, which is close to the expected 25%. This confirms that the synthetic lethality with ctf4 is tightly linked to dna2-2.

The original dna2-1 allele was temperature sensitive (BUDD and CAMPBELL 1995B Down) but dna2-2 strains grew at 11° and 38° (not shown), indicating fundamental differences between these mutations. We therefore tested dna2-1 for defects in combination with ctf4 to see if the synthetic lethality associated with dna2-2 was allele specific. No double mutants were detected among 91 viable spores from 48 tetrads derived from a cross between ctf4 and dna2-1 strains, indicating that this combination is also lethal. Double mutants were recovered at the expected frequency when the diploid was transformed with either DNA2 or CTF4 plasmids, but these haploids were unable to survive loss of the plasmids as demonstrated by counterselection using 5-FOA (not shown). This demonstrates that the synthetic lethality of dna2-1 and ctf4 is not due to a germination defect.

Additional interactions with ctf4 and dna2-2:
BUDD and CAMPBELL 1997 Down found that partially purified preparations of Dna2 contained some of the flap endonuclease encoded by the RAD27 gene, that Dna2 and Rad27 proteins coimmunoprecipitated, and that a rad27 deletion was inviable in combination with dna2-1. A deletion of RAD27 (REAGAN et al. 1995 Down) was found to be lethal with dna2-1, dna2-2, and ctf4-{Delta} (30 tetrads examined for each) but not with any of three POL1 alleles, indicating some specificity of the genetic interaction. To further address the issue of specificity, we constructed double mutants with a variety of conditional temperature-sensitive (ts) cell division cycle (cdc) mutants with defects in different cellular processes (Table 2). Most combinations were viable, and grew as well as the single cdc mutants, as assayed by determining the maximal permissive temperature (MPT) for growth of these strains. However, both ctf4 and dna2-2 affected the growth of some pol1 mutants. For example, the cdc17-1 mutant displayed a decrease in plating efficiency of at least 104-fold at 33° when combined with either ctf4 or dna2-2. The only additional lethal interactions that were noted involved proteins that appear to modulate the DNA polymerase {delta}/{epsilon} processivity factor proliferating cell nuclear antigen (PCNA). A conditional mutation in one of the subunits of RF-C, which loads PCNA onto DNA molecules (KORNBERG and BAKER 1992 Down; CULLMANN et al. 1995 Down; MCALEAR et al. 1996 Down), was lethal with ctf4, and both ctf4 and dna2-2 were lethal when combined with a deletion of CHL12, which is a paralog of RFC1 (KOUPRINA et al. 1994 Down; CULLMANN et al. 1995 Down). These results suggest a role for Ctf4 and Dna2 in a process that requires PCNA. Other nonlethal defects that were noted also involved proteins involved in DNA metabolism (Table 2 and DISCUSSION).


 
View this table:
In this window
In a new window

 
Table 2. Mutations in CTF4 and DNA2 alter the growth properties of some, but not all, cdc mutants

A screen for additional alleles of DNA2:
Additional alleles of DNA2 were identified using a plasmid shuffling method (SIKORSKI and BOEKE 1991 Down). Because dna2-1 and dna2-2 alleles caused sensitivity to the alkylating agent MMS (Figure 2), hydroxylamine-mutagenized plasmids were screened for the ability to support growth at 13°, 36°, and in the presence of 0.01% MMS. Of 5500 colonies screened, eight ts alleles, five MMS-sensitive alleles, and two alleles with both phenotypes were recovered (Table 3 and Figure 2). No cold-sensitive alleles were identified. To assess the severity of the phenotypes, mutants were placed on media containing various concentrations of MMS or incubated at various temperatures, and the maximal permissive condition was determined for each allele (Table 3).



View larger version (96K):
In this window
In a new window
Download PPT slide
 
Figure 2. MMS sensitivity of dna2 strains. Strains with wild-type DNA2 (WT; 4053-5-2) or various dna2 alleles (integrated into the genome; dna2-1 is 7628-2-4, dna2-2 is 7588-1-4, and the remainder are 7720-x) as labeled were grown to saturation and aliquots of 10-fold serial dilutions were placed on plates containing 0.006% MMS and photographed after 4 days at 26°.


 
View this table:
In this window
In a new window

 
Table 3. Properties associated with dna2 alleles

We integrated a set of the dna2 alleles into the genome so that the alleles could be examined in their normal context. In every case tested, the integrated version displayed a more stringent phenotype than the plasmid-borne version (Table 3). While the vector that was used for the mutagenesis contained a centromere and was presumably a single copy in most cells, the consistent increase in stringency upon integration suggests that the plasmid context leads to higher expression due to increased transcription or higher gene copy number. In two cases, dna2-1 and dna2-8, the integration of the mutations into the genome revealed sensitivity to MMS that was not observed when the mutations were present on plasmids. This suggests that the function of Dna2 is affected by the level of expression of the gene, and that the ability to tolerate DNA damage is especially sensitive to the amount of Dna2 activity. Consistent with a model in which Dna2 concentration affects its function, we found that increased expression of DNA2 from high copy plasmids or strong promoters was detrimental to the growth of cells (not shown).

