Isolation and Characterization of Drosophila retinal degeneration B Suppressors

Corresponding author: David R. Hyde, Department of Biological Sciences, Galvin Life Science Bdg., University of Notre Dame, P.O. Box 369, Notre Dame, IN 46556-0369., david.r.hyde.1{at}nd.edu (E-mail)

Communicating editor: T. C. KAUFMAN

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The Drosophila retinal degeneration B protein (RdgB) is a novel integral membrane phosphatidylinositol transfer protein required for photoreceptor cell viability and light response. We isolated one intragenic suppressor (rdgB^su100) and four autosomal suppressors of the hypomorphic rdgB^KS222 retinal degeneration phenotype. The rdgB^su100 suppressor dramatically slowed rdgB^KS222's photoreceptor degeneration without significantly improving the electroretinogram (ERG) light response. One autosomal recessive suppressor [su(rdgB)69] significantly slowed rdgB^KS222 retinal degeneration and restored the ERG light response near to that of the wild type. Unlike all the previously characterized rdgB suppressors, the four new autosomal suppressors do not affect the ERG light response in rdgB⁺ flies. Only Su(rdgB)116 exhibited a mutant phenotype in a rdgB⁺ background, which was smaller R1-6 rhabdomeres. We also examined the extent to which two previously identified visual transduction mutations suppressed rdgB retinal degeneration. Absence of one of the light-activated calcium channels (trp^CM) slowed the onset of rdgB-dependent degeneration. However, loss of protein kinase C (inaC²⁰⁹), which blocks photoreceptor cell deactivation, desensitization, and light adaptation, failed to suppress rdgB degeneration under normal light conditions. This demonstrates that TRP activity, but not INAC, is required for rapid rdgB-dependent degeneration.

THE Drosophila retinal degeneration B (rdgB) mutant exhibits light-enhanced retinal degeneration and an abnormal light response. The degeneration, which begins at the photoreceptor cell's synaptic terminal, is histologically apparent 3–4 days after eclosion (HOTTA and BENZER 1970 ; HARRIS and STARK 1977 ; STARK and CARLSON 1982 ). However, rdgB's electroretinogram (ERG) light response is defective within hours after eclosion and completely lost within the first day (HARRIS and STARK 1977 ; MILLIGAN et al. 1997 ). This suggests that the degeneration is a likely consequence of the photoreceptor's abnormal light response physiology.

Previous genetic and biochemical data suggest that the RdgB protein functions subsequent to protein kinase C (PKC) in the visual transduction cascade. Mutations in either the ninaE-encoded R1-6 opsin (O'TOUSA et al. 1985 ; ZUKER et al. 1985 ) or the norpA-encoded phospholipase C (BLOOMQUIST et al. 1988 ) suppress the rdgB retinal degeneration phenotype (HARRIS and STARK 1977 ; STARK and SAPP 1989 ). Additionally, a constitutively active DG_q mutation stimulates rapid rdgB retinal degeneration in the dark (LEE et al. 1994 ). The inaC mutation also weakly suppresses rdgB-dependent retinal degeneration (SMITH et al. 1991 ). The inaC gene encodes a retinal-specific PKC that is required for photoreceptor deactivation, desensitization, and light adaptation (SMITH et al. 1991 ; HARDIE et al. 1993 ). Consistent with this result, application of a phorbol ester also induces rapid rdgB-dependent retinal degeneration in the dark, presumably by stimulating PKC (MINKE et al. 1990 ). Furthermore, mutation of a putative PKC phosphorylation site in RdgB (threonine 59 to glutamic acid) dramatically reduces RdgB activity in vivo (MILLIGAN et al. 1997 ). PKC and all other known phototransduction components, excluding the ryanodine receptor (ARNON et al. 1997 ), are localized to the rhabdomere (reviewed in HYDE et al. 1995 ; O'TOUSA 1997 ). However, RdgB was immunolocalized to the subrhabdomeric cisternae (SRC), an extension of the endoplasmic reticulum that lies adjacent to the rhabdomere (VIHTELIC et al. 1993 ; SUZUKI and HIROSAWA 1994 ). It is presently unclear how the visual transduction cascade regulates RdgB in the spatially distinct SRC.

RdgB's photoreceptor cell function is unknown. The RdgB protein contains six putative transmembrane domains with both the N and C termini in the cytosol between the SRC and rhabdomere (VIHTELIC et al. 1991 , VIHTELIC et al. 1993 ). The N terminus possesses two distinct domains. One domain binds Ca²⁺ in vitro (VIHTELIC et al. 1993 ). The presence of this domain and the finding that voltage-gated calcium channel blockers inhibit rdgB-mediated retinal degeneration (SAHLY et al. 1992 ) suggest that Ca²⁺ is involved in RdgB function. The second domain is composed of the N-terminal 276 amino acids, which are >40% identical with the rat brain phosphatidylinositol transfer protein (PITP; VIHTELIC et al. 1993 ). Unlike RdgB, all previously characterized PITPs are 30- to 35-kD soluble proteins (BANKAITIS et al. 1989 ; CLEVES et al. 1991 ; WIRTZ 1991 ). RdgB's N terminus, expressed as a soluble protein (RdgB-PITP), possesses phosphatidylinositol transfer activity in vitro (VIHTELIC et al. 1993 ; MILLIGAN et al. 1997 ). Thus, RdgB defines a new class of integral membrane PITPs. Expression of this soluble RdgB-PITP is sufficient to suppress both the retinal degeneration and ERG light response phenotypes in rdgB² null mutants (MILLIGAN et al. 1997 ). However, the phospholipid transfer activity is not RdgB's critical function in vivo (MILLIGAN et al. 1997 ). Recently, mouse and human rdgB homologs that contain over 40% amino acid identity with Drosophila RdgB were identified (CHANG et al. 1997 ; GUO and YU 1997 ). Expression of the mouse rdgB cDNA suppressed the rdgB-dependent degeneration and ERG mutant phenotypes in flies (CHANG et al. 1997 ). This functionally equivalent vertebrate RdgB homolog suggests that the entire RdgB molecule is important to a basic function in both invertebrate and vertebrate photoreceptors.

To further elucidate RdgB's role in the photoreceptor cell, we identified five new suppressors of the rdgB-mediated retinal degeneration phenotype. One intragenic suppressor, which possessed two missense mutations in the first putative intralumenal loop of RdgB, slowed the rapid rdgB^KS222 photoreceptor degeneration without significantly altering the defective light response. We also isolated two dominant and two recessive autosomal suppressors. One suppressor [su(rdgB)69] significantly slowed rdgB^KS222 retinal degeneration and restored the rdgB ERG light response to nearly that of the wild type. We further examined the genetic relationship of the visual transduction cascade and rdgB-mediated retinal degeneration. We found that the trp mutation, but not inaC, significantly slowed rdgB degeneration. This suggests that the light-induced Ca²⁺ entry into the photoreceptor cell stimulates rdgB degeneration, while PKC activity is not absolutely required to activate the rdgB-dependent degeneration.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Scoring retinal degeneration:
Wild-type and vermilion eye-colored flies of various genotypes were collected daily and raised under either constant light or a 12-hr light:dark cycle. The flies were scored daily for the presence of a deep pseudopupil, which is a virtual image of the rhabdomeres from several adjacent ommatidia (FRANCESCHINI 1972 ). The percent of flies that retained their deep pseudopupil (dpp⁺) for a given day was calculated. At least three replicates of 25–150 flies, with a minimum of 100 flies total, were analyzed for each genotype to determine the average percent of dpp⁺ flies and standard deviation for each day. White-eyed flies (inaC²⁰⁹)were illuminated with blue light to score the presence or absence of a dark pseudopupil (O'TOUSA 1997 ).

