- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sidorova, J.
- Articles by Breeden, L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sidorova, J.
- Articles by Breeden, L.
The MSN1 and NHP6A Genes Suppress SWI6 Defects in Saccharomyces cerevisiae
Julia Sidorovaa and Linda Breedenaa Fred Hutchinson Cancer Research Center, Seattle, Washington 98109
Corresponding author: Linda Breeden, Fred Hutchinson Cancer Research Center, A2-168, 1100 Fairview Ave. N., Seattle, WA 98109., lbreeden{at}fred.fhcrc.org (E-mail)
Communicating editor: M. CARLSON
| ABSTRACT |
|---|
Ankyrin (ANK) repeats were first found in the Swi6 transcription factor of Saccharomyces cerevisiae and since then were identified in many proteins of eukaryotes and prokaryotes. These repeats are thought to serve as protein association domains. In Swi6, ANK repeats affect DNA binding of both the Swi4/Swi6 and Mbp1/Swi6 complexes. We have previously described generation of random mutations within the ANK repeats of Swi6 that render the protein temperature sensitive in its ability to activate HO transcription. Two of these SWI6 mutants were used in a screen for high copy suppressors of this phenotype. We found that MSN1, which encodes a transcriptional activator, and NHP6A, which encodes an HMG-like protein, are able to suppress defective Swi6 function. Both of these gene products are involved in HO transcription, and Nhp6A may also be involved in CLN1 transcription. Moreover, because overexpression of NHP6A can suppress caffeine sensitivity of one of the SWI6 ANK mutants, swi6-405, other SWI6-dependent genes may also be affected by Nhp6A. We hypothesize that Nhp6A and Msn1 modulate Swi6-dependent gene transcription indirectly, through effects on chromatin structure or other transcription factors, because we have not been able to demonstrate that either Msn1 or Nhp6A interact with the Swi4/Swi6 complex.
THE Swi6 protein of Saccharomyces cerevisiae is involved in the regulation of dozens of genes that are transcribed at the G1/S transition of the cell cycle. These include the genes encoding the HO endonuclease, G1 cyclins (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Swi4, Mbp1, Swi6, and the S. pombe homologues Res1, Res2, and Cdc10 contain four ankyrin (ANK) repeats. These repeats are degenerate 33 amino acid motifs that are found in tandem in many different proteins in both eukaryotes and prokaryotes (![]()
![]()
![]()
![]()
![]()
![]()
We have generated numerous ANK repeat mutations in Swi6 that render a transcriptionally inactive protein (![]()
![]()
![]()
In this work we used two of the temperature-sensitive ANK alleles of SWI6 in a high copy suppressor screen to find proteins needed for the full activity of the Swi4/Swi6 complex. We report the results of this screen and the further analysis of two of these high copy suppressors, NHP6A and MSN1.
| MATERIALS AND METHODS |
|---|
Strains and plasmids:
The BY600 MATa swi6::TRP1 ade ho::lacZ ura3 his3 leu2-3,112 trp1-1 can1-100 met2 and BY606 MATa swi4::LEU2 ade ho::lacZ ura3 his3 leu2-3,112 trp1-1 can1-100 met2 strains are described in ![]()
200 ura3-52 lys2-801 ade2-101 msn1
1::TRP1 trp1 was kindly provided by M. Carlson (![]()
ura3-52 trp1-289 his3
1 leu2-3 gal2 gal10 nhp6a-
3::URA3 nhp6b-
3::HIS3 was kindly provided by M. Snyder (![]()
![]()
LEU2::swi6-405, BY1956 swi6
LEU2::swi6-406, and analogous strains bearing other ANK mutations were constructed by integrative transformation of BY600 strain (![]()
![]()
|
|
Growth conditions:
All rich (YEPD) and minimal (YC) media and growth conditions were as described previously (![]()
DNA, RNA, and protein analysis:
FACS analysis of yeast cells was done as described in (![]()
![]()
![]()
![]()
In vitro transcription and translation:
The plasmid pBD972 was used for in vitro translation of Swi4 (![]()
![]()