Synthetic lethality of dna2 mutants with ctf4 is allele specific:
We attempted to construct ctf4 dna2 double mutants with the new alleles using standard genetic crosses to see if the synthetic lethality observed with dna2-1 and dna2-2 is general. Some dna2 alleles were clearly lethal with ctf4, but others produced viable double mutants at the expected frequency (Table 3). To examine large numbers of events, we used a plasmid loss assay to determine the phenotypes of the dna2 ctf4 combinations. We constructed a strain with deletions of both CTF4 and DNA2 that contained a DNA2 plasmid marked with URA3. The dna2-LEU2 mutant plasmids were then transformed into this strain, and transformants were transferred to medium containing 5-FOA to test for growth of the dna2 ctf4 cells. As shown in Figure 3 and Table 3, both the meiotic segregation and mitotic plasmid loss assays revealed similar effects. The wild-type DNA2 plasmid supported rapid growth of the ctf4-{Delta} dna2-{Delta} strain, as did the dna2 alleles -4, -5, -7, -9, -12, -13, and -15. Alleles dna2-3, -8, -10, and -16 supported growth, but only weakly. Plasmids with alleles dna2-2 (not shown), -6, -11, -14, and -19 failed to support growth, which indicates that these are tight lethals in combination with ctf4. dna2-3, -8, and -16 each gave weak growth in combination with ctf4 in the plasmid assay, but produced no viable double mutants in crosses (dna2-3 is the same as dna2-1; see below). dna2-3 and -8 were also sensitive to MMS only when present as the genomic version, so the acquisition of synthetic lethality upon integration correlates with acquisition of MMS sensitivity and is in keeping with the overall pattern of increased stringency of phenotypes with genomic mutations.



View larger version (75K):
In this window
In a new window
Download PPT slide
 
Figure 3. Interaction between ctf4 and dna2 mutations. Strain 7747-1-3 (dna2-{Delta} ctf4-{Delta}) with pTN3 (YEp, URA3, DNA2) was transformed with pTF98 (YCp, LEU2, DNA2; pDNA2), the parent vector p366 (YCp, LEU2; vector), or the pTF98 derivatives containing the dna2 mutant alleles as labeled. Transformants were grown to saturation under leucine selection, then aliquots of 10-fold serial dilutions were placed on medium lacking leucine to determine total viability, and on medium containing 5-FOA to detect loss of pTN3. Growth on 5-FOA therefore indicates the phenotype of cells lacking ctf4 and carrying only the DNA2 allele on the plasmid.

The correlation of MMS sensitivity with ctf4 synthetic lethality was found to be general: alleles scored as MMS sensitive were lethal with ctf4, and MMS-resistant (ts only) mutations allowed loss of CTF4 (Table 3 and Figure 4). dna2 mutants that cannot survive chronic exposure to DNA damage are therefore also unable to tolerate mutation of CTF4.



View larger version (9K):
In this window
In a new window
Download PPT slide
 
Figure 4. Clustering of dna2 mutations and common phenotypes. The location of dna2 mutations determined by nucleotide sequencing is shown relative to the 1522-residue Dna2 protein. Alleles causing temperature sensitivity (solid blocks below the ORF), MMS sensitivity (gray blocks above the ORF), and viability (open circles) or lethality (solid circles) in combination with ctf4 are indicated. Gray circles indicate alleles that supported weak growth in the plasmid assay for compatibility with ctf4, but were lethal with ctf4 when tested in a genomic context. Solid horizontal bars indicate blocks of sequence with similarity among six Dna2 orthologs aligned, as well as a seventh region with weaker similarity in gray. The seven motifs common to the helicase superfamily I fall within the four C-terminal homology blocks and are labeled with Roman numerals. Alleles with multiple changes detected are shown with the alteration of the most likely residue responsible for the phenotype indicated with a more prominent symbol. The mutations are dna2-1 and -3 (P504S), -2 (R1253Q), -4 (D1015N P1031L), -5 (H471Y), -6 (Q1518Stop), -7 (G913D), -8 (H1129Y), -9 (A1036V P1031S), -10 (P789L, S829L, A871V), -11 (E1297K, G1397S), -12 (H471Y), -13 (P1311L, T1312I), -14 (P1040L), -15 (G446A, R521K), -16 (G1350E), and -19 (E1387K).

In contrast to the allele specificity observed for the lethality of dna2 alleles with ctf4, all dna2 alleles tested were lethal in combination with a rad27 deletion (Table 3). This included alleles that caused temperature sensitivity, MMS sensitivity, or both, and alleles that did or did not tolerate deletion of CTF4. Cells lacking the flap endonuclease Rad27 therefore require optimal performance of all of the functions of Dna2 affected by the alleles tested.

Sequence changes in dna2 alleles:
Nucleotide sequence from the dna2 plasmids was used to determine the mutations in each allele (Figure 4). The entire ORF was sequenced for alleles dna2-1, -2, -11, and -15 to ensure that only the mutations noted were present, but only portions (an average of 43% of the ORF) of the remaining alleles were sequenced, leaving the possibility that additional changes also contributed to their phenotypes. Alleles dna2-1 and -15 were chosen to demonstrate that mutations in the conserved nonhelicase regions were sufficient for causing temperature sensitivity, and alleles dna2-2 and -11 were chosen because they affect invariant residues in the helicase motifs (see below). The wild-type sequence of DNA2 from an A364a strain was also determined because dna2-1 and dna2-2, which were isolated from this strain background, were each found to have 27 mutations relative to the standard sequence derived from an S288C strain. Twenty-six of the mutations were found to be common to both mutant alleles and to the A364a WT. The 26 mutations cause 11 amino acid differences, 9 of which are in the poorly conserved first 400 residues of DNA2 that are not needed for helicase or nuclease activities (BAE et al. 1998 Down). This surprisingly high level of divergence between the backgrounds did not affect the properties of the dna2-1 allele, since dna2-3 was found to have the same P504S mutation in the S288C context, and both alleles caused identical phenotypes.

