Extragenic Suppressors of Loss-of-Function Mutations in the Aspergillus FlbA Regulator of G-Protein Signaling Domain Protein

Corresponding author: Thomas H. Adams, Department of Biology, Texas A&M University, College Station, TX 77843-3258., tom{at}bio.tamu.edu (E-mail)

Communicating editor: R. H. DAVIS

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

We showed previously that two genes, bA and fadA, have a major role in determining the balance between growth, sporulation, and mycotoxin (sterigmatocystin; ST) production by the filamentous fungus Aspergillus nidulans. fadA encodes the subunit for a heterotrimeric G-protein, and continuous activation of FadA blocks sporulation and ST production while stimulating growth. bA encodes an A. nidulans regulator of G-protein signaling (RGS) domain protein that antagonizes FadA-mediated signaling to allow development. To better understand FlbA function and other aspects of FadA-mediated growth control, we have isolated and characterized mutations in four previously undefined genes designated as sfaA, sfaC, sfaD, and sfaE (suppressors of flbA), and a new allele of fadA (fadA^R205H), all of which suppress a bA loss-of-function mutation (bA98). These suppressors overcome bA losses of function in both sporulation and ST biosynthesis. fadA^R205H, sfaC67, sfaD82, and sfaE83 mutations are dominant to wild type whereas sfaA1 is semidominant. sfaA1 also differs from other suppressor mutations in that it cannot suppress a bA deletion mutation (and is therefore allele specific) whereas all the dominant suppressors can bypass complete loss of bA. Only sfaE83 suppressed dominant activating mutations in fadA, indicating that sfaE may have a unique role in fadA-bA interactions. Finally, none of these suppressor mutations bypassed uG loss-of-function mutations in development-specific activation.

THE asexual life cycle of the filamentous ascomycete Aspergillus nidulans can be divided into two distinct phases, growth and reproduction. The growth phase involves formation of an undifferentiated network of interconnected cells, or hyphae, that form the mycelium. Under appropriate growth conditions, some of the hyphal cells can stop normal growth and begin asexual reproduction by forming complex multicellular conidiophores that produce multiple chains of uninuleate spores called conidia (for review, see ADAMS 1994 ; ADAMS et al. 1998 ). We showed previously that initiation of A. nidulans asexual reproductive development requires the ability to control proliferative growth in response to an extracellular signal that functions specifically in activating development (LEE and ADAMS 1994B ; YU et al. 1996 ). The production of this developmental signal that controls initiating of conidiation requires uG, which apparently functions in part by activating the regulator of G-protein signaling (RGS) domain protein FlbA (LEE and ADAMS 1994B , LEE and ADAMS 1996 ; YU et al. 1996 ). Other development-specific regulatory genes required for sporulation in response to the FluG signal include bB, bC, bD, bE, and brlA (see Figure 1; ADAMS et al. 1988 ; WIESER et al. 1994 ; WIESER and ADAMS 1995 ; LEE and ADAMS 1996 ).

View larger version (14K): In this window In a new window Download PPT slide   Figure 1. bA and fadA control A. nidulans growth, asexual sporulation, and ST biosynthesis. As described in the Introduction, we propose that two antagonistic signaling pathways control A. nidulans growth, asexual development, and ST production. When FadA (G) is active (GTP-bound), it signals to enhance proliferative growth and repress both asexual sporulation and ST production. This FadA-dependent growth signaling pathway is modulated by FlbA and FluG activities. FluG stimulates both development-specific events and activation of FlbA, which in turn inactivates FadA signaling. However, it is important to note that the main role of FluG in ST biosynthesis is apparently indirect, through activation of FlbA (see Introduction). The dotted arrows describe the observation that bA overexpression in fadA mutants has positive effects on asexual sporulation and ST production by an unknown mechanism (YU et al. 1996 ; HICKS et al. 1997 ). Because no bA suppressor mutations bypass uG loss-of-function mutations for developmental phenotype except ST production, we propose that the major role for the products of sfa genes in activating asexual sporulation is through their effects on FadA-mediated growth signaling (see RESULTS and DISCUSSION).

FlbA (uffy low BrlA) has a major role in determining the balance between growth and sporulation through its ability to regulate FadA (uffy autolytic dominant), the subunit for a heterotrimeric G-protein (YU et al. 1996 ). When FadA-dependent signaling is activated in response to some unknown factor it stimulates growth and blocks sporulation. FlbA has the ability to inactivate FadA, as with other RGS domain proteins (BERMAN et al. 1996 ; WATSON et al. 1996 ) probably working as a GTPase activating protein (GAP), thus allowing development to proceed. Inactivation of bA or constitutive activation of fadA (fadA^G42R, fadA^R178L fadA^G183S, fadA^R178C, and fadA^Q204L) causes uncontrolled growth and leads to proliferation of undifferentiated aerial hyphae ("uffy") that autolyse as colonies mature (YU et al. 1996 ; WIESER et al. 1997 ; this study). By contrast, overexpression of bA or dominant interfering mutations in fadA (fadA^G203R) result in inhibited hyphal growth coupled with conidiophore development, even under growth conditions that normally interfere with sporulation (LEE and ADAMS 1994A ; YU et al. 1996 ). Interestingly, in addition to its requirement for development, FlbA-directed inactivation of FadA signaling is required for biosynthesis of the aatoxin-like mycotoxin called sterigmatocystin (ST; BROWN et al. 1996 ; HICKS et al. 1997 ). This has led us to propose that sporulation and production of the secondary metabolite ST share the need to inactivate the FadA-mediated proliferation signaling pathway. However, there is an important difference in the control of asexual development vs. ST biosynthesis. While uG deletion mutants fail to produce ST and do not sporulate, mutations that inactivate FadA suppress uG deletion mutant defects in ST production but not sporulation. This implies that the main role of FluG in ST biosynthesis is activation of FlbA, which in turn inactivates FadA (Figure 1; HICKS et al. 1997 ).