Gst fusion and purification from yeast or bacterial cells:
To construct GST fusions, MSN1 and NHP6A were generated by polymerase chain reaction (PCR) from pM-4 (pBD2050) and pN-5 (pBD2055), respectively, using M13 reverse primer and BL138 5'GGATCCATGGTCACCCCAAGAG3' primer for NHP6A, and M13 reverse and BL137 5'CCGGATCCATGGCAAGTAACC3' primers for MSN1. PCR fragments were cloned into pCRII (Invitrogen, Carlsbad, CA) generating pBD2056 and pBD2059, respectively. For construction of the GST-NHP6A fusion, the 2.3-kb BamHI fragment with the NHP6A open reading frame out of pBD2056 was cloned into BamHI-digested pBD1905, which bears GST under the control of GAL promoter in pRS316 vector, to give rise to pBD2057, or into BamHI-cut pGex2T (Pharmacia, Piscataway, NJ) to make pBD2064. The GAL-GST-NHP6A cassette was also recloned into a 2µ vector pBD2055 by insertion of the 2.9-kb EcoRV fragment of pBD2057, containing a portion of the URA3 gene and GAL-GST-NHP6A, into EcoRV-cut pBD2055; the resulting construct is called pBD2063.
For the GST-MSN1 fusions (pBD2061 and 2062), first the 1.5-kb SacI fragment from pBD2049 was substituted for the SacI fragment in pBD2058. Then the 1.4-kb BamHI fragment of the resulting pBD2060 containing MSN1 was cloned into BamHI-cut pBD1905, to give rise to pBD2061, or into BamHI-cut pGex2T (Pharmacia), to give rise to pBD2062.
To purify Gst fusions from E. coli, pBD2064 and pBD2062 were transformed into DH5
cells and the resulting strains were treated according to Pharmacia Biotech Gene Fusion System protocols. Bacterial cultures were grown to OD 0.6, and fusion protein expression was induced by 0.1 mM isopropyl thiogalactoside for 2 hr. Cells were then harvested, sonicated, centrifuged, and extracts were incubated with glutathione Sepharose 4B beads (Sigma, St. Louis) for 30 min at 4°. To determine if the Gst fusions were capable of interacting with Swi6, these glutathione beads with fusion proteins immobilized on them were incubated with recombinant Swi6 or in vitro-translated Swi4/Swi6 complex, washed, boiled, and loaded onto SDS PAGE.
To obtain Gst fusions from yeast, pBD2057, pBD2063, and pBD2061 were transformed into W303-1a strain. The resulting strains were grown in selective media with raffinose overnight and then expression of the fusions was induced by galactose for 34 hr. Cells were harvested, and protein extracts were prepared as described before (![]()
Thrombin cleavage of the Nhp6A from the Gst-Nhp6A fusion, bound to glutathione beads, was performed according to Pharmacia Biotech protocols. Glutathione beads were mixed with 38 µl of PBS and 2 µl of thrombin solution (1 unit/µl thrombin in PBS), incubated overnight at room temperature, and centrifuged. Supernatants were used directly for DNA-binding reactions.
Gel retardation:
Gel retardation analysis was performed exactly as described (![]()
![]()
![]()
| RESULTS |
|---|
Screen for high copy suppressors of temperature-sensitive ho::lacZ expression phenotype of swi6-405 and swi6-406 mutants:
We have previously carried out random mutagenesis of the ANK repeat-encoding region of the SWI6 gene (![]()
strains expressing Swi6-405 or Swi6-406 from the CEN plasmid pRS316 at 37°, but at 30 and 25°, they confer partial activity as judged by cell morphology and ho::lacZ transcript levels (data not shown and see below). In band shift assays, Swi4/Swi6-405 complex is less active in binding to SCB elements than the wild-type complex, and Swi4/Swi6-406 complex has an altered mobility (![]()
|
|
The mutated SWI6 genes were integrated at the LEU2 locus of the swi6
ho::lacZ strain, giving rise to strains BY1954 (swi6-405) and BY1956 (swi6-406). These strains were transformed with a 2µ-based yeast genomic library (![]()
![]()
ho:lacZ strain to determine if candidate suppressors were able to bypass the Swi6 function.