While ts mutations were found throughout the conserved regions of DNA2, seven of the eight MMS-sensitive alleles were clustered in the C-terminal region that contains the helicase motifs (Figure 4). The unique R1253Q mutation in dna2-2 directly altered helicase motif IV. Several versions of this motif are found in the different families that make up helicase superfamily I, but only this arginine residue is invariant among all members of the superfamily (GORBALENYA and KOONIN 1993 Down). dna2-11 had two mutations, E1297K and G1397S. The latter glycine represents the only invariant residue in helicase motif V (GORBALENYA and KOONIN 1993 Down). Site-directed mutagenesis studies of two other superfamily I helicases showed that mutation of either the R in motif IV or the G in motif V impaired the ATPase activity and abolished the helicase activity of the mutant proteins (GRAVES-WOODWARD et al. 1997 Down; HALL and MATSON 1997 Down). While the phenotypes associated with dna2-11 may not be solely due to the G1397S mutation, the fact that cells tolerate mutations expected to inactivate the helicase function of Dna2 suggests that full helicase function is not part of the essential role of DNA2. Because both these mutations and other changes in the helicase domain cause sensitivity to DNA damage, we conclude that the helicase function has a more important role in repair.

A previous report concluded that the helicase function of DNA2 was essential because a K1080E mutation in helicase domain I was found to be lethal (BUDD et al. 1995 Down), although this mutation was combined with a deletion of the N-terminal 105 residues of Dna2. This mutation was found to destroy both helicase and ATPase activities of Dna2 (BUDD et al. 1995 Down; BAE et al. 1998 Down). To extend this analysis, we constructed mutations in invariant residues in helicase motif I (K1080T) and motif II (D1186A, E1186A) in full-length DNA2. Plasmids with these mutations were tested for complementation of a genomic deletion of DNA2 as shown in Figure 5. Strains containing the K1080T mutation were found to be strongly impaired for growth, but clearly viable on media containing glucose. We had previously noted that the temperature sensitivity of dna2 mutants was suppressed by growth on poor carbon sources (Table 3; some suppression was even observed on synthetic media relative to rich media). While the mechanism for this suppression is not obvious, the same effect was noted for the helicase domain I and II mutants, which were both able to grow nearly as well as WT on glycerol-lactate media (Figure 5). Because the vector alone was unable to support growth under these conditions, DNA2 is still performing an essential function. However, because severe mutations that abolish DNA-dependent ATP hydrolysis and helicase activity in other members of helicase superfamily I support viability, we conclude that the essential function of DNA2 does not require significant levels of helicase function. Consistent with the motif IV and V mutations, the motif I and II mutants were both MMS sensitive and synthetically lethal with ctf4 on glycerol-lactate media (not shown), confirming that these are properties of cells with Dna2 helicase defects.



View larger version (95K):
In this window
In a new window
Download PPT slide
 
Figure 5. Mutations in helicase motifs I and II support growth. Strain 7577-2-1 pJB21 (dna2-{Delta} pDNA2) was transformed with YCplac111 (vector), pTF118 (DNA2), pTF118-K1080T (K1080T), and pTF118-D1186A, E1187A (DE-AA). Transformants were grown to saturation, and serial dilutions placed on complete synthetic medium with glucose (complete), or medium containing 5-FOA with either glucose (Glc) or 3% glycerol/2% lactate (Gly/lac) as the carbon source. Plates were photographed after incubating for 2 or 6 days as indicated. The weak growth observed on 5-FOA glucose plates with the motif I mutant was due to viable cells that could be recovered and grown on Gly/lac medium lacking 5-FOA while no viable cells could be recovered from the corresponding vector control spot (not shown).

Chromosome stability in dna2 mutants:
Mutations in CTF4 caused increased rates of chromosome loss and recombination (SPENCER et al. 1990 Down; KOUPRINA et al. 1992 Down; MILES and FORMOSA 1992A Down), as did mutations in other genes needed for DNA metabolism, including POL1 (HARTWELL and SMITH 1985 Down; CAMPBELL and NEWLON 1991 Down). A previous study indicated that the ts allele dna2-22 caused a 10- to 17-fold increase in the yield of combined loss and recombination products (FIORENTINO and CRABTREE 1997 Down). Our tests of dna2-1 and dna2-2 indicated slightly increased rates of loss (12- to 13-fold and 5- to 6-fold, respectively) when a fragment of chromosome III (CF352; SHERO et al. 1991 Down) was assayed and no effect on loss or recombination rates when the intact chromosome V assay was used (HARTWELL and SMITH 1985 Down), which showed the effects noted for dna2-22 (FIORENTINO and CRABTREE 1997 Down). No additional increase in the loss rate was observed when the dna2-1 strains were grown at their maximal permissive temperature or temporarily incubated at a restrictive temperature. dna2-4, -12, -13, and -16 strains also showed no effect in the chromosome V assay, although dna2-8 showed an increase of 7-fold in the rate of recombinants (not shown). Tests of the forward mutation frequency at the CAN1 locus also indicated normal mutation rates in dna2 mutants (not shown). We conclude that dna2 mutations affect genomic stability mildly, if at all.