While the most critical functions for FlbA involve inactivation of FadA, it is also clear that FlbA likely has other activities. Overexpression of bA causes inappropriate sporulation and precocious ST production even in a fadA mutant (YU et al. 1996 ; HICKS et al. 1997 ). This raises the possibility that FlbA could interfere with the activity of other G proteins, Gß signaling, or have a different role in activating sporulation and ST-specific genes (see Figure 1). These FlbA activities all appear to require an intact RGS domain (J.-H. YU and T. H. ADAMS, unpublished results) but FlbA is also known to share at least one other conserved region that directly precedes the RGS domain and is ~80 amino acid residues in length (PONTING and BORK 1996 ). This domain is called DEP (dishevelled, egl-10, pleckstrin) and is predicted to be a globular domain with an + ß topology (PONTING and BORK 1996 ). It is interesting that many other RGS domain proteins, including Sst2, RGS7, Egl-10, and Ya8c, have the DEP domain (PONTING and BORK 1996 ). Both RGS proteins and pleckstrin are known to function in negatively regulating critical signaling pathways, and it has been postulated that the DEP domains might regulate protein-protein interactions, but no such activity has been functionally demonstrated.

To better understand the complex role of FlbA in controlling growth and development we have isolated and begun to characterize suppressors of bA loss-of-function mutations. We expect that understanding the roles of these suppressors will allow an unbiased approach toward identifying other elements in this multicomponent signaling pathway. We describe suppressor mutations identifying five distinct loci that can overcome bA losses of function in both sporulation and ST biosynthesis. Characterization of these mutations and identification of one as a novel dominant inactivating allele of fadA are presented.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Aspergillus strains, growth conditions, genetics, and transformation:
The A. nidulans strains used in this study are listed in Table 1. Standard A. nidulans culture and genetic techniques were used (PONTECORVO et al. 1953 ; KAFER 1977 ). When appropriate (e.g., deletion detection), genotypes of strains were confirmed by genomic Southern blot analysis. Standard A. nidulans transformation techniques (YELTON et al. 1984 ; MILLER et al. 1985 ) were used with the slight modification of reducing the polyethylene glycol (PEG) treatment time from 20 min to 6 min. Whenever possible, genetic analysis was achieved via meiotic recombination. However, most of the primary isolates with bA suppressor mutations were affected in their ability to form fertile cleistothecia with PW1 (or FGSC89) in meiotic crosses. In these cases, primary recombinants were produced via parasexual genetics. Dominance of each sfa mutation was tested by generating diploid strains (dJYA1–dJYE83; see Table 1). Each diploid strain was treated with the microtubule destabilizing agent benomyl (2 mg/ml DMSO, 6- to 9-µl/plate) to produce haploid sectors. At least 20 haploid progeny were isolated from each diploid strain and tested for auxotrophic markers and/or the deletion of A. To test whether suppressor mutations can bypass A, suppressor mutant strains with a bA deletion (RJY8.9, RJY67.2, RJY82.4, and RJY83.6) were isolated from the haploid progeny of appropriate diploids. Suppressor mutant strains with uG;bA98 (TJY8.G–TJY83.G) were generated by transforming each arginine auxotroph with a uG deletion plasmid pJYGD4. Suppressor mutant strains with dominant activating alleles of fadA (TJY8.42R–TJY83.204L) were generated by transforming arginine auxotrophs with pJY8P2 (for G42R), pJYPK27 (for R178C), and pJYPK26 (for Q204L), respectively.

Mutagenesis and isolation of bA suppressor mutations:
Although bA loss-of-function mutants autolyze and fail to sporulate when grown on normal minimal medium (70 mM NaNO₃, 1% glucose; KÄFER 1997), this defect can be partially remediated by growth on medium containing a high concentration of salt (e.g., 0.8 M NaCl or 0.6 M KCl). Conidiospores isolated from a bA loss-of-function mutant (MJW98; see Table 1) grown on minimal medium with 0.8 M NaCl were mutagenized with NQO (4-nitroquinolin-1-oxide; 1 mg, 10 mg) as previously described (WIESER et al. 1994 ). Survival ratios after NQO treatment were from 0.1 to 10% depending on the length of NQO treatment. Survivors were visually screened for sporulation on complete medium (KÄFER 1997) where the bA98 mutant never sporulated. Among 100,000 survivors, 121 showed at least partial suppression of conidiation defects and 5 (SFA1, 8, 67, 82, and 83) of these mutants sporulated nearly as well as a wild type. These 5 mutants were further analyzed. Because characterization of these five suppressors identified five independent loci (no suppressor mutations were allelic to each other) an attempt was made to isolate additional suppressors to reach the saturation of mutations and/or to isolate possible alleles of the above-mentioned suppressor mutations. In a second set of mutagenesis, spores of a bA strain (RJH046; see Table 1) were mutagenized as mentioned above and among 50,000 survivors, 4 showed near complete suppression of conidiation defects (MSR123, 125, 126, 127). These 4 additional suppressors were also further characterized.