We recovered a total of 8 suppressor plasmids from swi6-406 and 19 from swi6-405 transformants. Using restriction digestion and PCR, we identified four different suppressors for swi6-406 and six for swi6-405. These are listed in Table 1. The SWI6 gene was isolated five times in the screen with swi6-406 and three times with swi6-405. Two suppressors (c2a and c6) were not pursued further because they activated ho::lacZ expression equally strongly in swi6-405 and swi6
cells and thus were completely independent of Swi6. Most of the suppressors (c2, c4, c5, c9, c12, c19, and c23) suppressed the ho::lacZ expression defect to some extent in the absence of Swi6, but only one (c19) could suppress in the absence of Swi4. This requirement for Swi4 suggests that the majority of suppressors enhance Swi4-mediated activation, rather than cause a general derepression of transcription. c15 showed no suppression of the ho::lacZ transcription defect in swi4 or swi6 deletion strains and thus was the best candidate for an allele-specific suppressor.
Sequence information was obtained for all the Swi4- and Swi6-dependent suppressors. c4, c5, c9, and c12 carry overlapping fragments from chromosome XV, and c23 has a nonoverlapping fragment from the same chromosome. c15 carries a fragment from chromosome XVI. Finally, c2 has a fragment from chromosome XIII. In each case more than one open reading frame was present on the insert. In this article we describe identification and further analysis of the genes responsible for suppression by c15 and c4.
We have subcloned fragments of c4 and c15 into pRS426 and transformed the resulting constructs into swi6-406 or swi6-405 to determine which of the open reading frames encode suppressors. The results of mapping and subcloning are summarized in Figure 1. Previously identified genes, MSN1 and NHP6A, were responsible for the suppression phenotypes of c4 and c15, respectively. MSN1 was originally cloned as a high copy suppressor of a temperature-sensitive SNF1 kinase mutant for its ability to restore SUC2 expression (![]()
![]()
![]()
![]()
MSN1 and NHP6A suppress the HO transcription defect of SWI6 ANK mutants:
Since NHP6A (c15) was incapable of bypassing Swi6 function, we sought to determine if NHP6A suppression was specific to the swi6-405 allele of SWI6. The NHP6A gene on pRS426 was transformed into strains with different mutant alleles of SWI6, and X-gal filter assays were performed. All these mutants express Swi6 at nonpermissive temperature (37°; ![]()
21 encodes a nonconditional and highly defective Swi6 protein (![]()
21, which carries a deletion of the putative leucine zipper in SWI6. Thus, NHP6A displays allele-specific suppression. It enhances transcription by some temperature-labile Swi6 proteins and has no detectable suppressing activity with others. This could indicate a direct interaction between Nhp6A and Swi6, which is disrupted by only a subset of the Swi6 mutants. However, because Nhp6A suppresses all but the most defective alleles of SWI6, this could also be explained if there is a threshold for detection of suppression and some mutants fall below this threshold.
ß-Galactosidase assays show that suppression by the 2µ plasmid-borne NHP6A or MSN1 of the ho::lacZ expression defect in swi6-405 or swi6-406 cells at 37° is low but well above background. For example, ß-galactosidase activities for swi6-406 transformed with MSN1 (pM-2) or NHP6A (pN-5) are 22 and 15 units, respectively, compared to 5 units for the vector-transformed control. To see if this increased expression occurred at the transcription level, we analyzed levels of ho::lacZ mRNA in these strains by S1 protection. Both at 25 and 30°, the ho::lacZ mRNA level was noticeably higher in the swi6-405 and swi6-406 strains transformed with high copy NHP6A and MSN1 plasmids, respectively, as compared to the same strains carrying the vector alone (Figure 2B and Figure C). At 37°, ho::lacZ mRNA level in these strains was too low to be reproducibly quantitated by S1 protection even in the presence of suppressors (data not shown). A similar result was obtained when MSN1 plasmid was transformed into swi6-405 (Figure 2D). These data show that both MSN1 and NHP6A exert their function at the mRNA level, rather than by affecting ß-galactosidase stability or activity.