Interactions between dna2 mutations and checkpoint functions:
We tested the DNA contents of dna2 mutants by flow cytometry and found that the ts mutants all arrested at restrictive temperatures with 2C DNA contents and >80% large-budded cells, consistent with previous reports (Figure 6, data not shown, and FIORENTINO and CRABTREE 1997 Down). dna2-2 strains delayed in G2/M during logarithmic growth, suggesting accumulation of S phase errors (not shown). These delays and arrests were lost when the dna2 mutations were combined with a rad9 deletion (Figure 6), but were still observed in mec1-1 mutants (not shown). In contrast, FIORENTINO and CRABTREE 1997 Down found that both RAD9 and MEC1 were needed to observe morphological arrest with the dna2-22 allele, and that either checkpoint mutation suppressed the lethality of dna2-20 and dna2-21. The role of checkpoints in monitoring defects in dna2 mutants therefore appears to be complex and allele specific.



View larger version (23K):
In this window
In a new window
Download PPT slide
 
Figure 6. Effect of checkpoint mutations on the DNA content of a dna2 mutant. Strains 4053-5-2 (WT), 7373-3-3 (rad9), 7628-2-4 (dna2-1), and 7666-1-2 (dna2-1 rad9) were grown to logarithmic phase, then incubated with shaking at 37° for 4 hr, and prepared for flow cytometry as described (SINGER et al. 1996 Down).

While RAD9 was needed for morphological arrest in dna2 mutants, removal of the checkpoint did not diminish the viability of these mutants. This was assessed by testing the MPT, the maximal MMS concentration tolerated, and the remaining viability after a brief shift to 37° with dna2 and dna2 rad9 strains for alleles dna2-1, -4, -12, and -16. The only case in which a rad9 mutation showed a strong effect was with dna2-16, where suppression was observed (Figure 7). Both the MPT and the MMS resistance were enhanced by deletion of RAD9, although the survival after a 4-hr incubation at 37° was ~3% for each strain. The deletion of RAD9 also suppressed the lethality of ctf4 dna2-2 combinations. A diploid heterozygous for dna2-2, ctf4, and rad9 mutations was sporulated and 100 haploid segregants from 38 tetrads were examined. The rad9 mutation was found in 52% of the clones, while dna2-2 and ctf4 were each found in 37%. Four spores were found to have both dna2-2 and ctf4 mutations, and all four also had the rad9 mutation. The triple mutants were thus recovered at less than the expected frequency (4% instead of 12.5%) and grew slowly, but were viable.



View larger version (30K):
In this window
In a new window
Download PPT slide
 
Figure 7. Suppression of dna2-16 by a deletion of rad9. Congenic strains (7373-3-3, 7720-41, and 2209-4-2) with the mutations shown were grown to saturation and aliquots of 10-fold serial dilutions were placed on YEPD for incubation at 23° or 31°, or on YEPD containing 0.003% MMS for incubation at 23°.

One explanation for the lack of synthetic effects between dna2 and checkpoint mutations could be that some aspect of the checkpoint function depends on Dna2 and is therefore equally deficient in single dna2 mutants and dna2-checkpoint combinations. For example, if dna2 mutants cause damage that should elicit a response to arrest DNA replication during S phase, but the Dna2 protein is needed to detect or signal this information, the cells could proceed inappropriately through S phase, compiling lethal damage that is sensed by the G2/M machinery but can no longer be repaired. We therefore tested the response of dna2 mutants to circumstances that activate G1/S and S phase checkpoints in normal cells to see if these responses were intact. Each of the dna2 mutants was found to arrest normally in G1 when treated with 0.02% MMS (not shown). Further, a dna2-2 strain was found to exhibit the normal slowing of the progression of S phase in response to MMS treatment (PAULOVICH and HARTWELL 1995 Down; data not shown). Finally, dna2-1 and dna2-2 mutants were found to exhibit a normal response to the DNA replication inhibitor hydroxyurea. dna2 mutants therefore appear to have normal G1/S, S, and G2/M checkpoints.

dna2 mutations alter telomere replication:
Mutations in POL1 and some other replication proteins cause telomeres to become unusually long (CARSON and HARTWELL 1985 Down; ADAMS and HOLM 1996 Down). The dna2-2 mutation was found to cause a slight but reproducible increase in the length of telomeres (Figure 8). In two measurements each of eight independent cultures, the terminal XhoI fragment from Y'-bearing telomeres in a dna2-2 strain averaged 86 ± 23 bp longer than a control strain (1160 ± 31 bp for WT, 1246 ± 37 bp for dna2-2). Similar results were obtained for all of the dna2 alleles listed in Table 3 (and data not shown), indicating that the effect on telomeres is a general property of dna2 mutants. The telomeric repeats in a cdc17-2 (pol1) strain increased 300–400 bp under these conditions, but double mutants also lacking CTF4 were limited to about half of this increase (Figure 8). Digestion with MspI, which liberates only the telomeric repeat region plus 41 bp of Y' sequence (SHAMPAY et al. 1984 Down; WALMSLEY et al. 1984 Down; CARSON and HARTWELL 1985 Down), indicated that the WT strain had an average of 340 bp of telomeric repeat sequence and that the increases observed were due to changes in these repeats (not shown, and CARSON and HARTWELL 1985 Down). dna2-2 therefore caused a 20–30% increase in the number of telomeric repeats, while cdc17-2 mutants showed a 100% increase under the same conditions. Deletion of CTF4 alone had no effect on telomeres but prevented cdc17-2 cells from acquiring their normal level of increase.



