The Levels of the RoRNP-Associated Y RNA Are Dependent Upon the Presence of ROP-1, the Caenorhabditis elegans Ro60 Protein

Corresponding author: Luis A. Rokeach, Département de Biochimie, Université de Montréal, C.P. 6128, Succursale Centre-ville, Montréal, Québec H3C 3J7, Canada., luis.rokeach{at}umontreal.ca (E-mail)

Communicating editor: R. K. HERMAN

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The Ro ribonucleoproteins (RoRNP) consist of at least one major protein of 60 kD, Ro60, and one small associated RNA, designated Y RNA. Although RoRNP have been found in all vertebrate species examined so far, their function remains unknown. The Caenorhabditis elegans rop-1 gene previously has been identified as encoding a Ro60 homologue. We report here the phenotypic characterization of a C. elegans strain in which rop-1 has been disrupted. This is the first report regarding the inactivation of a major RoRNP constituent in any organism. The rop-1 mutant worms display no visible defects. However, at the molecular level, the disruption of rop-1 results in a dramatic decrease in the levels of the ROP-1-associated RNA (CeY RNA). Moreover, transgenic expression of wild-type rop-1 partially rescues the levels of CeY RNA. Considering that transgenes are poorly expressed in the germline, the fact that the rescue is only partial is most likely related to the high abundance of the CeY RNA in the adult germline and in embryos. The developmental expression pattern and localization of CeY RNA suggest a role for this molecule during embryogenesis. We conclude that, under laboratory culture conditions, ROP-1 does not play a crucial role in C. elegans.

THE Ro ribonucleoproteins (RoRNP) have been initially identified as the primary target of autoantibodies in patients with autoimmune diseases such as systemic lupus erythematosus and Sjögren's syndrome (reviewed in TAN 1993 ; YOUINOU et al. 1994 ). Their components have been detected in all cells studied so far, in various organisms such as mammals (WOLIN and STEITZ 1983 ; DEUTSCHER et al. 1988 ; WANG et al. 1996 ), reptiles (FARRIS et al. 1995 ), frogs (O'BRIEN et al. 1993 ), and nematodes (LABBE et al. 1995 ; VAN HORN et al. 1995 ). In spite of their intense immunological and biochemical characterization in the past years, the exact molecular composition of RoRNP is controversial and their cellular function remains elusive.

RoRNP consists of at least one protein of ~60 kD, Ro60, which associates with one small RNA polymerase III transcript, designated Y RNA (reviewed in VAN VENROOIJ et al. 1993 ). In most vertebrate cells, there are four different Y RNA molecules, with lengths ranging from 69 to 112 nucleotides (O'BRIEN et al. 1993 ; PRUIJN et al. 1993 ; FARRIS et al. 1995 ). These RNAs all fold into a conserved stem-loop structure, whose stem is formed by the 5' and 3' ends of the RNA except for a short single-stranded polyuridine tail at the 3' end (WOLIN and STEITZ 1984 ; O'BRIEN et al. 1993 ; PRUIJN et al. 1993 ; VAN GELDER et al. 1994 ). The Ro60 protein binds directly to the stem of the Y RNA and requires the presence of a highly conserved bulging C residue in this structure (WOLIN and STEITZ 1984 ; PRUIJN et al. 1991 ; O'BRIEN et al. 1993 ; GREEN et al. 1998 ). The La protein is also associated with Y RNAs in a subpopulation (30%) of the RoRNP (BOIRE and CRAFT 1989 ; MAMULA et al. 1989 ; BOIRE et al. 1995 ). La has been implicated in RNA polymerase III transcription initiation and termination (GOTTLIEB and STEITZ 1989A , GOTTLIEB and STEITZ 1989B ; MARAIA 1996 ; FAN et al. 1997 ; LINMARQ and CLARKSON 1998 ), viral internal translation initiation (BELSHAM et al. 1995 ; ALI and SIDDIQUI 1997 ), double-stranded RNA unwinding (HUHN et al. 1997 ), and tRNA maturation (VAN HORN et al. 1997 ; YOO and WOLIN 1997 ; FAN et al. 1998 ). La has been shown to bind to the polyuridine stretch located at the 3' of the Y RNAs, as well as to a secondary site (STEFANO 1984 ; PRUIJN et al. 1991 ; SLOBBE et al. 1992 ). The proposed association of a third protein of 52 kD to the human RoRNP (Ro52) is still controversial (CHAN et al. 1991 ; ITOH et al. 1991 ; KELEKAR et al. 1994 ; BOIRE et al. 1995 ; TSENG et al. 1997 ).

Previous studies in Xenopus oocytes have demonstrated that Ro60 binds misfolded 5S rRNA molecules (O'BRIEN and WOLIN 1994 ; SHI et al. 1996 ). These Ro60-bound 5S rRNAs all possess an ~10-nucleotide extension at their 3' end, resulting from the failure of RNA polymerase III to terminate transcription at the proper nucleotide. Binding of Ro60 to 5S rRNA was shown to require the formation of an alternative stem-like structure in the 5S rRNA molecule (SHI et al. 1996 ). Ro60 has thus been proposed to lead these mutant 5S rRNAs to degradation, suggesting a role in 5S rRNA biogenesis for the RoRNP. This putative role has been recently re-inforced by electron microscopy observations showing that RoRNP components are present in nucleoli and ribosome-rich cytoplasmic areas (FARRIS et al. 1997 ).