Nhp6A has a close homologue, Nhp6B, which has a set of properties indistinguishable from Nhp6A. The two proteins may have overlapping functions, because only deletion of both genes has a discernible phenotype (![]()
Swi6-405 and Swi6-406 are maintained at lower levels than the wild-type protein, so one indirect mechanism of suppression by NHP6A and NHP6B could be that of increasing expression of swi6-405, swi6-406, or the SWI4 gene. To test this possibility, we looked at SWI4 transcription in the swi6-405 strains with or without the elevated level of Nhp6A and found no difference in SWI4 mRNA levels (data not shown). We were not able to test if the Swi4 protein levels were affected, because available antibodies do not detect endogenous levels of this protein. However, because Nhp6A and Nhp6B are generally considered to be involved in DNA metabolism rather than in protein stability, the fact that SWI4 transcript levels are not affected by Nhp6A overproduction makes it likely that the protein levels are also unaltered. We also measured the levels of Swi6-405 protein at 37° in cells transformed with vector alone or with NHP6A- or NHP6B-expressing plasmids and found that the mutant Swi6 accumulated to the same level in all strains tested (Figure 2A). Thus, the suppression by Nhp6A or Nhp6B proteins cannot be attributed to the increase in SWI4 or SWI6 expression.
MSN1 and NHP6A are involved in HO transcription:
To determine if MSN1 and NHP6A are normally involved in the transcription of the Swi4/Swi6-regulated promoters, we isolated mRNA from exponentially growing cultures of strains with or without MSN1 or NHP6A and NHP6B gene products and compared the levels of HO and CLN1 transcripts in these strains to the wild-type strain by S1 protection (Figure 3). The msn1
strain expresses about three- to fivefold less HO transcript and the nhp6ab
strain shows a twofold drop in HO transcript compared to wild type. Interestingly, there is little or no effect of msn1
on another Swi4/Swi6-regulated promoter, CLN1 (data not shown), but the nhp6ab
has a similar twofold effect on CLN1 (Figure 3B and Figure C).
|
NHP6A and NHP6B genes can suppress the caffeine sensitivity of the swi6-405 allele:
The NHP6A gene has been implicated as a downstream target of the Slt2/Mpk1 MAP kinase pathway that leads from Pkc1 and is involved in growth control and cell morphogenesis (![]()
mutants are also sensitive to caffeine (![]()
|
Nhp6A probably affects Swi4/Swi6 DNA binding indirectly:
To see whether there is a direct interaction between Nhp6A and Swi6, we immunoprecipitated Swi4 or Swi6 proteins out of wild-type extracts carrying HA-Nhp6A and then immunoblotted with anti-HA antibodies to detect HA-Nhp6A. Despite the fact that this HA-tagged Nhp6A is functional and can suppress the swi6-405 transcription defect (Figure 2B), there was no indication that HA-Nhp6A coprecipitates either with Swi4 or Swi6 under the same conditions that we use to detect Swi4/Swi6 association (![]()
We then prepared fusions of Nhp6A and Msn1 proteins with Gst. The GST-NHP6A and GST-MSN1 fusions were put under the control of GAL1-10 promoter and expressed in a wild-type strain. When plated under conditions which select for the plasmid and cause overexpression of the fusion, neither one of these strains was able to form colonies (Figure 4B), indicating that overexpression of either Msn1 or Nhp6A as Gst fusions is lethal. Liquid cultures of the same strains were grown in raffinose and then incubated with galactose for up to 8 hr. FACS profiles of these cultures did not show accumulation of cells in any single compartment of the cell cycle; thus overproduction of Gst-Msn1 or Gst-Nhp6A did not lead to a specific cell cycle arrest (data not shown).