ST production analysis:
ST production was examined by inoculating ~1 x 10⁵ conidia in 3 ml of liquid complete medium (minimal medium with 2% glucose, 0.2% peptone, 0.1% yeast extract, and 0.1% casamino acids; KAFER 1977 ) in an 8-ml vial and incubated at 30° for 7 days (stationary culture) as previously described (YU and LEONARD 1995 ). ST was then extracted from 7-day-old cultures by adding 1.5 ml of CHCl₃ to the vials and then vortexed for 2 min. Vials were centrifuged at 500 x g for 5 min and the organic phase was collected, dried, resuspended in 50 µl of CHCl₃, and 4 µl of each concentrated sample was loaded for thin-layer chromatography (TLC) analysis described previously (YU and LEONARD 1995 ).

Nucleic acid manipulation:
To determine the sequence of the bA98 mutant allele the bA coding region from MJW98 genomic DNA was amplified by the polymerase chain reaction (PCR) using the synthetic oligonucleotides CTGGTTTAGTCTGATTTTCGTC and TCGTCGTAATCTCACCGCA as primers. The resulting bA98 amplicon (~2.9 kb) was sequenced directly. The fadA^R178C and fadA^Q204L dominant-activating alleles were generated by site-directed mutagenesis with the synthetic oligonucloetides GTCCTACGCagctGTGTCAAGAAC or GACGTTGGaGGcCtCCGTTCTGAG (lowercase letters represent mismatches), respectively (KUNKEL 1985 ). These oligonucleotides introduce PvuII or StuI sites that were used for screening convenience. Each 3.15-kb PstI fragment with the fadA^R178C and fadA^Q204L mutant alleles was then moved into pPK1 (WIESER and ADAMS 1995 ) to give pJYPK27 and pJYPK26, respectively. Resulting plasmids were used for transformation of suppressor mutant strains. The fadA gene from SFA8 was amplified by PCR with synthetic oligonucleotides ATGACTCTGCAGCGGGGCTATC and TCGCTGCTGCAGAGCGGCGAA. The resulting 3.15-kb amplicon was digested with PstI and cloned into pPK1 (for fadA gene structure, see YU et al. 1996 ). Four independent clones were isolated and used for transformation of RJY8.22. Two of these clones were sequenced and the mutation was also confirmed by directly sequencing the PCR product. A uG disruption vector (pJYGD4) containing the wild-type argB gene as a selective marker was constructed by replacing the trpC⁺ fragment in pTA127 (LEE and ADAMS 1994B ) with an XhoI-digested argB fragment.

Microscopy:
Photomicrographs presented in this study were taken using an Olympus BH2 compound microscope and differential interference contrast optics. All other microscopy was carried out using an Olympus SZ-11 stereo microscope and transmitted light.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Isolation of bA extragenic suppressors that identify five distinct loci:
We set out to identify extragenic suppressors of bA using a mutant strain with the bA98 allele (strain MJW98). We used this strain because its sporulation defect was less severe than for an bA deletion mutant, suggesting partial function. By using this partial-function bA98 allele we expected that we could identify both allele-specific and bypass suppressor mutations. Conidiospores from MJW98 were treated with NQO as described in MATERIALS AND METHODS and 100,000 survivors were screened to identify suppressors. From this approach, 121 at least partially sporulating strains were isolated, and 5 of these mutants (SFA1, 8, 67, 82, and 83) that sporulated nearly as well as wild types (Figure 2) were selected for further studies. Suppressor loci are designated as either sfa^S (mutant alleles) or sfa^WT (wild-type alleles).

View larger version (66K): In this window In a new window Download PPT slide   Figure 2. Phenotypes of bA suppressors. Photographs of wild-type and suppressor mutant colonies (top) and the close-up views of conidiation are shown (bottom). Panels are wild type (A and B), bA98 (C and D), bA98;sfaA1 (E and F), bA98;fadAR205H (G and H), bA98;sfaC67 (I and J), flbA98;sfaD82 (K and L), and bA98;sfaE83 (M and N).

To determine if suppression resulted from mutations within bA or from mutations in unlinked genes we attempted to cross each primary suppressed mutant strain with a developmentally wild-type strain (PW1) to look for segregation of the bA98 phenotype. However, only two of these mutants (SFA67 and SFA82) produced fertile cleistothecia when crossed with PW1. For each of these cases, ~25% of the progeny had the bA98 phenotype, indicating that sfa67 and sfa82 were extragenic bA suppressors. In both cases, the other 75% of the progeny were developmentally wild type, indicating that neither sfa67 nor sfa82 likely caused phenotypic abnormalities in a bA⁺ strain.

After repeated unsuccessful attempts to cross SFA1, SFA8, and SFA83 with different wild-type strains (PW1 or FGSC89), we chose to examine linkage of mutations to bA via parasexual (mitotic-cross) analysis. Diploids were generated from heterokaryons formed between each sfa^S;bA98 mutant (each SFA) strain and either PW1 or FGSC89. These diploid strains were then treated with the microtubule-destabilizing agent benomyl to generate haploid progeny. In every case A98;sfa^S/bA⁺;sfa^WT diploids produced haploid sectors with the bA98 phenotype as expected if the suppressor mutations were not linked to bA. All other haploid progeny appeared wild type and several of these strains were purified and used in meiotic crosses to determine their genotype. Interestingly, several strains of each type that formed fertile crosses with wild-type strains yielded 25% uffy progeny, indicating that the parent genotype was sfa^S;bA98. Thus, the sexual defect in the primary mutant strains was apparently not linked to the sfa mutation and it is important to note that each suppressor segregated as a single trait. As above, none of the sfa mutations caused phenotypic abnormalities in bA⁺ strains and no further attempts to distinguish sfa^S; bA⁺ from sfa^WT;bA⁺ were made. Finally, pairwise crosses were made between different sfa^S;bA98 mutant strains to determine how many different suppressor loci had been identified. In every case, ~25% of the progeny had the bA98 phenotype, indicating that every mutation defined a distinct locus, four of which were designated as sfaA, sfaC, sfaD, sfaE, and the fifth was a new allele of fadA (fadA^R205H; see below).