Retinal degeneration was also examined by both light and electron microscopy of retinal tissue sections. Flies were raised in a 12-hr light:dark cycle and then decapitated. The heads were bisected, fixed, and embedded in Polybed 812 as described previously (LEE et al. 1994 ). For light microscopy, 2-µm sections were stained with 1% methylene blue and 1% azure II. For electron microscopy, 0.5- to 0.8-µm sections were stained with 4.9% uranyl acetate for 5 min, rinsed in methanol, incubated in 1% lead citrate for 2 min, and rinsed in 0.1 M NaOH, followed by a water rinse.

Electrophysiology:
ERGs were performed as described (LARRIVEE et al. 1981 ; BLAKE et al. 1991 ; ZARS and HYDE 1996 ). One- to two-day-old flies raised in a 12-hr light:dark cycle were prepared under dim red light and dark adapted 4 min before stimulation with white light (1.2 x 10^-3 W/cm²). Average light response amplitudes were calculated from recordings of at least five different flies, with representative light response recordings shown.

PCR amplification and DNA sequencing:
The rdgB gene was PCR amplified from wild-type (Oregon-R), rdgB^KS222, and rdgB^su100 genomic DNAs in four overlapping clones using Taq DNA Polymerase (Fisher Biotech, Pittsburgh, PA), and primers based on the rdgB sequence (VIHTELIC et al. 1991 ). To minimize PCR errors, three independent PCR reactions were performed on each rdgB genomic fragment from all three genotypes. The PCR products were cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced. Reverse transcription PCR (RT-PCR) was performed on mRNA isolated from rdgB^KS222 and rdgB^su100 flies to confirm the presence of the Gln147term mutation in the mRNA. Poly(A)⁺ mRNA was isolated from 50 rdgB^KS222 and rdgB^su100 fly heads using the QuickPrep Micro mRNA purification kit (Pharmacia Biotech, Piscataway, NJ). First-strand cDNA and the PCR reaction were carried out sequentially using reverse transcriptase, oligo(dT) primers, and the SuperScript Preamplification system (GIBCO BRL, Gaithersburg, MD). The rdgB PCR primer sequences were 5' GAGTCGCGAGGAGAGCCAT GGCG 3' and 5' TGCTTGGGATCCTCCTCCTTCAC 3', which correspond to nucleotides 84–106 and 460–482, respectively (VIHTELIC et al. 1991 ). The PCR products were cloned into the pCR2.1 vector.

DNA sequencing was performed by the dideoxy chain-termination method (SANGER et al. 1977 ) using either single-stranded or double-stranded plasmid template DNA with the Sequenase version 2.0 sequencing kit (Amersham, Arlington Heights, IL). While sequencing the wild-type rdgB cDNAs and genomic clones, we identified three nucleotide differences relative to the original published sequence (VIHTELIC et al. 1991 ). First, an additional C is present at position 3161. Second, an additional GC is inserted at position 3470. Third, the G at position 3472 is not present. Numbering of the rdgB nucleotides corresponds to the numbering found in VIHTELIC et al. 1991 . These changes increase the open reading frame an additional 584 bp to a TGA codon at position 3751-3753, which encodes a putative protein of 1250 amino acids and now agrees with the rdgB sequence of RUBBOLI et al. 1997 .

Generation of suppressor mutants:
Suppressors were generated using an F₃ free recombination mutagenesis scheme (ASHBURNER 1989 ). Male rdgB^KS222 flies were starved for ~6 hr, fed 25 mM EMS (Sigma, St. Louis, MO) in a 0.1% sucrose solution overnight, and mated en masse to rdgB^KS222; SM1/Gla virgin females. rdgB^KS222; SM1 or rdgB^KS222; Gla F₁ males and virgin females were pair mated, and the resulting F₂ offspring were mated inter se. The F₃ progeny were raised 5–8 days in a 12-hr light:dark cycle before deep pseudopupil analysis (FRANCESCHINI 1972 ). Under these conditions, all rdgB^KS222 flies lacked the deep pseudopupil by 3 days after eclosion.

Mapping of suppressor mutations:
F₃ flies possessing a deep pseudopupil were individually mated to rdgB^KS222; SM1/Sco; TM2/Sb flies. F₁ rdgB^KS222; SM1; TM2 virgin females and rdgB^KS222; Sco; Sb males were mated. The F₂ progeny were raised 5–8 days in a 12-hr light:dark cycle and scored for the presence or absence of the deep pseudopupil. Segregation of the dpp⁺ phenotype from the dominantly marked second and third chromosomes assigned the mutation to a chromosome and determined the dominant-recessive nature of the suppressors.

Complementation: All X chromosome suppressors were tested for complementation with norpA by mating male suppressor flies to virgin female norpA^P41 (LINDSLEY and ZIMM 1990 ) flies and analyzing the ERG of the female progeny. Third chromosome suppressors were tested for complementation with ninaE by mating male suppressor flies to virgin female w¹¹¹⁸; ninaE^I17 flies (O'TOUSA et al. 1985 ) and analyzing the male progeny for the presence of a dark pseudopupil (O'TOUSA 1997 ). The su(rdgB)69 and Su(rdgB)116 mutations are not trp and dgq alleles, respectively, because they complemented the corresponding ERG and retinal degeneration phenotypes.

Recombination mapping: Each of the suppressor stocks was individually crossed to a stock that is homozygous for one of the following multiply marked chromosomes (in a rdgB^KS222 background): y cv v rdgB⁺ f, al b cn sp, and ru h th st cu sr e ca (X, second and third chromosomes, respectively). The resulting F₁ heterozygous females were crossed to rdgB^KS222 stocks to score for the presence of the suppressor mutation by deep pseudopupil. Males both possessing and lacking a deep pseudopupil were individually mated to the multiply marked chromosomal stocks to score the presence or absence of all the recessive markers.