Because of their toxicity, we purified these Gst fusions from cells grown in raffinose and then induced by galactose addition for only 34 hr. Though we could purify the fusion proteins from these cells under low-stringency conditions, there was no detectable Swi6 copurifying with either of them, as we judged by probing the fusion protein isolates with Swi6 antibodies on Western blots. We also purified these Gst fusion proteins from E. coli on glutathione beads and then incubated the fusion-bound beads with recombinant Swi6 (![]()
![]()
Nhp6A may not directly associate with Swi6, yet it could facilitate the binding of the Swi4/Swi6 complex to SCBs by inducing a favorable bend in DNA. Thus, we tested the involvement of Nhp6A in the Swi6 complex formation on DNA. Band shift analysis was carried out with Swi4/Swi6 complexes obtained by in vitro translation of Swi4 in the presence of recombinant Swi6. These complexes appeared to be identical to the complex observed in whole cell extracts, in that they migrated with the same mobility, contained both Swi4 and Swi6 proteins, as judged by their supershifting by Swi4 and Swi6 antibodies, and were specific to SCB elements of the HO promoter fragment (Figure 5A and data not shown). The purified Gst-Nhp6A fusion was first tested in gel retardation assays with the HO promoter fragment. The Gst-Nhp6A fusion, but not Gst alone, was able to nonspecifically bind DNA (Figure 5B, lane 8). We also cleaved the Gst moiety off the Gst-Nhp6A fusion with thrombin and tested the released Nhp6A in gel retardation assays. As anticipated, thrombin cleavage of Gst-Nhp6A released a DNA-binding component that forms a much smaller complex on DNA (Figure 5B, lane 15). However, both Gst-Nhp6A and Nhp6A were able to bind DNA and both could form a series of bandshifts indicating that multiple Nhp6A molecules bound simultaneously to one DNA molecule. Next, the in vitro-translated Swi4/Swi6 complex was mixed together with varying amounts of Gst-Nhp6A or Nhp6A and was added to the HO promoter fragment (Figure 5B, lanes 57 and 1214). These reactions were compared to the ones in which Swi4/Swi6 complex was mixed with Gst only (lanes 13), thrombin cleavage mixture only (lanes 911), and Gst-Nhp6A or Nhp6A mixed with the rabbit reticulocyte lysate (lanes 8 and 15). The amount of the DNA-bound Swi4/Swi6 complex was unaffected by the addition of Gst-Nhp6A (compare lanes 13 with 57) and slightly reduced upon the addition of Nhp6A (compare lanes 911 and 1214). These results indicate that there is no cooperation between Nhp6A and Swi4/Swi6 in binding to DNA under the conditions of this assay. It is also worth noting that there appeared to be a negative effect on the amount of DNA-bound Gst-Nhp6A and Nhp6A if the Swi4/Swi6 complex was present in the reaction (compare lanes 7 to 8 and 14 to 15). Because the HO DNA was in excess in the reaction, and the Swi4/Swi6 complex was at subsaturating level, this cannot be attributed simply to competition for binding sites.
|
| DISCUSSION |
|---|
In this article we describe a screen for genes that are able to suppress ANK defects of Swi6 when expressed at high copy levels. Two of these genes, MSN1 and NHP6A, were further characterized. Both NHP6A and MSN1 are weak suppressors of swi6 ANK mutant alleles. Both of the gene products are required for maximal expression of HO, as mutations in these genes lead to a two- and threefold drop in HO mRNA levels, respectively. However, neither protein appears to directly associate with Swi6.
MSN1 (also named FUP1, PHD2, MSS10) has been isolated multiple times as a gene which, when overproduced, improves iron uptake (![]()
![]()
![]()
![]()
![]()
![]()
Interestingly, PHD1, a gene coding for a protein with homology to Swi4, was isolated in the same screen for enhancers of pseudohyphal growth in which MSN1 was identified (as PHD2) (![]()
A different picture emerges in the case of NHP6A (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Massive overproduction of Nhp6A is deleterious to the cell (![]()
![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank members of the lab for support and helpful discussions. Special thanks are due to Glen Mikesell for technical assistance, and to Marian Carlson, Michael Snyder, and David Kolodrubetz for providing strains and plasmids, as well as advice and encouragement. This work was supported by grants GM-41073 from the National Institute of General Medical Sciences and DAMND17-94-J-4122 from the Army Breast Cancer Initiative. J.S. was supported by a fellowship from the Leukemia Research Foundation.