Dominance relationships of sfa mutations:
Because bA loss-of-function mutations (e.g., bA98 and bA) are recessive to the wild-type bA gene, dominance of each suppressor mutation needed to be tested in homozygous bA^- diploid. Such diploids were generated from heterokaryons resulting from fusion between the sfa^S;bA98 strains and a sfa^WT;bA (TBN39.5) mutant strain. Resulting heterokaryons were predominantly conidiating and four of the diploid strains isolated (dJYB8, dJYC67, dJYD82, dJYE83; see Table 1) sporulated like wild types when grown at 37°. These diploid strains yielded uffy haploid sectors when treated with benomyl, confirming that the suppressors had a dominant activity. The sfaA1;bA98/sfaA⁺;bA diploid strain (dJYA1; see Table 1) also sporulated but remained somewhat uffy, so that this suppressor mutation was characterized as semidominant. Interestingly, we found that when these diploid strains were incubated at 25° the phenotype reverted to uffy, indicating that the dominant suppressor mutant phenotype was cold sensitive (see Table 2). However, haploid sfa^S;A and sfa^S;bA98 strains remained conidial when grown at 25°.

View this table: In this window In a new window   Table 2. Characteristics of bA suppressors

Suppression of the bA deletion mutation:
To test whether these bA suppressor mutations could bypass a complete lack of bA function, we substituted the bA mutation for bA98 by recovering sfa^S;bA haploid progeny from the sfa^S;bA98/sfa^WT;bA diploid strain (dJYA1–dJYE83). For dJYB8, dJYC67, dJYD82, and dJYE83, conidiating bA haploid progeny were identified, indicating that fadA^R205H, sfaC67, sfaD82, and sfaE83 are all able to bypass the complete loss of bA function and are not allele specific. However, none of the conidial progeny from dJYA1 were bA, indicating that sfaA1 cannot bypass the complete lack of bA function and thus could be an allele-specific suppressor. Alternatively, the sfaA1 mutation could be on chromosome I, the same chromosome as bA (very little intrachromosomal recombination occurs in mitotic diploids). However, examination of the segregation pattern for other genes on chromosome I (yA and biA) indicated that this chromosome segregated freely among uffy progeny.

Identification of a new fadA allele:
Because we knew that some fadA mutations (e.g., fadA and fadA^G203R; YU et al. 1996 ) suppress bA loss-of-function mutations we tested the possibility that one of the suppressors was an allele of fadA by examining linkage to fadA^G203R. All but one suppressor (carried by SFA8) locus independently segregated from the fadA locus. The fadA genomic region from SFA8 was amplified by PCR and the sequence was determined to directly test if SFA8 carried an allele of fadA. We found that SFA8 carried a novel fadA mutant allele that resulted from a G-to-A transition causing conversion of Arg205 to His (fadA^R205H). This mutant allele was used to transform a bA98 mutant strain and resulted in conidial transformants, indicating that fadA^R205H represents a novel dominant negative fadA allele (see DISCUSSION and Figure 5).

View larger version (83K): In this window In a new window Download PPT slide   Figure 3. Suppressors overcome bA losses of function in ST biosynthesis. All sfaS strains also suppress ST defects caused by bA losses of function. The wild type (FGSC26; WT), bA98, bA98;sfaA1, bA98;fadAR205H, bA98;sfaC67, bA98;sfaD82, and bA98;sfaE83 strains (shown by relevant genotypes) were inoculated into 3 ml of liquid complete medium in 8-ml vials and incubated at 30° for 7 days (stationary culture). ST was extracted from each culture using chloroform, and samples were analyzed by thin-layer chromatography (YU and LEONARD 1995 ). ST standard is shown (Std).

View larger version (108K): In this window In a new window Download PPT slide   Figure 4. sfaC67 and sfaD82 mutant strains produce conidiophores in submerged culture. Approximately 5 x 105 conidia/ml were inoculated into 100 ml of liquid minimal medium (with supplements and 0.1 g of yeast extract) in 250-ml asks and incubated at 37° at 300 rpm. Micrographs of bA98 (A), bA98;sfaA1 (B), bA98;fadAR205H (C), bA98;sfaC67 (D), flbA98;sfaD82 (E), and bA98;sfaE83 (F) strains were taken at 22 hr after inoculation. Although wild-type A. nidulans strains occasionally formed conidiophores following prolonged incubation, only sfaC67 and sfaD82 strains produced conidiophores by 22 hr after inoculation and these structures were observed in every microscopic field examined.

View larger version (31K): In this window In a new window Download PPT slide   Figure 5. fadA mutant alleles. FadA primary protein structure and known dominant activating (a) and interfering (i) mutations are shown. A consensus myristoylation site (MGXXXS) is underlined near the N-terminal end. Dominant activating mutations include G42R (YU et al. 1996 ), R178C, R178L, (WIESER et al. 1997 ), G183S (WIESER et al. 1997 ), and Q204L, and dominant interfering mutations are G203R (YU et al. 1996 ) and R205H. Switch domains that are important for the proper conformational changes are shown.