View larger version (79K):
In this window
In a new window
Download PPT slide
 
Figure 8. The dna2-2 mutation affects the size of telomeres. The effect of mutations on telomere length was determined as described in MATERIALS AND METHODS by measuring the size of a telomeric restriction fragment as indicated with a bracket. (A) Three isolates each of 7610-2-1 [DNA2 sol3-{Delta}(::LEU2), WT] and 7587-10-2 [dna2-2 sol3-{Delta}(::LEU2)]. (B) Strains 7373-4-4 (WT), 7411-10-3 (ctf4-{Delta}), 7391-1-1 (cdc17-2), and 7391-4-2 (ctf4-{Delta} cdc17-2).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Deletion of the Pol1-binding protein Ctf4 impairs DNA metabolism but leaves cells viable. We isolated mutations that make Ctf4 essential and found that one such mutation was in DNA2. Our results connect Dna2 to a role in a DNA Polymerase {alpha}-dependent process, consistent with previous reports that proposed a role in lagging strand DNA synthesis (BUDD and CAMPBELL 1997 Down; FIORENTINO and CRABTREE 1997 Down). A set of dna2 mutations demonstrated that optimal Dna2 helicase function is needed principally for damage repair and that it is this function that is either assisted by Ctf4 or becomes necessary in cells lacking Ctf4.

Genetic interactions link Dna2 to Pol {alpha} and other lagging strand synthesis factors:
Ctf4 and Pol {alpha} interact physically and genetically, and the properties of ctf4 mutants suggest that this binding is biologically relevant (KOUPRINA et al. 1992 Down; MILES and FORMOSA 1992A Down). An allele of DNA2 was lethal in combination with a deletion of CTF4, which suggested that Dna2 also interacts with Pol {alpha}. Consistent with this, dna2-2 displayed an allele-specific synthetic defect with a pol1 mutation. In addition to the effect with pol1, ctf4 and dna2 mutations had strong effects when combined with rad27, rfc1, chl12, spt16, and cdc16 mutations. The Pol {alpha}/primase holoenzyme is thought to provide the primers that initiate each Okazaki fragment during lagging strand synthesis (CAMPBELL and NEWLON 1991 Down; KORNBERG and BAKER 1992 Down). Rad27 is a structure-specific "flap" endonuclease that interacts physically and genetically with Dna2 (BUDD and CAMPBELL 1997 Down). A homologue of Rad27 is needed to complete Okazaki fragment maturation during SV40 replication in human cell extracts (STILLMAN 1994 Down), and the properties of rad27 deletion mutants are consistent with a similar role in yeast cells (REAGAN et al. 1995 Down; SOMMERS et al. 1995 Down). Rfc1 is the largest subunit of RF-C, a complex of five similar proteins that modulate the loading of PCNA trimers onto DNA (CULLMANN et al. 1995 Down). PCNA controls the processivity of DNA polymerases {delta} and {epsilon}, and also binds to a large number of replication, repair, and cell cycle progression factors, including Rad27 (EISSENBERG et al. 1997 Down; LOOR et al. 1997 Down). While high levels of processivity are not expected to be needed for lagging strand synthesis or repair, PCNA appears to act as an organizing factor for many different types of DNA polymerase functions, including lagging strand synthesis and repair. The role of Chl12 is not known, but its high level of similarity with Rfc1 (KOUPRINA et al. 1994 Down; CULLMANN et al. 1995 Down) suggests that it also acts in modulating PCNA function. Spt16 is a global regulator of chromatin function, and binds to Pol {alpha} (WITTMEYER and FORMOSA 1997 Down). Cdc16 is a subunit of the anaphase-promoting complex, but has also been shown to regulate the exit from S phase (HEICHMAN and ROBERTS 1998 Down). The genes that display synthetic defects with ctf4 and dna2 mutations are therefore all linked to DNA metabolism, and most are thought to act directly in the lagging strand phase of DNA replication or in damage repair. We propose that Ctf4 and Dna2 act within protein complexes that contain these other gene products or rely on their function.

Full activity of the Dna2 helicase function is needed only for repair and tolerating loss of Ctf4:
DNA2 is a member of the Sen1-like family of helicases, sharing extensive similarity with this group throughout the helicase domain (GORBALENYA and KOONIN 1993 Down; ALTSCHUL et al. 1997 Down). Like other members of this group from human, worm, plant, frog, and yeast, this helicase domain is linked to another set of conserved sequences (Figure 4). While the function of this second region is unknown, the recent demonstration that Dna2 has nuclease activity (BAE et al. 1998 Down) suggests that it is a nuclease domain, and provides a likely scenario for the function of Dna2: it could act in Okazaki fragment maturation or damage repair by using its helicase activity to provide the substrate for its nuclease function. The broad conservation of this linked pair of activities suggests this role is an important one.