Immunoblots:
Immunoblots to detect RdgB protein expression were performed essentially as described (LEE et al. 1994 ). Heads from two newly eclosed (<8 hr old), dark-raised flies were homogenized in 10 µl extraction buffer (2.3% SDS, 10% glycerol, 62.5 mM Tris-HCl, pH 6.8, 1 mM EGTA, and 0.01% bromophenol blue). The homogenate was incubated at 37° for 1 hr, centrifuged briefly, and resolved on a 5% polyacrylamide-SDS gel (LAEMMLI 1970 ). Proteins were transferred to nitrocellulose with a semidry transfer apparatus (Bio-Rad, Hercules, CA) at 17 V for 40 min. The membrane was blocked for 2 hr in 5% nonfat dry milk in TBS (20 mM Tris-HCl, pH 7.5, 500 mM NaCl), followed by washing twice for 20 min in TTBS (0.05% Tween 20 in TBS). The membranes were incubated overnight at room temperature in a 1:10 dilution of anti-RdgB monoclonal supernatant. The membranes were washed three times (10 min each) with TTBS and incubated for 2 hr with goat anti-mouse alkaline phosphatase-conjugated secondary antibody (Sigma) diluted 1:3,000 in 2% nonfat dry milk in TBS. The membranes were washed twice for 5 min and once for 15 min with TTBS. A final 5 min wash with 0.1 M Tris-HCl, pH 9.5, preceded colorimetric detection (Bio-Rad). RdgB protein levels were determined by scanning three independent immunoblots on a Pharmacia/LKB Ultrascan laser densitometer.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Isolation of novel rdgB suppressors:
The Drosophila RdgB protein is a novel integral membrane PITP (VIHTELIC et al. 1993 ; MILLIGAN et al. 1997 ). To examine RdgB's role in light response and photoreceptor cell viability, we performed an F₃ free recombination screen (ASHBURNER 1989 ) to identify suppressors of the rdgB^KS222-mediated retinal degeneration. The rdgB^KS222 allele, which is a hypomorphic mutation based on its phenotype relative to other rdgB alleles (HARRIS and STARK 1977 ; VIHTELIC et al. 1993 ), expresses ~20% of wild-type-sized RdgB protein relative to the wild type (Figure 1A). We identified 12 suppressors from 3204 independent F₃ families (Table 1). As expected from previous work (HARRIS and STARK 1977 ; STARK and SAPP 1989 ), both norpA (three alleles) and ninaE (one allele) mutations were identified (Table 1). The remaining six recessive and two dominant mutations represent previously unidentified rdgB suppressors. One recessive suppressor (rdgB^su100) is X linked. The seven autosomal suppressors comprise four complementation groups with one recessive and one dominant locus on both the second and third chromosomes.

View larger version (54K): In this window In a new window Download PPT slide   Figure 1. Molecular characterization of the rdgBKS222 and rdgBsu100 mutants. (A) Protein extracts from (lane 1) 2-day-old Oregon-R (wild type), (lane 2) 2-day-old rdgBKS222, (lane 3) 2-day-old rdgBsu100, and (lane 4) 2-day-old rdgB2 (a null allele) flies were tested by immunoblots with anti-RdgB monoclonal antibody. Equivalent levels of protein, ~15% of wild type, were found in the rdgBsu100 and rdgBKS222 flies at 2 days after eclosion. No RdgB protein was detected in rdgB2 extracts. (B) A schematic of the RdgB protein and its putative domains. The N and C termini, the PITP domain, a region that binds Ca2+ in vitro (Ca2+), and the six putative hydrophobic membrane-spanning domains are shown (VIHTELIC et al. 1991 , VIHTELIC et al. 1993 ). The cytoplasmic and lumenal sides of the SRC are labeled. The rdgBKS222 nonsense mutation at Gln147 (small black bar) and the two rdgBsu100 missense mutations (His542Glu and Asp543His) in the first lumenal loop (small white bar) are shown.

The rdgB^su100 is an intragenic suppressor of rdgB^KS222:
The rdgB^su100 mutation was intriguing for two reasons: first, it was an X-linked suppressor that was not a norpA allele and second, recombination mapping placed it very close to the rdgB^KS222 mutation. In fact, we failed to separate the rdgB^KS222 and rdgB^su100 mutations among 3845 recombinants. However, rdgB^su100 behaved as an unusual rdgB allele because it was a recessive rather than a dominant suppressor.

To determine the molecular nature of this mutation, we sequenced the rdgB^KS222 and rdgB^su100 alleles. While the rdgB^KS222 allele contains a single nonsense mutation (Gln147TAG) within the PITP domain (Figure 1B), immunoblots reveal that rdgB^KS222 expresses low levels of wild-type-sized RdgB protein rather than a truncated protein (Figure 1A). This is not a cross-reacting protein because we failed to detect a similar protein in the rdgB² null mutant (Figure 1A). We performed RT-PCR on rdgB^KS222 mRNA to determine if alternative splicing removed the termination codon to yield the full-length RdgB protein. The sequences of 27 clones generated from five independent RT-PCR reactions were identical to the wild-type rdgB sequence (VIHTELIC et al. 1991 ), except for the presence of the nonsense mutation. Translation through the nonsense mutation, rather than alternative splicing, must yield the full-length RdgB protein in rdgB^KS222 flies. Both rdgB^KS222 and the rdgB^su100 flies (generated from rdgB^KS222) expressed nearly identical levels of RdgB protein on immunoblots (21.5 ± 3.1 and 23.4 ± 2.2%, respectively; Figure 1A). Therefore, the suppression is not through increased amounts of full-length RdgB protein. The rdgB^su100 allele contained the expected rdgB^KS222 nonsense mutation and two additional second-site mutations (His542Glu and Asp543His, Figure 1B) in RdgB's first putative lumenal loop (VIHTELIC et al. 1993 ). It is likely that these two missense mutations partially restore RdgB activity by interacting with the rdgB^KS222 mutation in the PITP domain, which was previously shown to be critical and sufficient for RdgB activity in vivo (MILLIGAN et al. 1997 ).

The rdgB^su100 mutation delayed the rdgB^KS222 deep pseudopupil loss by only a few days (Figure 2B), which was the weakest effect by any of the five suppressors that we isolated. Light microscope sections of 10-day-old rdgB^su100 flies raised in a 12-hr light:dark cycle that lacked a deep pseudopupil revealed some disorganized ommatidia and small and/or missing R1-6 rhabdomeres that were not apparent in the wild type (Figure 2E and Figure C, respectively). However, these rdgB^su100 retinas lacked the massive degeneration observed in identically raised rdgB^KS222 flies (Figure 2D). Electron microscopy confirmed that rdgB^su100 R1-6 photoreceptors were abnormally shaped and had reduced rhabdomeres at 10 days relative to the wild type (Figure 2H and Figure F, respectively), but they lacked the complete R1-6 cell and rhabdomere loss observed in rdgB^KS222 flies (Figure 2G). The rapid rdgB^su100 deep pseudopupil loss is clearly caused by the disruption of the precisely reiterated R1-6 rhabdomeric trapezoid within and between adjacent ommatidia. While the rdgB^su100 mutation did not dramatically restore the ERG light response amplitude (9 and 6 mV for rdgB^su100 and rdgB^KS222, respectively; Figure 1A), it did possess an off transient that is absent in rdgB^KS222 ERGs. The presence of the off transient indicates that these photoreceptors may possess either an improved light response physiology or better synaptic connections than rdgB^KS222 photoreceptors.

View larger version (85K): In this window In a new window Download PPT slide   Figure 2. Phenotype of the rdgBsu100 intragenic suppressor. (A) The ERG light response of 1- to 2-day-old rdgBKS222, rdgBsu100, and Oregon-R (wild-type) flies, raised in 12-hr light:dark cycle, are shown. Flies were dark adapted for 4 min before a 2-sec light stimulus, as indicated by the raised bar below the ERGs. Scales of 5 mV and 2 sec are shown. The rdgBsu100 mutations are in a rdgBKS222 mutant background. (B) Flies were raised in either constant light [rdgBKS222 (open circles), rdgBsu100 (open squares), Oregon-R (open triangles)] or a 12-hr light:dark cycle [rdgBKS222 (solid circles), rdgBsu100 (solid squares)] and analyzed daily for the presence of a deep pseudopupil (dpp+). The percent of dpp+ flies on each day is plotted against their age. (C–E) Light microscopy of 10-day-old Oregon-R (C), rdgBKS222 (D), and rdgBsu100 (E) flies raised in a 12-hr light:dark cycle. The size of the rdgBsu100 R1-6 rhabdomeres are reduced relative to the R7 rhabdomere (arrowhead), and some of the ommatidia are misshapen (arrow). The rdgBKS222 (D) and rdgBsu100 (E) retinas lacked a deep pseudopupil before histology. (F–H) Wild-type (F), rdgBKS222 (G), and rdgBsu100 (H) flies were raised in a 12-hr light:dark cycle for 10 days, and retinal sections were examined by electron microscopy. The R7 rhabdomeres are labeled.