sfaE83 can suppress dominant activating fadA mutations:
Because the primary function of the FlbA RGS domain protein antagonizes FadA-directed signaling (YU et al. 1996 ), and because sfa mutations suppress bA loss-of-function mutations, it was of interest to know if sfa mutations could also suppress fadA-activating alleles like fadA^G42R, which causes a dominant uffy-autolytic phenotype. To address this question, suppressor mutant strains were transformed with the fadA^G42R-activating allele to produce bA98;fadA^G42R/fadA⁺;sfa^S mutant strains. More than 50% of sfaA1, fadA^R205H, sfaC67, and sfaD82 transformants were uffy autolytic as is observed when wild type is transformed with the fadA^G42R allele. However, no uffy autolytic transformants were observed following transformation of the bA98;sfaE83 strain with the fadA^G42R allele. All bA98;sfaE83 transformants were able to conidiate and genomic DNA Southern blot analysis showed that about 50% of the total transformants had one to five copies of the fadA^G42R allele integrated into their genomes. To test whether sfaE83 suppressed other dominant activating fadA alleles an sfaE83;bA98 strain was transformed with the fadA^R178C and fadA^Q204L alleles, respectively. Again, all transformants were conidiating and ~50% of them had from one to several copies of each fadA dominant activating mutant allele (see DISCUSSION).

sfa mutants regain the ability to produce a mycotoxin ST:
Because bA suppressor mutations overcome a complete lack of bA function for sporulation, it was of interest to test their ability to suppress defects in ST biosynthesis. As shown in Figure 3 and summarized in Table 2, we examined ST production from each suppressor mutant strain as previously described grown under conditions known to favor ST biosynthetic activities in wild type, and all suppressor mutant strains produced ST. Moreover, all suppressor mutants accumulated stc (sterigmatocystin gene cluster; BROWN et al. 1996 ) transcripts with timing similar to that of the wild-type strain (data not shown).

sfaC67 and sfaD82 mutations cause inappropriate sporulation:
Because all suppressors were dominant we speculated that some of these gain-of-function suppressor mutations might behave like fadA^G203R dominant-interfering mutations and cause conidiation even in submerged culture where wild-type A. nidulans strains do not sporulate. In fact, sfaC67 and sfaD82 mutants elaborated complex conidiophores by 22 hr after inoculation in submerged culture (Figure 4). All of the other suppressor mutant strains grew like wild type in submerged culture and did not sporulate. As expected, mRNA corresponding to the developmental regulatory gene brlA accumulated in both sfaC67 and sfaD82 coincident with sporulation (data not shown).

bA suppressors do not eliminate the need for uG in sporulation:
The A. nidulans uG gene is hypothesized to be required for production of a small diffusible extracellular factor that controls initiation of development, possibly by activating FlbA (LEE and ADAMS 1994B ; LEE and ADAMS 1996 ). We showed previously that neither a dominant interfering fadA mutation (fadA^G203R) nor a deletion of fadA could overcome uG loss-of-function mutations for asexual sporulation (YU et al. 1996 ). This led us to propose that developmental activation requires uG factor-mediated events that are distinct from inhibition of FadA-mediated growth signaling. Because bA suppressors were identified on the basis of recovery of asexual sporulation, one possibility is that suppression results from hyperactivation of FadA-independent FluG signaling events. We have tested this possibility by examining the ability of bA suppressor mutations to bypass the loss of uG functions for sporulation. This was accomplished by transformation of each bA98;argB2;sfa^S strain (except sfaA1 due to the absence of appropriate strains) with pJYGD4 (containing a uG deletion replaced by argB⁺) and screening for the uG phenotype. Approximately 20% of transformants from each set of transformation experiment had the uG developmental phenotype, indicating that none of the suppressor mutations could bypass uG loss-of-function mutations for this sporulation function. However, all uG phenotypic transformants were able to produce ST as expected, if the main role of FluG in ST biosynthesis was indirect, through activating FlbA (see Introduction and Figure 1; HICKS et al. 1997 ).

Additional suppressors identify alleles of sfaD82:
Because all of the first bA suppressor mutants identified different loci and most were bypass suppressors, we decided to screen for additional suppressor mutants beginning with a bA strain. Among 50,000 survivors, 2 showed partial suppression of conidiation defects and 4 sporulated nearly as well as wild type (MSR123, 125, 126, 127). Because a bA strain was used to isolate these primary suppressor mutants, these are expected to be extragenic bypass suppressors of bA function. Meiotic crosses between these primary suppressor mutants and a developmentally wild-type strain (FGSC237) did not generate any distinguishable progeny, indicating that as with other bA mutant suppressors, these mutations were silent in bA⁺ strains. No uffy progeny arose from sexual crosses between these new suppressor mutant strains, indicating that the suppressor mutations were closely linked to one another. To test whether these suppressor mutations were alleles of previously identified bA98 suppressor mutations, mutant strains of the new series (MSR123 and MSR127) were crossed with sfaA1, sfaC67, sfaD82, sfaE83, and fadA^R205H mutant strains (RJY1.12, 67.3, 82.6, 83.21, and 8.22, respectively). Fluffy progeny were recovered from all crosses except MSR123 x RJY82.6 and MSR127 x RJY82.6 crosses, indicating that these additional suppressor mutations are likely to be alleles of sfaD82 (or represent closely linked loci). We have tentatively called these mutations sfaD123, sfaD125, sfaD126, and sfaD127, respectively. Interestingly, MSR125 (sfaD125, not shown) sporulated in submerged culture like SFA82 (sfaD82; Figure 4), but the other mutants grew like wild types, indicating that all sfaD alleles are not identical for this trait. All of these mutations were dominant at 37° but recessive at 25°, similar to sfaD82, and all mutants regained the ability to produce ST (not shown).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

We previously proposed that there are two antagonistic signaling pathways that coordinate A. nidulans growth, conidiation, and ST biosynthesis (see Introduction and Figure 1; YU et al. 1996 ; HICKS et al. 1997 ). As a step toward understanding the multiple roles of FlbA in controlling growth, sporulation, and ST biosynthesis we have isolated a collection of mutants that sporulate and produce ST even in the absence of FlbA. These mutant strains carry dominant or semidominant mutations in any of five distinct loci designated sfaA, sfaC, sfaD, sfaE, and a novel fadA allele, fadA^R205H. Because sfaA1, sfaC67, and sfaD82 mutations suppressed bA loss-of-function mutations but could not suppress fadA dominant activating mutant alleles, we propose that the normal products of these genes most likely function prior to FadA activation or are required in some other way for FadA activity.