To our surprise, some of the dna2 mutations we isolated were in residues expected to eliminate helicase activity, but these alleles had no obvious effects on growth, which suggests that full Dna2 helicase activity is not essential. Two of these alleles, dna2-2 and dna2-11, were alterations of invariant residues in helicase motifs IV and V. Mutations introduced into these same residues in E. coli UvrD and herpes virus UL5 proteins caused a reduction in ATPase and complete loss of helicase activity in vitro, and obliterated their functions in vivo (GRAVES-WOODWARD et al. 1997 Down; HALL and MATSON 1997 Down). More severe effects were observed in the UL5 protein when mutations were introduced into motifs I and II (GRAVES-WOODWARD et al. 1997 Down). These motifs correspond to the Walker A and B motifs found in a broad range of NTP-hydrolyzing proteins, and as expected, severely affected the ability of UL5 mutants to hydrolyze ATP (GRAVES-WOODWARD et al. 1997 Down). Previous studies also showed that a K1080E motif I mutation in Dna2 destroyed the ATPase and helicase activities (BUDD et al. 1995 Down; BAE et al. 1998 Down) and prevented growth in the context of a deletion of the N terminus of Dna2 (BUDD et al. 1995 Down). To test the effect of a motif I mutation in full-length Dna2 and to extend this to motif II, we engineered K1080T and D1186A, E1187A mutations into DNA2. These mutants were severely impaired for growth on glucose, but were viable. They were able to grow nearly as well as wild type on glycerol-lactate media, a condition that also suppressed the temperature sensitivity of dna2 ts mutants (as well as pol1, cdc9, cdc15, cdc16, cdc28, cdc36, cdc39 and spt16 ts mutations, but not cdc2, cdc4, cdc6, cdc8, or cdc25 ts mutants; SHUSTER 1982 Down and our unpublished observations). While the mechanism of the suppression is not known, we can conclude that under some growth conditions even mutations shown or expected to destroy the helicase and ATPase functions of Dna2 support viability, so the full activity of the helicase domain is not essential.

The MMS-sensitive alleles of DNA2 clustered in the helicase domain and the site-directed motif I and II mutations were MMS sensitive. All of the MMS-sensitive alleles were also synthetically lethal with ctf4, while mutations that tolerated MMS normally also survived the loss of CTF4. The dna2-1 allele was MMS sensitive, mapped outside the helicase domain, and was lethal with ctf4, while dna2-13 was MMS resistant, mapped inside the helicase domain, and tolerated deletion of ctf4. This demonstrates that the correlation of synthetic lethality with ctf4 is clearly with MMS sensitivity and not with map position within the helicase domain. The helicase function is therefore needed for some forms of DNA damage repair and for tolerating loss of Ctf4.

The correlation of MMS sensitivity and synthetic lethality with ctf4 could indicate that Ctf4 and Dna2 act cooperatively to repair the damage caused by MMS, or that the same functions of Dna2 needed for tolerating alkylation damage are also needed for tolerating damage caused by Ctf4 deficiency. In the first case, Ctf4 might act to assemble or stabilize complexes containing Dna2 that then act during repair of alkylation damage. ctf4 and dna2 mutants would be individually sensitive to MMS because of an inability to form these complexes and effect repair efficiently. Combinations would be lethal due to a further reduction in repair capability or the inability to form similar complexes needed for a more essential function such as lagging strand synthesis. In the second model, certain types of DNA damage require the efficient function of the Dna2 helicase activity for repair, and these types of damage are found in cells treated with MMS and in cells lacking Ctf4. We favor the first model for two reasons. First, the synthetic lethality of dna2 ctf4 combinations is suppressed by loss of the RAD9 checkpoint. If the ctf4 mutation caused lethal damage to accumulate that had to be repaired by Dna2, removal of a checkpoint would not be expected to rescue the cells because they would still contain lethal amounts of damage. Second, our preliminary data show that Dna2 is found in whole cell extracts in a complex that elutes from a size-exclusion matrix at ~700 kD, but this complex is lost and the Dna2 is partially degraded in cells lacking Ctf4 (T. NITTIS, unpublished observations). We therefore propose that Ctf4 acts as a scaffold to assemble or stabilize complexes that can include Pol {alpha} and Dna2 as components. Loss of Ctf4 allows these complexes to form only inefficiently, requiring optimal performance of each of the remaining members of the complexes. Different complexes utilizing Ctf4 might act in lagging strand synthesis, Okazaki fragment maturation, and DNA damage repair. Alternatively, a single complex might act in all of these processes but use only some components for each task. This model could explain the existence of damage-sensitive alleles of POL1 (AGUILERA and KLEIN 1988 Down) when neither its DNA polymerase activity nor its associated priming function are thought to be needed for repair (CAMPBELL and NEWLON 1991 Down; BUDD and CAMPBELL 1995A Down). If mutations in POL1 block the formation of a larger complex, they could cause damage sensitivity even if Pol1 function is not catalytically involved in repair. This model could also explain the observed elongation of telomeres because the efficiency of the lagging-strand replication complex is thought to alter the balance between elongation and degradation that determines telomere length.