Characterization of the autosomal su(rdgB)69:
The su(rdgB)69 complementation group consists of four alleles (Table 1) with nearly identical phenotypes. The su(rdgB)69 mutation significantly slowed the loss of the rdgB^KS222 deep pseudopupil under both 12-hr light:dark and constant light regimens (>50% of the flies retained a deep pseudopupil at >30 and 5 days, respectively; Figure 3B). The only obvious histological abnormality in rdgB^KS222; su(rdgB)69 flies raised in 12-hr light:dark for 10 days was the reduced size of the R1-6 rhabdomeres relative to R7 (Figure 3E). This is in stark contrast to the massive loss of ommatidial organization and photoreceptor cells in 10-day-old rdgB^KS222 mutant retinas (Figure 3D). Even at 20 days, the rdgB^KS222; su(rdgB)69 retina lacked only a few rhabdomeres per ommatidium (Figure 3F). The su(rdgB)69 mutation also effectively improved the rdgB^KS222 ERG light response amplitude from 6 to 15 mV, relative to the 24 mV for similarly aged wild-type flies (Figure 3A).

View larger version (70K): In this window In a new window Download PPT slide   Figure 3. Suppression of rdgBKS222 by su(rdgB)69. (A) The ERG light response of 1- to 2-day-old rdgBKS222, rdgBKS222; su(rdgB)69, and Oregon-R (wild-type) flies raised in a 12-hr light:dark cycle were recorded as in Figure 2. Scales of 5 mV and 2 sec are shown. (B) Vermilion-eyed [rdgB2 and rdgB2; su(rdgB)69] or wild-type eye-colored (all others) flies were raised either in constant light [rdgBKS222 (open circles), rdgBKS222; su(rdgB)69 (open squares), Oregon-R (open triangles)] or in a 12-hr light:dark cycle [rdgBKS222 (solid circles), rdgBKS222; su(rdgB)69 (solid squares), rdgB2 (open cross), rdgB2; su(rdgB)69 (solid cross)] and analyzed daily for the presence of a deep pseudopupil (dpp+). The percent of dpp+ flies on each day is plotted against their age. (C–F) Retinal sections of Oregon-R (C), rdgBKS222 (D), and rdgBKS222; su(rdgB)69 (E and F) flies raised in a 12-hr light:dark cycle for either 10 days (C–E) or 20 days (F) were examined by light microscopy. The R7 rhabdomere (arrowhead) is indicated for orientation. The 20-day-old rdgBKS222; su(rdgB)69 retinas (F) possess several ommatidia that lack one to two rhabdomeres (white arrows). rdgBKS222; su(rdgB)69 flies that possessed or lacked a deep pseudopupil gave similar histological results.

Because su(rdgB)69 strongly suppressed the rdgB^KS222 retinal degeneration phenotype, we examined if it also suppressed the rdgB² null retinal degeneration phenotype. The su(rdgB)69 allele significantly slowed the time course of the rdgB²-dependent deep pseudopupil loss, although not as dramatically as with rdgB^KS222 (Figure 3B). Surprisingly, the ERG light response of newly eclosed rdgB²; su(rdgB)69 flies was nearly identical to that of rdgB² flies (data not shown).

Characterization of the autosomal su(rdgB)82:
The weakest of the four autosomal suppressors, su(rdgB)82, is located on the right arm of the second chromosome (Table 1). This suppressor slowed the rdgB^KS222 retinal degeneration such that 50% of the rdgB^KS222; su(rdgB)82 flies retained a deep pseudopupil at days 3 and 13 under constant light and 12-hr light:dark regimens, respectively (Figure 4B). Retinal sections of 10-day-old rdgB^KS222; su(rdgB)82 flies (raised in 12-hr light:dark) revealed great variability in the extent of degeneration. Flies retaining a deep pseudopupil showed excellent ommatidial arrangement, few missing rhabdomeres, and highly variable R1-6 rhabdomere sizes (Figure 4E). Retinal sections of sibling flies that lacked a deep pseudopupil were indistinguishable from 10-day-old rdgB^KS222 mutant flies (Figure 4F and Figure D, respectively). While the ERG light response amplitude of rdgB^KS222; su(rdgB)82 flies (8 mV) was not significantly different than that of rdgB^KS222 flies (6 mV; Figure 4A), it possessed an off transient.

View larger version (68K): In this window In a new window Download PPT slide   Figure 4. Suppression of rdgBKS222 by su(rdgB)82. (A) The ERG light responses of 1- to 2-day-old rdgBKS222, rdgBKS222; su(rdgB)82, and Oregon-R (wild-type) flies raised in a 12-hr light:dark cycle were recorded as in Figure 2. Scales of 5 mV and 2 sec are shown. (B) Flies were raised in either constant light [rdgBKS222 (open circles), rdgBKS222; su(rdgB)82 (open squares), Oregon-R (open triangles)] or in a 12-hr light:dark cycle [rdgBKS222 (solid circles), rdgBKS222; su(rdgB)82 (solid squares)] and analyzed daily for the presence of a deep pseudopupil (dpp+). The percent of dpp+ flies on each day is plotted against their age. (C–F) Oregon-R (C), rdgBKS222 (D), and rdgBKS222; su(rdgB)82 (E and F) flies were raised in a 12-hr light:dark cycle for 10 days, and retinal sections were examined by light microscopy. The dpp+ rdgBKS222; su (rdgB)82 retina (E) possesses several ommatidia with swollen cell bodies or lacking a single rhabdomere (white arrows), as well as R1-6 rhabdomeres that vary in size relative to R7 (arrowheads).

Characterization of the autosomal dominant suppressors Su(rdgB)83 and Su(rdgB)116:
Two dominant suppressors were isolated, Su(rdgB)83 and Su(rdgB)116, which mapped to the right arms of the third and second chromosomes, respectively (Table 1). Both Su(rdgB)83 and Su(rdgB)116 slowed the rdgB^KS222 deep pseudopupil loss to a similar rate. Half of the rdgB^KS222; Su(rdgB)83 flies possessed a deep pseudopupil until days 4 and 22 under constant light and 12-hr light:dark conditions, respectively (Figure 5B), while half the rdgB^KS222; Su(rdgB)116 flies retained their deep pseudopupil until day 5 in constant light or day 21 in a 12-hr light:dark regimen (Figure 5C). However, the suppressed degeneration phenotypes were histologically distinct. While 10-day-old rdgB^KS222; Su(rdgB)83 flies raised in 12-hr light:dark showed loss of some R1-6 rhabdomeres and photoreceptor cell bodies, large variability in R1-6 rhabdomere size, and holes in the retinal tissue (Figure 5F), they were better organized and possessed larger R1-6 rhabdomeres than similarly aged rdgB^KS222 retinas (Figure 5E). The rdgB^KS222; Su(rdgB)116 R1-6 rhabdomeres were uniformly smaller than those from the wild type, but very few R1-6 rhabdomeres or photoreceptors were missing, and the overall ommatidial arrangement was well intact (Figure 5G). However, the superior ommatidial organization of rdgB^KS222; Su(rdgB)116 relative to rdgB^KS222; Su(rdgB)83 did not correlate with an improved light response. The ERG light response amplitudes of rdgB^KS222; Su(rdgB)83 flies and rdgB^KS222; Su(rdgB)116 flies were ~16 and 12 mV, respectively (Figure 5A).