Manuscript received June 22, 1998; Accepted for publication September 23, 1998.
| LITERATURE CITED |
|---|
ANDREWS, B. J. and I. HERSKOWITZ, 1989 The yeast SWI4 protein contains a motif present in developmental regulators and is part of a complex involved in cell-cycle-dependent transcription. Nature 342:830-833[Medline].
ANDREWS, B. J. and L. MOORE, 1992a Mutational analysis of a DNA sequence involved in linking gene expression to the cell cycle. Biochem Cell Biol. 70:1073-1080[Medline].
ANDREWS, B. J. and L. A. MOORE, 1992b Interaction of the yeast Swi4 and Swi6 cell cycle regulatory proteins in vitro.. Proc. Natl. Acad. Sci. USA 89:11852-11856
BORK, P., 1993 Hundreds of ankyrin-like repeats in functionally diverse proteins: mobile modules that cross phyla horizontally. Proteins Struct. Funct. Genet. 17:363-374[Medline].
BREEDEN, L., 1996 Start-specific transcription in yeast, pp. 95127 in Current Topics in Microbiology and Immunology, Vol. 208, edited by P. J. FARNHAM. Springer-Verlag, Berlin.
BREEDEN, L. and G. MIKESELL, 1991 Cell cycle-specific expression of the SWI4 transcription factor is required for the cell cycle regulation of HO transcription. Genes Dev. 5:1183-1190
BREEDEN, L. and K. NASMYTH, 1985 Regulation of the yeast HO gene. Cold Spring Harbor Symp. Quant. Biol. 50:643-650
BUTLER, A. P., J. K. MARDIAN, and D. E. OLINS, 1985 Nonhistone chromosomal protein HMG 1 interactions with DNA. Fluorescence and thermal denaturation studies. J. Biol. Chem. 260:10613-10620
CARLSON, M. and G. BOTSTEIN, 1982 Two differentially regulated mRNAs with different 5' ends encode secreted with intracellular forms of yeast invertase. Cell 28:145-154[Medline].
COSTIGAN, C., D. KOLODRUBETZ, and M. SNYDER, 1994 NHP6A and NHP6B, which encode HMG1-like proteins, are candidates for downstream components of the yeast SLT2 mitogen-activated protein kinase pathway. Mol. Cell. Biol. 14:2391-2403
DIRICK, L., T. MOLL, H. AUER, and K. NASMYTH, 1992 A central role for SWI6 in modulating cell cycle Start-specific transcription in yeast. Nature 357:508-513[Medline].
EIDE, D. and L. GUARENTE, 1992 Increased dosage of a transcriptional activator gene enhances iron-limited growth of Saccharomyces cerevisiae. J. Gen. Microbiol. 138:347-354[Medline].
ESPINET, C., M. A. D. L. TOORE, M. ALDEA, and E. HERRERO, 1995 An efficient method to isolate yeast genes causing overexpression-mediated growth arrest. Yeast 11:25-32[Medline].
ESTRUCH, F. and M. CARLSON, 1990 Increased dosage of the MSN1 gene restores invertase expression in yeast mutants defective in the SNF1 protein kinase. Nucleic Acids Res. 18:6959-6964
EWASKOW, S. P., J. M. SIDOROVA, J. HENDLE, J. C. EMERY, and D. E. LYCAN et al., 1998 Mutation and modeling analysis of the Saccharomyces cerevisiae Swi6 ankyrin repeats. Biochemistry 37:4437-4450[Medline].
GE, H. and R. G. ROEDER, 1994 The high mobility group protein HMG1 can reversibly inhibit class II gene transcription by interaction with the TATA-binding protein. J. Biol. Chem. 269:17136-17140
GIMENO, C. J. and G. R. FINK, 1994 Induction of pseudohyphal growth by overexpression of PHD1, a Saccharomyces cerevisiae gene related to transcriptional regulators of fungal development. Mol. Cell. Biol. 14:2100-2112
HEICHMAN, K. A. and J. M. ROBERTS, 1996 The Yeast CDC16 and CDC27 genes restrict DNA replication to once per cell cycle. Cell 85:39-48[Medline].