One of the suppressor mutants (SFA8) turned out to represent a novel allele of fadA (fadA^R205H). This mutation has not been described in other G proteins but causes a dominant negative phenotype similar to the G203R mutation described earlier (YU et al. 1996 ). Arg205, like Gly203, is predicted to be a part of alpha helix 2 in the switch II region of G proteins and could therefore be required for the conformational change that triggers disengagement of G and Gß following receptor-mediated GDP-GTP exchange on G (NOEL et al. 1993 ; SONDEK et al. 1996 ). Although fadA^R205H behaves as a dominant loss-of-function mutation, this mutation differs from the fadA^G203R mutation in that it failed to stimulate submerged sporulation (see YU et al. 1996 ).

While we do not yet know what sfaA, sfaC, and sfaD encode, it is interesting to speculate that these could encode other elements of the heterotrimeric G-protein such as Gß or G. In many cases the Gß heterodimer can function in signaling downstream effectors like those stimulated by G-GTP (CLAPHAM and NEER 1993 ; NEER 1995 ). If the Gß complex associated with FadA is also required to stimulate growth and block sporulation, then loss-of-function or dominant negative mutations in either the Gß or subunits could suppress bA^- phenotype. We previously observed that the fadA^G203R dominant negative mutation caused submerged asexual sporulation, but fadA mutations did not. Given that the expected effect of fadA^G203R is to block the conformational change in the switch II region of G, preventing dissociation from Gß, one possible explanation for the different phenotypes is that inhibition or loss of Gß is required for hyperactive sporulation to occur. In keeping with this hypothesis, both sfaC67 and sfaD82 alleles caused hyperactive sporulation (Figure 4) and might therefore identify Gß or subunits.

Another possible role for sfaA, sfaC, or sfaD products is in post-translational modification of G-protein subunits. Like many G proteins, FadA contains a consensus amino acid sequence for myristoylation at its N terminus (BUSS et al. 1987 ; YU et al. 1996 ; see Figure 5). N-Myristoylation is known to be essential for G membrane association, proper G-Gß interaction, and receptor coupling (SONG and DOHLMAN 1996 ; SONG et al. 1996 ) so that mutations blocking myristoylation of FadA would be predicted to be like loss of fadA function. Similarly, prenylation of G subunits is typically required for membrane localization and for efficient downstream signaling by Gß (SIMONDS et al. 1991 ; CLARKE 1992 ; MUNTZ et al. 1992 ). Thus, loss of prenyltransferase activity could have similar effects to loss of Gß or G function.

sfaA1 differs from mutations in other suppressor genes in that it is semidominant and is unable to suppress a bA deletion mutant. Sequence analysis of the bA98 allele that sfaA1 mutation suppresses showed that a G-to-A transition occurred at the 3' border of the third intron (GT - - - AGG AAG). This mutation is predicted to cause incorrect splicing and result in a frameshift affecting the last 50 amino acids at C terminus, including the end (16 amino acids) of the RGS domain. An interesting possibility is that the bA98 mutation results in a partially functional FlbA protein that lacks RGS-GAP activity and that the sfaA1 mutation can suppress loss of GAP activity but not loss of other unknown FlbA functions. If this turns out to be true, sfaA might identify a unique activity that will help to define FlbA's additional roles.

sfaE83 differs from the other suppressor mutations in its ability to suppress not only bA loss-of-function, but also dominant activating fadA mutations (G42R, Q204L, R178C). These dominant activating fadA mutations cause a loss of (or a dramatic decrease in) the intrinsic GTPase activity of G (FadA), which is essential for inactivating heterotrimeric G-protein signaling. Thus, sfaE mutations could either block activation of FadA by preventing GDP-GTP exchange or prevent transmission of downstream FadA-mediated signaling events. In the first case, it is possible that mutations that interfere with agonist-receptor sensitization (STEFAN and BLUMER 1994 ) would prevent GDP-GTP exchange and suppress both bA loss-of-function and fadA dominant activating mutations. For the second case, many downstream effector molecules that are regulated by G-protein subunits have been described, including ion channels, phospholipase A2, protein kinases, adenylyl cyclases, and phospholipase C (for review, see CLAPHAM and NEER 1993 ; NEER 1995 ). If any of these activities are essential for FadA-mediated growth activation and inhibition of sporulation, loss-of-function mutations would be predicted to suppress both bA loss-of-function and fadA dominant activating mutations.

No bA suppressors bypass the complete lack of uG function. We proposed previously that uG is required for: (i) activation of FlbA, which then inactivates FadA, and (ii) activation of development-specific functions that require the products of other genes, including B, bC, bD, bE, and brlA (see Figure 1; ADAMS et al. 1988 ; WIESER et al. 1994 ; WIESER and ADAMS 1995 ; LEE and ADAMS 1996 ). Our earlier finding that fadA deletion and fadA^G203R dominant interfering mutant alleles did not bypass uG loss-of-function mutations in asexual sporulation led us to propose that both processes must occur if development is to proceed (YU et al. 1996 ). Because none of the bA suppressor mutations can suppress loss-of-uG function, we propose that like FlbA, the major role for the products of sfa genes in activating asexual sporulation is indirect, through their effects on FadA-mediated growth signaling.