View larger version (70K): In this window In a new window Download PPT slide   Figure 5. Dominant suppression of rdgBKS222 by Su(rdgB)83 and Su(rdgB)116. (A) The ERG light responses of 1- to 2-day-old rdgBKS222, Oregon-R (wild-type), rdgBKS222; Su(rdgB)83/+, and rdgBKS222; Su(rdgB)116/+ flies raised in a 12-hr light:dark cycle were recorded as in Figure 2. Scales of 5 mV and 2 sec are shown. (B and C) Flies were raised in either constant light [rdgBKS222 (open circles), rdgBKS222; Su(rdgB)83/+ (open squares, B), rdgBKS222; Su(rdgB)116/+ (open squares, C), Oregon-R (solid triangles)] or in a 12-hr light:dark cycle [rdgBKS222 (solid circles), rdgBKS222; Su(rdgB)83/+ (solid squares, B), rdgBKS222; Su(rdgB)116/+ (solid squares, C)] and analyzed daily for the presence of a deep pseudopupil (dpp+). The percent of dpp+ flies on each day is plotted against their age. (D–G) Oregon-R (D), rdgBKS222 (E), rdgBKS222; Su(rdgB)83/+ (F), and rdgBKS222; Su(rdgB)116/+ (G) flies were raised in a 12-hr light:dark cycle for 10 days, and retinal sections were examined by light microscopy. Ommatidia lacking rhabdomeres and/or cell bodies (white arrows) and large holes in the section (black arrows) are marked. The R7 rhabdomere (arrowhead) is shown for orientation. rdgBKS222; Su(rdgB)116/+ flies that either retained or lacked a deep pseudopupil gave similar histological results.

Phenotypes of the suppressors in a wild-type (rdgB⁺) background:
We examined each autosomal suppressor in a rdgB⁺ background for either a deep pseudopupil phenotype or an aberrant ERG light response. All the suppressors possessed wild-type ERG light responses (data not shown). The only detectable abnormality associated with any of the suppressors was a light-enhanced deep pseudopupil loss for Su(rdgB)116 flies (Figure 6A). The histology of Su(rdgB)116/+ retinas (Figure 6C) was very similar to rdgB^KS222; Su(rdgB)116/+ (Figure 5G), with small R1-6 rhabdomeres, very few missing rhabdomeres, and few swollen cell bodies in the retinal sections. Even at 20 days, Su(rdgB)116/+ retinas (Figure 6D) exhibited relatively few abnormalities in the photoreceptor cells and ommatidial organization. Because the rdgB^KS222; Su(rdgB)116/+ deep pseudopupil loss was significantly faster than that of Su(rdgB)116/+ (Figure 5C and Figure 6A, respectively), the Su(rdgB)116 mutation must not completely suppress the rdgB^KS222 degeneration phenotype.

View larger version (82K): In this window In a new window Download PPT slide   Figure 6. The Su(rdgB)116 mutant exhibits a dominant retinal degeneration phenotype. (A) Flies were raised in either constant light [Su(rdgB)116/+ (open squares), Oregon-R (open triangles)] or in a 12-hr light:dark cycle [Su(rdgB)116/+ (solid squares), Oregon-R (solid triangles)] and analyzed daily for the presence of a deep pseudopupil (dpp+). The percent of dpp+ flies on each day is plotted against their age. (B–D) Oregon-R (B) and Su(rdgB)116/+ (C and D) flies were raised in a 12-hr light:dark cycle for either 10 days (B and C) or 20 days (D), and retinal sections were examined by light microscopy. The 10-day-old Su(rdgB)116/+ retinas possess small R1-6 rhabdomeres, relative to R7 (arrowheads), and several ommatidia lack a single rhabdomere (white arrow, C). Swollen cell bodies (black arrows) are also present by 20 days after eclosion (D). Su(rdgB)116/+ flies that either retained or lacked a deep pseudopupil gave similar histological results.

The Drosophila trp mutation, but not inaC, suppresses rdgB retinal degeneration:
Because previous experiments indicated that the rdgB-mediated retinal degeneration was dependent on stimulation of PKC in the visual transduction cascade, we examined the ability of two visual transduction mutations (inaC and trp) to suppress rdgB degeneration. The inaC gene encodes a retinal-specific PKC (INAC; SMITH et al. 1991 ), while the trp gene encodes one of the light-activated calcium channels (TRP; HARDIE and MINKE 1992 ).

During a 12-hr light:dark cycle, inaC²⁰⁹ flies maintained their deep pseudopupil for at least 15 days (Figure 7). However, rdgB^ota1; inaC²⁰⁹ and rdgB^KS222; inaC²⁰⁹ deep pseudopupil loss was not significantly different from that of rdgB^ota1 and rdgB^KS222 flies, respectively (Figure 7). Retinal sections confirmed that inaC²⁰⁹ failed to suppress the photoreceptor degeneration and ommatidial disorganization apparent in 6-day-old rdgB^ota1 and rdgB^KS222 flies (Figure 8).

View larger version (36K): In this window In a new window Download PPT slide   Figure 7. Effect of trpCM and inaC209 mutations on rdgB-deep pseudopupil loss. Wild-type eye-colored rdgBota1 (hatched circles), rdgBota1; trpCM (solid circles), rdgBota1; inaC209 (open circles), rdgBKS222 (hatched squares), rdgBKS222; trpCM (solid squares), rdgBKS222; inaC209 (open squares), trpCM (solid diamonds), and white-eyed inaC209 (solid diamonds) flies were raised in a 12-hr light:dark cycle and analyzed daily for the presence of a deep pseudopupil (dpp+). The percent of dpp+ flies on each day is plotted against their age. No deep pseudopupil loss was observed for either the inaC209 or trpCM flies.

View larger version (179K): In this window In a new window Download PPT slide   Figure 8. Effect of inaC209 and trpCM mutations on the rdgB-dependent retinal degeneration. Wild-type eye-colored Oregon-R (A), trpCM (B), inaC209 (C), rdgBota1 (D), rdgBota1; trpCM (E), rdgBota1; inaC209 (F), rdgBKS222 (G), rdgBKS222; trpCM (H), and rdgBKS222; inaC209 (I) flies were raised in a 12-hr light: dark cycle for 6 days and retinal sections were examined by light microscopy. The Oregon-R, trpCM, inaC209, rdgBota1; trpCM, and rdgBKS222; trpCM flies possessed a deep pseudopupil, while the rdgBota1, rdgBKS222, rdgBota1; inaC209, and rdgBKS222; inaC209 flies lacked a deep pseudopupil. Large holes in the retinal sections (black arrows) are observed in D, F, G, and I. Ommatidia lacking the full complement of seven rhabdomeres (white arrows) are shown. The size of the R1-6 rhabdomeres in some ommatidia is significantly smaller than R7 (arrowheads). Bar in A, 10 µm.