HENKEL, T., U. ZEBEL, K. VAN ZEE, J. M. MULLER, and E. FANNING et al., 1992 Intramolecular masking of the nuclear location signal and dimerization domain in the precursor for the p50 NF kappa B subunit. Cell 68:1121-1133[Medline].
IGUAL, J. C., A. L. JOHNSON, and L. H. JOHNSTON, 1996 Coordinated regulation of gene expression by the cell cycle transcription factor SWI4 and the protein kinase C MAP kinase pathway for yeast cell integrity. EMBO J. 15:5001-5013[Medline].
KOCH, C., T. MOLL, M. NEUBERG, H. AHORN, and K. NASMYTH, 1993 A role for the transcription factors Mbp1 and Swi4 in progression from G1 to S phase. Science 261:1551-1557
KOLODRUBETZ, D. and A. BURGUM, 1990 Duplicated NHP6 genes of Saccharomyces cerevisiae encode proteins homologous to bovine high mobility group protein 1. J. Biol. Chem. 265:3234-3239
LAMBERT, S. and V. BENNETT, 1993 From anemia to cerebellar dysfunction. A review of the ankyrin gene family. Eur. J. Biochem. 211:1-6[Medline].
LAMBRECHTS, M. G., F. F. BAUER, J. MARMUR, and I. S. PRETORIUS, 1996a Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast. Proc. Natl. Acad. Sci. USA 93:8419-8424
LAMBRECHTS, M. G., P. SOLLITTI, J. MARMUR, and I. S. PRETORIUS, 1996b A multicopy suppressor gene, MSS10, restores STA2 expression in Saccharomyces cerevisiae strains containing the STA10 repressor gene. Curr. Genet. 29:523-529[Medline].
LOWNDES, N. F., A. L. JOHNSON, and L. H. JOHNSTON, 1991 Coordination of expression of DNA synthesis genes in budding yeast by a cell cycle regulated trans factor. Nature 350:247-248[Medline].
LOWNDES, N. F., A. L. JOHNSON, L. BREEDEN, and L. H. JOHNSTON, 1992 SWI6 protein is required for transcription of the periodically expressed DNA synthesis genes in budding yeast. Nature 357:505-508[Medline].
MADDEN, K., Y. J. SHEU, K. BAETZ, B. ANDREWS, and M. SNYDER, 1997 SBF cell cycle regulator as a target of the yeast PKC-MAP kinase pathway. Science 275:1781-1784
MCINTOSH, E. M., R. W. ORD, and R. K. STORMS, 1988 Transcriptional regulation of the cell cycle-dependent thymidylate synthase gene of Saccharomyces cerevisiae.. Mol. Cell. Biol. 8:4616-4624
MCINTOSH, E. M., T. ATKINSON, R. K. STORMS, and M. SMITH, 1991 Characterization of a short, cis-acting DNA sequence which conveys cell cycle stage-dependent transcription in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:329-337
MEASDAY, V., L. MOORE, J. OGAS, M. TYERS, and B. ANDREWS, 1994 The PCL2 (ORFD)-PHO85 cyclin-dependent kinase complex: a cell cycle regulator in yeast. Science 266:1391-1395
NASMYTH, K. and L. DIRICK, 1991 The role of SWI4 and SWI6 in the activity of G1 cyclins in yeast. Cell 66:995-1013[Medline].
OGAS, J., B. J. ANDREWS, and I. HERSKOWITZ, 1991 Transcriptional activation of CLN1, CLN2, and a putative new G1 cyclin (HCS26) by SWI4, a positive regulator of G1-specific transcription. Cell 66:1015-1026[Medline].