Finally, strategies for isolating the genes identified by these suppressors need to be discussed. The fact that all the suppressor mutations are dominant or semidominant at 37° but recessive at 25° (Table 2) provides two potential strategies for isolating the corresponding genes. In the first approach, the dominant nature of these mutations can be taken advantage of in constructing cosmid libraries from the suppressor mutant strains (sfa^S;bA^-) to transform bA98 or bA deletion strains followed by screening for transformants that are developmentally wild type at 37° but uffy at 25°. Alternatively, it may be possible to take advantage of the temperature-sensitive nature of the suppressors by transforming the suppressor strains (sfa^S; bA98 or sfa^S;bA) with a wild-type genomic DNA library and screening for transformants that are conidial at 37° but are uffy at 25°. In any case, identification of each suppressor will lead us to better understand coordinate control of growth, development, and ST biosynthesis in A. nidulans.

	FOOTNOTES

¹ Present address: Cereon Genomics, LLC, Bldg. 300, 1 Kendall Sq., Cambridge, MA 02139.

	ACKNOWLEDGMENTS

We thank our colleagues in the lab for their many helpful suggestions. This work was supported by National Institutes of Health grant GM-45252 to T.H.A. and by Hellmuth Hertz Foundation and the Swedish Institute postdoctoral fellowship to S.R.

Manuscript received March 31, 1998; Accepted for publication September 25, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ADAMS, T. H., 1994 Asexual sporulation in higher fungi, pp. 367–382 in The Growing Fungus, edited by N. A. R. GOW and G. M. GADD. Chapman & Hall, London.

ADAMS, T. H., M. T. BOYLAN, and W. E. TIMBERLAKE, 1988  brlA is necessary and sufficient to direct conidiophore development in Aspergillus nidulans.. Cell 54:353-362[Medline].

ADAMS, T. H., J. K. WIESER, and J.-H. YU, 1998  Asexual sporulation in Aspergillus nidulans. Microbiol. Rev. 62:35-54[Abstract/Free Full Text].

BERMAN, D. M., T. M. WILKIE, and A. G. GILMAN, 1996  GAIP and RGS4 are GTPase activating proteins (GAPs) for the G_i subfamily of G protein subunits. Cell 86:445-452[Medline].

BROWN, D. W., J.-H. YU, H. S. KELKAR, M. FERNANDES, and T. C. NESBITT et al., 1996  Twenty-five coregulated transcripts define a sterigmatocystin gene cluster in Aspergillus nidulans. Proc. Natl. Acad. Sci. USA 93:1418-1422[Abstract/Free Full Text].

BUSS, J. E., S. E. MUMBY, P. J. CASEY, A. G. GILMAN, and B. M. SEFTON, 1987  Myristoylated alpha subunits of guanine nucleotide-binding regulatory proteins. Proc. Natl. Acad. Sci. USA 84:7493-7497[Abstract/Free Full Text].

CLAPHAM, D. E. and E. J. NEER, 1993  New roles for G-protein ß dimers in transmembrane signalling. Nature 365:403-406[Medline].

CLARKE, S., 1992  Protein isoprenylation and methylation at carboxyl-terminal cysteine residues. Annu. Rev. Biochem. 61:355-386[Medline].

HICKS, J. K., J.-H. YU, N. P. KELLER, and T. H. ADAMS, 1997  Aspergillus sporulation and mycotoxin production both require inactivation of the FadA G protein-dependent signaling pathway. EMBO J. 16:4916-4923[Medline].

KÄFER, E., 1977  Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19:33-131[Medline].

KUNKEL, T. A., 1985  Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492[Abstract/Free Full Text].

LEE, B.-N. and T. H. ADAMS, 1994a  Overexpression of bA, an early regulator of Aspergillus asexual sporulation, leads to activation of brlA and premature initiation of development. Mol. Microbiol. 14:323-334[Medline].

LEE, B.-N. and T. H. ADAMS, 1994b  The Aspergillus nidulans uG gene is required for production of an extracellular developmental signal and is related to prokaryotic glutamine synthetase I. Genes Dev. 8:641-651[Abstract/Free Full Text].

LEE, B.-N. and T. H. ADAMS, 1996  fluG and bA function interdependently to initiate conidiophore development in Aspergillus nidulans through brlAß activation. EMBO J. 15:299-309[Medline].

MILLER, B., K. MILLER, and W. E. TIMBERLAKE, 1985  Direct and indirect gene replacements in Aspergillus nidulans. Mol. Cell. Biol. 5:1714-1721[Abstract/Free Full Text].

MUNTZ, K. H., P. C. STERNWEIS, A. G. GILMAN, and S. M. MUMBY, 1992  Inuence of subunit prenylation on association of guanine nucleotide-binding regulatory proteins with membranes. Mol. Cell. Biol. 3:49-61.

NEER, E. J., 1995  Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80:249-257[Medline].

NOEL, J. P., H. E. HAMM, and P. B. SIGLER, 1993  The 2.2 Å crystal structure of transducin- complexed with GTPS. Nature 366:654-663[Medline].

PONTECORVO, G., J. A. ROPER, L. M. HEMMONS, K. D. MACDONALD, and A. W. J. BUFTON, 1953  The genetics of Aspergillus nidulans. Adv. Genet. 5:141-238[Medline].

PONTING, C. P. and P. BORK, 1996  Pleckstrin's repeat performance: a novel domain in G-protein signaling? Trends Biochem. Sci. 21:245-246[Medline].