While dna2 mutants produce a signal that engages the Rad9 checkpoint, the ensuing delays are either neutral or detrimental to the viability of the cells. One interpretation of this surprising result is that dna2 mutants might accumulate damage that cannot be repaired. The damage is sensed by checkpoint mechanisms, but the delay that this triggers is ineffective in promoting repair. In some cases, the damage is irreparable but not lethal, so the persistent arrest signals only serve to inhibit growth. Mutated Dna2 proteins could retain the ability to bind to other proteins and to helicase substrates, as noted for the herpes virus UL5 mutants (GRAVES-WOODWARD et al. 1997 Down), but not the ability to unwind duplexes efficiently. With some alleles this could cause the formation of stable but inactive protein complexes that serve to protect damaged DNA from alternative repair strategies. This signals checkpoint delays, but the bound complexes prevent repair even during these delays, so the checkpoint is ineffective and therefore irrelevant. With other alleles, the mutant Dna2 proteins are able to process the DNA to structures that still trigger checkpoint delays, but are not ultimately lethal to the cells. In this case, the checkpoint-delay signals can be safely ignored, and this would in fact lead to improved growth upon removal of the recurring cell cycle delays. Further analysis of the properties of mutant Dna2 proteins will be required to assess the validity of these models.


*  ACKNOWLEDGMENTS

We thank E. Mortensen and D. Bronson for technical assistance, V. Lundblad for advice on the telomere assay, S. Forsburg and J. Campbell for providing Dna2 homolog sequences, and J. Wittmeyer, D. Carroll, and D. Stillman for comments on the manuscript. Support for this work was provided by the National Institutes of Health and by the Lucille Markey Foundation.

Manuscript received October 7, 1998; Accepted for publication January 18, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAMS, A. K. and C. HOLM, 1996  Specific DNA replication mutations affect telomere length in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:4614-4620[Abstract].

AGUILERA, A. and H. L. KLEIN, 1988  Genetic control of intrachromosomal recombination in Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyper-recombination mutations. Genetics 119:779-790[Abstract/Free Full Text].

ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1997  Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402[Abstract/Free Full Text].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN, J. A. SMITH and K. STRUHL (Editors), 1994 Current Protocols in Molecular Biology. Greene Publishing Associates, Inc., and John Wiley & Sons, Inc., Boston.

BAE, S. H., E. CHOI, K. H. LEE, J. S. PARK, and S. H. LEE et al., 1998  Dna2 of Saccharomyces cerevisiae possesses a single-stranded DNA-specific endonuclease activity that is able to act on double-stranded DNA in the presence of ATP. J. Biol. Chem. 273:26880-26890[Abstract/Free Full Text].

BENDER, A. and J. R. PRINGLE, 1991  Use of a screen for synthetic lethal and multicopy suppressor mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:1295-1305[Abstract/Free Full Text].

BOEKE, J. D., J. TRUEHEART, G. NATSOULIS, and G. R. FINK, 1987  5-fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175[Medline].

BRAGUGLIA, D., P. HEUN, P. PASERO, B. P. DUNCKER, and S. M. GASSER, 1998  Semi-conservative replication in yeast nuclear extracts requires Dna2 helicase and supercoiled template. J. Mol. Biol. 281:631-649[Medline].

BUDD, M. E. and J. L. CAMPBELL, 1995a  DNA polymerases required for repair of UV-induced damage in Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:2173-2179[Abstract].

BUDD, M. E. and J. L. CAMPBELL, 1995b  A yeast gene required for DNA replication encodes a protein with homology to DNA helicases. Proc. Natl. Acad. Sci. USA 92:7642-7646[Abstract/Free Full Text].

BUDD, M. E. and J. L. CAMPBELL, 1997  A yeast replicative helicase, Dna2 helicase, interacts with yeast FEN-1 nuclease in carrying out its essential function. Mol. Cell. Biol. 17:2136-2142[Abstract].

BUDD, M. E., W.-C. CHOE, and J. L. CAMPBELL, 1995  DNA2 encodes a DNA helicase essential for replication of eukaryotic chromosomes. J. Biol. Chem. 270:26766-26769[Abstract/Free Full Text].

CAMPBELL, J. L., and C. S. NEWLON, 1991 Chromosomal DNA replication, pp. 41–146 in The Molecular and Cellular Biology of the Yeast Saccharomyces, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

CARSON, M. J. and L. HARTWELL, 1985  CDC17: an essential gene that prevents telomere elongation in yeast. Cell 42:249-257[Medline].

CHRISTIANSON, T. W., R. S. SIKORSKI, M. DANTE, J. H. SHERO, and P. HIETER, 1992  Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122[Medline].

CULLMANN, G., K. FIEN, R. KOBAYASHI, and B. STILLMAN, 1995  Characterization of the five replication factor C genes of Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:4661-4671[Abstract].

EISSENBERG, J. C., R. AYYAGARI, X. V. GOMES, and P. M. J. BURGERS, 1997  Mutations in yeast proliferating cell nuclear antigen define distinct sites for interaction with DNA polymerase {delta} and DNA polymerase {epsilon}. Mol. Cell. Biol. 17:6367-6378[Abstract].

FIORENTINO, D. F. and G. R. CRABTREE, 1997  Characterization of Saccharomyces cerevisiae dna2 mutants suggests a role for the helicase late in S phase. Mol. Biol. Cell. 8:2519-2537[Abstract/Free Full Text].

GIETZ, R. D. and A. SUGINO, 1988  New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534[Medline].

GORBALENYA, A. E. and E. V. KOONIN, 1993  Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol. 3:419-429.