PARTRIDGE, J. F., G. E. MIKESELL, and L. L. BREEDEN, 1997 Cell cycle-dependent transcription of CLN1 involves Swi4 binding to MCB-like elements. J. Biol. Chem. 272:9071-9077
PAULL, T. T. and R. C. JOHNSON, 1995 DNA looping by Saccharomyces cerevisiae high mobility group proteins NHP6A/B. Consequences for nucleoprotein complex assembly and chromatin condensation. J. Biol. Chem. 270:8744-8754
PAULL, T. T., M. CAREY, and R. C. JOHNSON, 1996 Yeast HMG proteins NHP6A/B potentiate promoter-specific transcriptional activation in vivo and assembly of preinitation complexes in vitro.. Genes Dev. 10:2769-2781
PRIMIG, M., S. SOCKANATHAN, H. AUER, and K. NASMYTH, 1992 Anatomy of a transcription factor important for the Start of the cell cycle in Saccharomyces cerevisiae.. Nature 358:593-597[Medline].
RAMER, S. W., S. J. ELLEDGE, and R. W. DAVIS, 1992 Dominant genetics using a yeast genomic library under the control of a strong inducible promoter. Proc. Natl. Acad. Sci. USA 89:11589-11593
SCHNEIDER, K. R., R. L. SMITH, and E. K. O'SHEA, 1994 Phosphate-regulated inactivation of the kinase PH080-PH085 by the CDK inhibitor PH081. Science 266:122-126
SHYKIND, B. M., J. KIM, and P. A. SHARP, 1995 Activation of the TFIID-TFIIA complex with HMG-2. Genes Dev. 9:1354-1365
SIDOROVA, J. and L. BREEDEN, 1993 Analysis of the SWI4/SWI6 protein complex, which directs G1/S-specific transcription in Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:1069-1077
SIDOROVA, J., G. MIKESELL, and L. BREEDEN, 1995 Cell cycle regulated phosphorylation of Swi6 controls its nuclear localization. Mol. Biol. Cell 6:1641-1658[Abstract].
SINGH, J. and G. H. DIXON, 1990 High mobility group proteins 1 and 2 function as general class II transcription factors. Biochemistry 29:6295-6302[Medline].
STELZER, G., A. GOPPELT, F. LOTTSPEICH, and M. MEISTERERNST, 1994 Repression of basal transcription by HMG2 is counteracted by TFIIH-associated factors in an ATP-dependent process. Mol. Cell. Biol. 17:4712-4721.
THOMPSON, C. C., T. A. BROWN, and S. L. MCKNIGHT, 1991 Convergence of Ets- and Notch-related structural motifs in a heteromeric DNA binding complex. Science 253:762-768
TREMETNICK, D. J. and P. L. MOLLOY, 1988 Effects of high mobility group proteins 1 and 2 on initiation and elongation of specific transcription by RNA polymerase II in vitro.. Nucleic Acids Res. 16:11107-11127
This article has been cited by other articles:
![]() |
R. R. Barrales, J. Jimenez, and J. I. Ibeas Identification of Novel Activation Mechanisms for FLO11 Regulation in Saccharomyces cerevisiae Genetics, January 1, 2008; 178(1): 145 - 156. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Flick and C. Wittenberg Multiple Pathways for Suppression of Mutants Affecting G1-Specific Transcription in Saccharomyces cerevisiae Genetics, January 1, 2005; 169(1): 37 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. van Dyk, I. S. Pretorius, and F. F. Bauer Mss11p Is a Central Element of the Regulatory Network That Controls FLO11 Expression and Invasive Growth in Saccharomyces cerevisiae Genetics, January 1, 2005; 169(1): 91 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Brewster, G. C. Johnston, and R. A. Singer A Bipartite Yeast SSRP1 Analog Comprised of Pob3 and Nhp6 Proteins Modulates Transcription Mol. Cell. Biol., May 15, 2001; 21(10): 3491 - 3502. [Abstract] [Full Text] |
||||
![]() |
Y. Yu, P. Eriksson, and D. J. Stillman Architectural Transcription Factors and the SAGA Complex Function in Parallel Pathways To Activate Transcription Mol. Cell. Biol., April 1, 2000; 20(7): 2350 - 2357. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sidorova, J.
- Articles by Breeden, L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sidorova, J.
- Articles by Breeden, L.