SIMONDS, W. F., J. E. BUTRYNSKI, N. GAUTAM, C. G. UNSON, and A. M. SPIEGEL, 1991  G protein ß dimers: membrane targeting required subunit coexpression and intact C-A-A-X domain. J. Biol. Chem. 266:5363-5366[Abstract/Free Full Text].

SONDEK, J., A. BOHM, D. G. LAMBRIGHT, H. E. HAMM, and P. B. SIGLER, 1996  Crystal structure of a G_A protein ß dimer at 2.1 Å resolution. Nature 379:369-374[Medline].

SONG, J. and H. G. DOHLMAN, 1996  Partial constitutive activation of pheromone responses by a palmitoylation-site mutant of a G protein subunit in yeast. Biochemistry 35:14806-14817[Medline].

SONG, J., J. HIRSCHMAN, K. GUNN, and H. G. DOHLMAN, 1996  Regulation of membrane and subunit interactions by N-myristoylation of a G protein subunit in yeast. J. Biol. Chem. 271:20273-20283[Abstract/Free Full Text].

STEFAN, C. J. and K. J. BLUMER, 1994  The third cytoplasmic loop of a yeast G-protein-coupled receptor controls pathway activation, ligand discrimination, and receptor internalization. Mol. Cell. Biol. 14:3339-3349[Abstract/Free Full Text].

WATSON, N., M. E. LINDER, K. M. DRUEY, J. H. KEHRL, and K. J. BLUMER, 1996  RGS family members: GTPase-activating proteins for heterotrimeric G-protein subunits. Nature 383:172-175[Medline].

WIESER, J. and T. H. ADAMS, 1995  bD encodes a Myb-like DNA binding protein that regulates initiation of Aspergillus nidulans conidiophore development. Genes Dev. 9:491-502[Abstract/Free Full Text].

WIESER, J., B. N. LEE, J. W. FONDON, and T. H. ADAMS, 1994  Genetic requirements for initiating asexual development in Aspergillus nidulans. Curr. Genet. 27:62-69[Medline].

WIESER, J., J.-H. YU, and T. H. ADAMS, 1997  Dominant mutations affecting both sporulation and sterigmatocystin biosynthesis in Aspergillus nidulans. Curr. Genet. 32:218-224[Medline].

YELTON, M. M., J. E. HAMER, and W. E. TIMBERLAKE, 1984  Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 81:1470-1474[Abstract/Free Full Text].

YU, J.-H. and T. J. LEONARD, 1995  Sterigmatocystin biosynthesis in Aspergillus nidulans requires a novel type I polyketide synthase. J. Bacteriol. 177:4792-4800[Abstract/Free Full Text].

YU, J.-H., J. WIESER, and T. H. ADAMS, 1996  The Aspergillus FlbA RGS domain protein antagonizes G protein signaling to block proliferation and allow development. EMBO J. 15:5184-5190[Medline].

This article has been cited by other articles:

				J.-H. Yu, J.-H. Mah, and J.-A. Seo Growth and developmental control in the model and pathogenic aspergilli. Eukaryot. Cell, October 1, 2006; 5(10): 1577 - 1584. [Full Text] [PDF]

				J.-H. Mah and J.-H. Yu Upstream and Downstream Regulation of Asexual Development in Aspergillus fumigatus. Eukaryot. Cell, October 1, 2006; 5(10): 1585 - 1595. [Abstract] [Full Text] [PDF]

				J.-A. Seo, Y. Guan, and J.-H. Yu FluG-Dependent Asexual Development in Aspergillus nidulans Occurs via Derepression Genetics, March 1, 2006; 172(3): 1535 - 1544. [Abstract] [Full Text] [PDF]

				J.-A. Seo and J.-H. Yu The Phosducin-Like Protein PhnA Is Required for G{beta}{gamma}-Mediated Signaling for Vegetative Growth, Developmental Control, and Toxin Biosynthesis in Aspergillus nidulans Eukaryot. Cell, February 1, 2006; 5(2): 400 - 410. [Abstract] [Full Text] [PDF]

				J.-A. Seo, K.-H. Han, and J.-H. Yu Multiple Roles of a Heterotrimeric G-Protein {gamma}-Subunit in Governing Growth and Development of Aspergillus nidulans Genetics, September 1, 2005; 171(1): 81 - 89. [Abstract] [Full Text] [PDF]

				M. Ni, S. Rierson, J.-A. Seo, and J.-H. Yu The pkaB Gene Encoding the Secondary Protein Kinase A Catalytic Subunit Has a Synthetic Lethal Interaction with pkaA and Plays Overlapping and Opposite Roles in Aspergillus nidulans Eukaryot. Cell, August 1, 2005; 4(8): 1465 - 1476. [Abstract] [Full Text] [PDF]

				M.-H. Chang, K.-S. Chae, D.-M. Han, and K.-Y. Jahng The GanB G{alpha}-Protein Negatively Regulates Asexual Sporulation and Plays a Positive Role in Conidial Germination in Aspergillus nidulans Genetics, July 1, 2004; 167(3): 1305 - 1315. [Abstract] [Full Text] [PDF]

				P. K. Mukherjee, J. Latha, R. Hadar, and B. A. Horwitz Role of Two G-Protein Alpha Subunits, TgaA and TgaB, in the Antagonism of Plant Pathogens by Trichoderma virens Appl. Envir. Microbiol., January 1, 2004; 70(1): 542 - 549. [Abstract] [Full Text] [PDF]

				J.-A. Seo, Y. Guan, and J.-H. Yu Suppressor Mutations Bypass the Requirement of fluG for Asexual Sporulation and Sterigmatocystin Production in Aspergillus nidulans Genetics, November 1, 2003; 165(3): 1083 - 1093. [Abstract] [Full Text] [PDF]