The trp^CM flies also maintained their deep pseudopupil for at least 15 days (Figure 7). The rdgB^ota1; trp^CM flies began losing their deep pseudopupil 7 days after eclosion in a 12-hr light:dark cycle, 6 days later than rdgB^ota1 flies (Figure 7). Thus, trp^CM slowed the initiation of rdgB^ota1 retinal degeneration without completely preventing deep pseudopupil loss. While trp^CM failed to delay initiation of rdgB^KS222 retinal degeneration, it significantly slowed the rate of deep pseudopupil loss (Figure 7). Retinal sections confirmed that trp^CM dramatically suppressed photoreceptor degeneration and ommatidial disorganization in both rdgB^ota1 and rdgB^KS222 flies (Figure 8). Consistent with the deep pseudopupil loss results, the rdgB^KS222; trp^CM retina possessed a higher degree of ommatidial disorganization and significantly more R1-6 rhabdomere loss than the rdgB^ota1; trp^CM retina (Figure 8H and Figure E, respectively). Thus, TRP activity, but not INAC, is required for rdgB-mediated retinal degeneration.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The Drosophila RdgB is a novel integral membrane PITP (VIHTELIC et al. 1993 ) that is required for the viability of the photoreceptor cell and to produce a light response. While expressing only RdgB's N-terminal PITP domain as a soluble protein (RdgB-PITP) is sufficient to prevent retinal degeneration and restore the ERG light response in rdgB² null mutants, phospholipid transfer is not the critical activity (MILLIGAN et al. 1997 ). Furthermore, the identification of a functionally equivalent vertebrate RdgB ortholog makes elucidating RdgB's function more relevant (CHANG et al. 1997 ; GUO and YU 1997 ). Identifying suppressors of rdgB-dependent degeneration revealed four new features about RdgB and its mutant phenotypes. First, an intragenic rdgB^KS222 suppressor (rdgB^su100) suggested that RdgB's putative intralumenal loops could play a role in RdgB's activity. Second, three different suppressors [rdgB^su100, su(rdgB)69, and su(rdgB)82] revealed that the rdgB-dependent degeneration may not be strictly caused by a defective light response. Third, while the inaC-encoded PKC may affect RdgB activity, INAC is not required to stimulate rdgB-dependent retinal degeneration. Fourth, trp-encoded Ca²⁺ channel activity is required for rapid rdgB-dependent retinal degeneration. While the four autosomal mutations exhibited a range of suppression, only Su(rdgB)116 exhibited any detectable mutant phenotype in an rdgB⁺ background. This suggests that the other three suppressors affect redundant functions, or that the mutant phenotypes were too subtle to detect.

Genetic and molecular characterization of rdgB^KS222 and rdgB^su100 revealed several interesting features about the RdgB protein. The rdgB^KS222 mutation is a nonsense mutation (TAG) at position 147 within the PITP domain. Because we failed to detect a truncated RdgB^KS222 protein on immunoblots and RT-PCR confirmed the presence of the nonsense mutation in the mRNA, the truncated protein must be relatively unstable. More surprisingly, we detected low levels of wild-type-sized RdgB^KS222 protein on immunoblots, which suggests that translation proceeds through this nonsense mutation. The ability of Drosophila to translate through nonsense mutations, particularly UAG, has been described for the kelch, elav, and synapsin genes (XUE and COOLEY 1993 ; SAMSON et al. 1995 ; KLAGGES et al. 1996 ). While the rdgB^KS222 mutant phenotypes could result from reduced levels of RdgB protein, immunoblots reveal that the mechanism of rdgB^su100 suppression is not caused by increased steady-state levels of RdgB protein relative to rdgB^KS222 (Figure 1A). Because rdgB^su100 is a recessive suppressor, the RdgB^su100 protein likely possesses more activity than the RdgB^KS222 protein and less than RdgB⁺. Confirmation of this hypothesis must await a biochemical assay for RdgB. While RdgB's N-terminal PITP domain is sufficient and essential for in vivo function (MILLIGAN et al. 1997 ), the rdgB^su100 molecular data suggest that other regions of the protein can affect RdgB's activity in vivo.

While the rdgB^su100 mutations did not significantly delay deep pseudopupil loss (Figure 2B), they dramatically slowed R1-6 rhabdomere and cell body degeneration (Figure 2G and Figure H). The small perturbations in the rdgB^su100 rhabdomere and ommatidial arrangement most likely resulted in deep pseudopupil loss. While the ERG light response amplitude of rdgB^su100 flies was not significantly different from that of rdgB^KS222, the rdgB^su100 flies did possess an off transient (Figure 2A) that originated postsynaptically to the photoreceptors in the lamina (reviewed in PAK 1975 ). All four autosomal suppressors also restored the off transient, even if the light response was not significantly different from that of rdgB^KS222. Thus, the presence of off transients may indicate an improved light response or simply the preservation of the photoreceptor cells' synaptic connections in the lamina caused by the dramatically slowed degeneration. Two models exist for the preservation of the rdgB^su100 photoreceptors without significant restoration of the ERG light response. First, the rdgB^KS222-dependent degeneration is not a direct consequence of the abnormal light response physiology, which suggests that RdgB is required for multiple and distinct photoreceptor cell functions. This is supported by su(rdgB)82 dramatically slowing rdgB^KS222 retinal degeneration without significantly affecting the mutant ERG light response, and by su(rdgB)69 slowing the rdgB² null deep pseudopupil loss without significantly restoring the ERG light response. To further support that rdgB-dependent degeneration and defective light response are not intimately linked, expressing an RdgB protein lacking the Ca²⁺-binding domain restores a wild-type ERG light response in rdgB² flies without fully preventing retinal degeneration (R. B. ELAGINA, S. C. MILLIGAN and D. R. HYDE, unpublished results). Alternatively, the ERG light response may be more sensitive to perturbations in RdgB activity than in photoreceptor viability. Thus, the rdgB^su100 mutations restored sufficient RdgB activity to suppress retinal degeneration without providing the minimal activity required for the wild-type ERG light response. However, this model fails to explain how an RdgB protein lacking the Ca²⁺-binding domain restores a normal ERG light response in rdgB² flies without preventing degeneration.

The four autosomal suppressors exhibit three unique features that were unobserved in previous rdgB suppressors. First, the autosomal suppressors lack a mutant ERG light response phenotype in an rdgB⁺ background. Because all previous suppressors disrupted the ERG light response by affecting key components of the visual transduction cascade, these new suppressors either affect a previously unrecognized aspect of RdgB function, or they affect redundant components in the light response. Second, the four autosomal suppressors most likely compensate for reduced activity in the rdgB^KS222 mutant. However, immunoblots reveal that this is not caused by increased RdgB protein levels (data not shown). Surprisingly, su(rdgB)69 compensated for complete loss of RdgB activity in rdgB² flies to delay deep pseudopupil loss. Third, two of these mutations are the first identified dominant suppressors of rdgB-mediated retinal degeneration. Unlike rdgB suppressors that inactivate the visual transduction cascade, these dominant suppressors may stimulate components downstream of RdgB that are normally not activated in the rdgB mutant.