GRAVES-WOODWARD, K. L., J. GOTTLIEB, M. D. CHALLBERG, and S. K. WELLER, 1997  Biochemical analyses of mutations in the HSV-1 helicase-primase that alter ATP hydrolysis, DNA unwinding, and coupling between hydrolysis and unwinding. J. Biol. Chem. 272:4623-4630[Abstract/Free Full Text].

HALL, M. C. and S. W. MATSON, 1997  Mutation of a highly conserved arginine in motif IV of Escherichia coli DNA helicase II results in an ATP-binding defect. J. Biol. Chem. 272:18614-18620[Abstract/Free Full Text].

HARRIS, S. D. and J. E. HAMER, 1995  sepB: an Aspergillus nidulans gene involved in chromosome segregation and the initiation of cytokinesis. EMBO J. 14:5244-5257[Medline].

HARRIS, S. D. and P. R. KRAUS, 1998  Regulation of septum formation in Aspergillus nidulans by a DNA damage checkpoint pathway. Genetics 148:1055-1067[Abstract/Free Full Text].

HARRIS, S. D., J. L. MORRELL, and J. E. HAMER, 1994  Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136:517-532[Abstract].

HARTWELL, L. H., 1967  Macromolecule synthesis in temperature-sensitive mutants of yeast. J. Bacteriol. 93:1662-1670[Abstract/Free Full Text].

HARTWELL, L. H. and D. SMITH, 1985  Altered fidelity of mitotic chromosome transmission in cell cycle mutants of S. cerevisiae.. Genetics 110:381-395[Abstract/Free Full Text].

HEICHMAN, K. A. and J. M. ROBERTS, 1998  CDC16 controls initiation at chromosome replication origins. Mol. Cell 1:457-463[Medline].

HOEKSTRA, M. F., H. S. SEIFERT, J. NICKOLOFF, and F. HEFFRON, 1991  Shuttle mutagenesis: bacterial transposons for genetic manipulations in yeast. Methods Enzymol. 194:329-342[Medline].

IIRI, T., Z. FARFEL, and H. R. BOURNE, 1998  G-protein diseases furnish a model for the turn-on switch. Nature 394:35-38[Medline].

KOHLER, A., M. S. SCHMIDT-ZACHMANN, and W. W. FRANKE, 1997  AND-1, a natural chimeric DNA-binding protein, combines an HMG-box with regulatory WD-repeats. J. Cell Sci. 110:1051-1062[Abstract].

KORNBERG, A., and T. BAKER, 1992 DNA Replication. W. H. Freeman and Co., New York.

KOUPRINA, N., E. KROLL, V. BANNIKOV, V. BLISKOVSKY, and R. GIZATULLIN et al., 1992  CTF4 (CHL15) mutants exhibit defective DNA metabolism in the yeast Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:5736-5747[Abstract/Free Full Text].

KOUPRINA, N., E. KROLL, A. KIRILLOV, V. BANNIKOV, and V. ZAKHARYEV et al., 1994  CHL12, a gene essential for the fidelity of chromosome transmission in the yeast Saccharomyces cerevisiae.. Genetics 138:1067-1079[Abstract].

LOOR, G., S. J. ZHANG, P. ZHANG, N. L. TOOMEY, and M. Y. LEE, 1997  Identification of DNA replication and cell cycle proteins that interact with PCNA. Nucleic Acids Res. 25:5041-5046[Abstract/Free Full Text].

MCALEAR, M. A., K. M. TUFFO, and C. HOLM, 1996  The large subunit of replication factor C (Rfc1p/cdc44p) is required for DNA replication and DNA repair in Saccharomyces cerevisiae.. Genetics 142:65-78[Abstract].

MILES, J. and T. FORMOSA, 1992a  Evidence that POB1, a Saccharomyces cerevisiae protein that binds to DNA polymerase a, acts in DNA metabolism in vivo.. Mol. Cell. Biol. 12:5724-5735[Abstract/Free Full Text].

MILES, J. and T. FORMOSA, 1992b  Protein affinity chromatography with purified yeast DNA polymerase {alpha} detects proteins that bind to DNA polymerase. Proc. Natl. Acad. Sci. USA 89:1276-1280[Abstract/Free Full Text].

MORGAN, B. A., F. L. CONLON, M. MANZANARES, J. B. MILLAR, and N. KANUGA et al., 1996  Transposon tools for recombinant DNA manipulation: characterization of transcriptional regulators from yeast, Xenopus, and mouse. Proc. Natl. Acad. Sci. USA 93:2801-2806[Abstract/Free Full Text].

PAULOVICH, A. G. and L. H. HARTWELL, 1995  A checkpoint regulates the rate of progression through S phase in S. cerevisiae in response to DNA damage. Cell 82:841-847[Medline].

REAGAN, M. S., C. PITTENGER, W. SIEDE, and E. C. FRIEDBERG, 1995  Characterization of a mutant strain of Saccharomyces cerevisiae with a deletion of the RAD27 gene, a structural homolog of the RAD2 nucleotide excision repair gene. J. Bacteriol. 177:364-371[Abstract/Free Full Text].

ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics, A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SHAMPAY, J., J. W. SZOSTAK, and E. H. BLACKBURN, 1984  DNA sequences of telomeres maintained in yeast. Nature 310:154-157[Medline].

SHEN, W. C., D. R. STANFORD, and A. K. HOPPER, 1996  Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family. Genetics 143:699-712