The dominant Su(rdgB)116 mutation was the only autosomal suppressor that possessed a mutant phenotype in a rdgB⁺ background. The Su(rdgB)116/+ fly exhibited shrinking rhabdomeres and no obvious photoreceptor cell loss. The dominant Su(rdgB)116/+ histology is more similar to the hypomorphic ninaE mutants than to rdgB (LEONARD et al. 1992 ; KUMAR and READY 1995 ), although the Su(rdgB)116/+ flies lacked the characteristic nina mutant ERG light response (STEPHENSON et al. 1983 ). While the histology of the rdgB^KS222; Su(rdgB)116/+ double mutant was indistinguishable from the Su(rdgB)116/+ mutant, the time course of deep pseudopupil loss for rdgB^KS222; Su(rdgB)116/+ flies was significantly faster than for Su(rdgB)116/+ flies (Figure 5C and Figure 6A, respectively). This suggests that the suppression of rdgB^KS222-dependent degeneration was incomplete. It is unclear if the gradual rhabdomere loss directly mediates the rdgB^KS222 suppression, or if an underlying cellular process affects both rhabdomere size and photoreceptor viability.

RdgB was postulated to function after PKC in the fly visual transduction cascade on the basis of pharmacological experiments (MINKE et al. 1990 ). Later, the inaC²⁰⁹ mutation was shown to suppress rdgB^EE170-mediated retinal degeneration (SMITH et al. 1991 ). However, the flies were exposed to light for only 90 min, and the exact nature of the rdgB^EE170 allele is unknown. In a 12-hr light:dark cycle, inaC²⁰⁹ did not suppress degeneration of either rdgB^KS222 or rdgB^ota1, which is a Pro93Ser mutation in the PITP domain (S. C. MILLIGAN and D. R. HYDE, unpublished results). Finally, mutation of a putative PKC phosphorylation site (Thr59Glu) in RdgB's PITP domain inactivates RdgB in vivo, although it does not affect PI transfer activity in vitro (MILLIGAN et al. 1997 ). Taken together, the inaC-encoded PKC may regulate some aspect of RdgB's function, although PKC is not directly upstream of RdgB and is not required for rdgB-dependent retinal degeneration. Consistent with earlier results (CHEN and STARK 1983 ; STARK and SAPP 1989 ), the trp^CM mutation failed to prevent retinal degeneration in rdgB^KS222 and rdgB^ota1 flies. However, the trp^CM mutation significantly slowed the onset and/or rate of rdgB^KS222 and rdgB^ota1 retinal degeneration. This is consistent with Ca²⁺ channel blockers suppressing rdgB-mediated retinal degeneration (SAHLY et al. 1992 ). The trp mutant has decreased light-dependent influx of Ca²⁺ into the retinal cell (PERETZ et al. 1994 ), which is consistent with rdgB degeneration resulting from increased intracellular Ca²⁺ levels (SAHLY et al. 1994 ). The increased Ca²⁺ influx in inaC mutants (PERETZ et al. 1994 ) is also consistent with inaC²⁰⁹ failing to suppress rdgB degeneration. Taken together, these results suggest that either the RdgB protein may modulate intracellular Ca²⁺ levels, or that RdgB may be regulated by Ca²⁺. RdgB's localization to the subrhabdomeric cisternal membrane (VIHTELIC et al. 1993 ; SUZUKI and HIROSAWA 1994 ), a putative intracellular Ca²⁺ store, and the potential Ca²⁺-binding site in the RdgB protein is consistent with either of these two models.

	ACKNOWLEDGMENTS

We thank the members of the Hyde lab and Dr. Joseph O'Tousa for kindly reading the manuscript and providing constructive comments. We thank Drs. William L. Pak, John Carlson, Craig Montell and Charles Zuker for norpA, rdgB^ota1, trp^CM, and dgq^9-1 mutants, respectively. We are grateful to several undergraduates who participated in various aspects of screening the rdgB^KS222 suppressors, including Nicole Rauert, Aaron Schetter and Brie Schaeffer. We appreciate Yan Cheng's expertise in tissue sectioning and electron microscopy of the retinas. We thank Scott Milligan for providing the initial findings on the suppression of rdgB^ota1 degeneration by trp^CM. This work was supported by a National Institutes of Health research grant (R01-EY08058) to D.R.H. and a summer fellowship from the Fight for Sight research division of Prevent Blindness America to D.W.P.

Manuscript received June 8, 1998; Accepted for publication October 29, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ARNON, A., B. COOK, B. GILLO, C. MONTELL, and Z. SELINGER et al., 1997  Calmodulin regulation of light adaptation and store-operated dark current in Drosophila photoreceptors. Proc. Natl. Acad. Sci. USA 94:5894-5899[Abstract/Free Full Text].

ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BANKAITIS, V. A., D. E. MALEHORN, S. D. EMR, and R. GREENE, 1989  The Saccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that is required for transport of secretory proteins from the yeast Golgi complex. J. Cell Biol. 108:1271-1281[Abstract/Free Full Text].

BLAKE, A., L. B. BENDER, P. M. O'DAY, M. LONERGAN, and T. R. VENKATESH, 1991  Fused rhabdomeres (fur) in Drosophila: an eye mutation that alters rhabdomere morphology and retinal function. J. Neurogenet. 7:213-228[Medline].

BLOOMQUIST, B. T., R. D. SHORTRIDGE, S. SCHNEUWLY, M. PERDEW, and C. MONTELL et al., 1988  Isolation of a putative phospholipase C gene of Drosophila, norpA, and its role in phototransduction. Cell 54:723-733[Medline].

CHANG, J. T., S. MILLIGAN, Y. LI, C. E. CHEW, and J. WIGGS et al., 1997  Mammalian homolog of Drosophila retinal degeneration B rescues the mutant fly phenotype. J. Neurosci. 17:5881-5890[Abstract/Free Full Text].

CHEN, D.-M. and W. S. STARK, 1983  Sensitivity and adaptation in the Drosophila phototransduction and photoreceptor degeneration mutants trp and rdgB.. J. Insect Physiol. 29:133-140.

CLEVES, A., T. MCGEE, and V. BANKAITIS, 1991  Phospholipid transfer proteins: a biological debut. Trends Cell Biol. 1:30-34[Medline].

FRANCESCHINI, N., 1972 Pupil and pseudopupil in the compound eye of Drosophila, pp. 75–82 in Information Processing in the Visual Systems of Arthropods, edited by R. WEHNER. Springer-Verlag, Berlin.

GUO, J. and F. X. YU, 1997  Cloning and characterization of human homologue of Drosophila retinal degeneration B: a candidate gene for degenerative retinal diseases. Dev. Genet. 20:235-245[Medline].

HARDIE, R. C. and B. MINKE, 1992  The trp gene is essential for a light-activated Ca²⁺ channel in Drosophila photoreceptors. Neuron 8:643-651[Medline].

HARDIE, R. C., A. PERETZ, E. SUSS-TOBY, A. ROM-GLAS, and S. A. BISHOP et al., 1993  Protein kinase C is required for light adaptation in Drosophila photoreceptors. Nature 363:634-637[Medline].

HARRIS, W. A. and W. S. STARK, 1977  Hereditary retinal degeneration in Drosophila melanogaster: a mutant defect associated with the phototransduction process. J. Gen. Physiol. 69:261-291[Abstract/Free Full Text].

HOTTA, Y. and S. BENZER, 1970  Genetic dissection of the Drosophila nervous system by means of mosaics. Proc. Natl. Acad. Sci. USA 67:1156-1163[Abstract/Free Full Text].

HYDE, D. R., S. MILLIGAN and T. S. VIHTELIC, 1995 The role of the retinal degeneration B protein in the Drosophila visual system, pp. 243–254 in Degenerative Diseases of the Retina, edited by R. E. ANDERSON, M. M. LAVAIL and J. G. HOLLYFIELD. Plenum Press, New York.

KLAGGES, B. R. E., G. HEIMBECK, T. A. GODENSCHWEGE, A. HOFBAUER, and G. O. PFLUGFELDER et al., 1996  Invertebrate synapsins: a single gene codes for several isoforms in Drosophila. J. Neurosci. 16:3154-3165[Abstract/Free Full Text].

KUMAR, J. P. and D. F. READY, 1995  Rhodopsin plays an essential structural role in Drosophila photoreceptor development. Development 121:4359-4370[Abstract].

LAEMMLI, U. K., 1970  Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].

LARRIVEE, D. C., S. K. CONRAD, R. S. STEPHENSON, and W. L. PAK, 1981  Mutation that selectively affects rhodopsin concentration in the peripheral photoreceptors of Drosophila melanogaster.. J. Gen. Physiol. 78:521-545[Abstract/Free Full Text].

LEE, Y. J., S. SHAH, E. SUZUKI, T. ZARS, and P. M. O'DAY et al., 1994  The Drosophila dgq gene encodes a G protein that mediates phototransduction. Neuron 13:1143-1157[Medline].

LEONARD, D. S., V. D. BOWMAN, D. F. READY, and W. L. PAK, 1992  Degeneration of photoreceptors in rhodopsin mutants of Drosophila.. J. Neurobiol. 23:605-626[Medline].

LINDSLEY, D. L. and G. ZIMM, 1990  The genome of Drosophila melanogaster. 4. Genes L–Z. Dros. Inf. Serv. 68:89-90.

MILLIGAN, S., J. G. ALB, R. B. ELAGINA, V. A. BANKAITIS, and D. R. HYDE, 1997  The phosphatidylinositol transfer protein domain of Drosophila retinal degeneration B protein is essential for photoreceptor cell survival and recovery from light stimulation. J. Cell Biol. 139:351-363[Abstract/Free Full Text].

MINKE, B., C. T. RUBINSTEIN, I. SAHLY, S. BAR-NACHUM, and R. TIMBERG et al., 1990  Phorbol ester induces photoreceptor-specific degeneration in a Drosophila mutant. Proc. Natl. Acad. Sci. USA 87:113-117[Abstract/Free Full Text].

O'TOUSA, J., 1997  Normal physiology and retinal degeneration in the Drosophila visual system. Prog. Retinal Eye Res. 16:691-703.

O'TOUSA, J. E., W. BAEHR, R. L. MARTIN, J. HIRSH, and W. L. PAK et al., 1985  The Drosophila ninaE gene encodes an opsin. Cell 40:839-850[Medline].

PAK, W. L., 1975 Mutations affecting the vision of Drosophila melanogaster, pp. 703–733 in Handbook of Genetics, Vol. 3, edited by R. C. KING. Plenum Press, New York.

PERETZ, A., C. SANDLER, K. KIRSCHFELD, R. C. HARDIE, and B. MINKE, 1994  Genetic dissection of light-induced Ca²⁺ influx into Drosophila photoreceptors. J. Gen. Physiol. 104:1057-1077[Abstract/Free Full Text].

RUBBOLI, F., A. BULFONE, S. BOGNI, A. MARCHITIELLO, and M. ZOLLO et al., 1997  A mammalian homolog of the Drosophila retinal degeneration B gene: implications for the evolution of phototransduction mechanisms. Genes Funct. 1:205-214[Medline].

SAHLY, I., S. BAR-NACHUM, E. SUSS-TOBY, A. ROM, and A. PERETZ et al., 1992  Calcium channel blockers inhibit retinal degeneration in the retinal degeneration-B mutant of Drosophila. Proc. Natl. Acad. Sci. USA 89:435-439[Abstract/Free Full Text].

SAHLY, I., W. H. SCHRODER, K. ZIEROLD, and B. MINKE, 1994  Accumulation of calcium in degenerating photoreceptors of several Drosophila mutants. Vis. Neurosci. 11:763-772[Medline].

SAMSON, M.-L., M. J. LISBIN, and K. WHITE, 1995  Two distinct temperature-sensitive alleles at the elav locus of Drosophila are suppressed nonsense mutations of the same tryptophan codon. Genetics 141:1101-1111[Abstract].

SANGER, F., S. NICKLEN, and A. R. COULSON, 1977  DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].

SMITH, D. P., R. RANGANATHAN, R. W. HARDY, J. MARX, and T. TSUCHIDA et al., 1991  Photoreceptor deactivation and retinal degeneration mediated by a photoreceptor-specific protein kinase C. Science 254:1478-1484[Abstract/Free Full Text].

STARK, W. S. and S. D. CARLSON, 1982  Ultrastructural pathology of the compound eye and optic neuropiles of the retinal degeneration mutant (w rdgB^KS222) Drosophila melanogaster.. Cell Tissue Res. 255:11-22.

STARK, W. S., and R. SAPP, 1989 Retinal degeneration and photoreceptor maintenance in Drosophila: rdgB and its interaction with other mutants, pp. 467–489 in Inherited and Environmentally Induced Retinal Degenerations, edited by M. M. LAVAIL, R. E. ANDERSON and J. G. HOLLYFIELD. A. R. Liss, New York.

STEPHENSON, R. S., J. O'TOUSA, N. J. SCAVARDA, L. L. RANDALL and W. L. PAK, 1983 Drosophila mutants with reduced rhodopsin content, pp. 477–501 in The Biology of Photoreception, edited by D. COSENS and D. VINCE-PRICE. Cambridge University Press, Cambridge.

SUZUKI, E. and K. HIROSAWA, 1994  Immunolocalization of a Drosophila phosphatidylinositol transfer protein (rdgB) in normal and rdgA mutant photoreceptor cells with special reference to the subrhabdomeric cisternae. J. Electron Microsc. 43:183-189[Abstract/Free Full Text].

VIHTELIC, T. S., D. R. HYDE, and J. E. O'TOUSA, 1991  Isolation and characterization of the Drosophila retinal degeneration B (rdgB) gene. Genetics 127:761-768[Abstract].

VIHTELIC, T. S., M. GOEBL, S. MILLIGAN, J. E. O'TOUSA, and D. R. HYDE, 1993  Localization of Drosophila retinal degeneration B, a membrane-associated phosphatidylinositol transfer protein. J. Cell Biol. 122:1013-1022[Abstract/Free Full Text].

WIRTZ, K. W. A., 1991  Phospholipid transfer proteins. Annu. Rev. Biochem. 60:73-99[Medline].

XUE, F. and L. COOLEY, 1993  kelch encodes a component of intracellular bridges in Drosophila egg chambers. Cell 72:681-693[Medline].

ZARS, T. and D. R. HYDE, 1996  rdgE: a novel retinal degeneration mutation in Drosophila melanogaster.. Genetics 144:127-138[Abstract].

ZUKER, C. S., A. F. COWMAN, and G. M. RUBIN, 1985  Isolation and structure of a rhodopsin gene from D. melanogaster. Cell 40:851-858[Medline].

This article has been cited by other articles:

R. Iakhine, I. Chorna-Ornan, T. Zars, N. Elia, Y. Cheng, Z. Selinger, B. Minke, and D. R. Hyde Novel Dominant Rhodopsin Mutation Triggers Two Mechanisms of Retinal Degeneration and Photoreceptor Desensitization J. Neurosci., March 10, 2004; 24(10): 2516 - 2526.