We and others have previously reported the identification of a Ro60 homologue in the nematode Caenorhabditis elegans (LABBE et al. 1995 ; VAN HORN et al. 1995 ). This protein, designated ROP-1, binds to a single Y RNA (CeY RNA) of 105 nucleotides, which is predicted to fold in the same manner as its mammalian and frog counterparts, but that lacks a polyuridine tail that would permit the binding of the protein La (VAN HORN et al. 1995 ). We wished to take advantage of the powerful genetics of C. elegans to investigate the biological function of ROP-1. To that effect, we studied a worm strain in which the gene encoding ROP-1, rop-1, has been inactivated by the insertion of the Tc1 transposon. We report here the phenotypic and molecular characterization of this C. elegans rop-1::Tc1 mutant strain.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

General methods and strains:
C. elegans strains were cultured as described by BRENNER 1974 . All animals were grown at 20° unless otherwise stated. The wild-type strain used was the Bristol N2 strain. The strain NL733 rop-1(pk93) was received from Ronald Plasterk of The Netherlands Cancer Institute, and was generated by PCR-screening a randomly inserted Tc1 transposon frozen nematode library (ZWAAL et al. 1993 ). The strain MQ470 rop-1(pk93) was generated by backcrossing NL733 hermaphrodites 10 times with MQ259 unc-42(e270) males to eliminate the mutator activity as well as other Tc1 insertions present in the original strain.

Generation of transgenic nematodes:
Animals were transformed using two previously described methods. In the first one, plasmid pCeRo4146, containing the wild-type rop-1 gene, was coinjected with the transformation marker pRF4 [containing a dominant mutation in the collagen gene rol-6(su1006)] in rop-1(pk93) animals, both at a concentration of 50 µg/ml (MELLO and FIRE 1995 ). The extrachromosomal array of one of the three resulting strains, rop-1(pk93); qmEx156, was integrated in the genome using the -ray-induced integration technique (MELLO and FIRE 1995 ). Alternatively, to increase the transgenic expression level of rop-1, pCeRo4146 was also coinjected with both pRF4 and wild-type genomic DNA prepared as previously described (KELLY et al. 1997 ). This technique generates more complex arrays that should allow better expression of a given transgene. All the strains were assayed for the rescue of CeY RNA expression.

For lacZ expression, the rop-1 promoter was cloned in vector pPD22.11 so that it would drive the expression of a nuclear localization signal (NLS)-containing ß-galactosidase gene product, with the 3' UTR of unc-54 (FIRE et al. 1990 ). The resulting plasmid pCeRo4107 was coinjected with pRF4, at respective concentrations of 100 µg/ml and 50 µg/ml. The extrachromosomal array of one of the seven resulting strains was integrated in the genome using the -ray-induced integration method (MELLO and FIRE 1995 ). All the strains were stained with X-Gal as described previously (FIRE 1992 ), and the expression pattern of rop-1::lacZ was thus visualized.

RNA procedures:
Staged and mixed-staged worms were grown and collected as described previously (LEWIS and FLEMING 1995 ). Total RNA was extracted by treating the worm pellets with TRIsol reagent (BRL) according to the manufacturer's instructions. Reverse transcription-PCR (RT-PCR) analysis was done as previously described (EWBANK et al. 1997 ). For Northern blot analysis, 5 µg of total RNA were resolved on a 1.5% formaldehyde-agarose gel electrophoresis in 1x 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (200 mM MOPS; 50 mM Na acetate; 10 mM EDTA). Following migration, the gel was rinsed twice for 20 min in 20x SSC (3 M NaCl; 0.3 M Na citrate) and the RNA was transferred overnight by capillarity with 20x SSC onto Nytran filters (Schleicher & Schuell, Keene, NH). DNA probes were labeled by the random priming method using the Prime-it II kit (Stratagene, La Jolla, CA). The membrane was then UV irradiated (UV Crosslinker, FisherBiotech) and prehybridized in RNA hybridization solution (100 mM NaCl; 50 mM PIPES, pH 6.8; 50 mM phosphate buffer, pH 7.0; 1 mM EDTA; 5% SDS) at 60° for 1 hr. Hybridization was performed in the same buffer at 60° for 12–16 hr. Following hybridization, the membrane was washed twice for 15 min in 2x SSC; 0.1% SDS at 60°. The membrane was subsequently exposed wet to autoradiography on Kodak Bio-Max film.

For ribosomal RNA extraction, worm pellets were ground in liquid nitrogen and resuspended in NET-2 buffer (40 mM Tris-HCl, pH 7.4; 150 mM NaCl; 0.05% NP-40). The extracts were spun at 5,000 rpm for 15 min at 4° in order to eliminate the collagen cuticles. The supernatants were then ultracentrifuged at 35,000 rpm for 2 hr at 4° in a Beckman (Fullerton, CA) SW50.1 rotor. The resulting pellets were resuspended in 100 µl of RNAse-free water and subjected to two rounds of phenol/chloroform extractions, followed by a precipitation with Na acetate. RNA was collected by centrifugation for 15 min at 4°.

For individual 5S rRNA cloning, 2.5 µg of total or ribosomal RNA were precipitated and resuspended in 10 µl of poly(A) polymerase buffer [50 mM Tris-HCl, pH 7.9; 250 mM NaCl; 10 mM MgCl₂; 2.5 mM MnCl₂; 250 µM ATP; 20 units of RNAsin RNAse inhibitor (Stratagene); 0.5 µg/ml of bovine serum albumin]. One unit of poly(A) polymerase (BRL) was then added to the mixture. The reaction was incubated 15 min at 37° to allow polymerization, followed by 15 min at 65° to inactivate the polymerase. RT was performed on 2 µl of polyadenylated RNA sample in a total reaction volume of 25 µl, using primer XBpoly(T). PCR was then performed on 5 µl of RT product using primers XBpoly(T) and S1CE5S. Vent polymerase (New England Biolabs, Beverly, MA) was used to minimize the misincorporation events. The PCR products were ligated in the pBlueScript vector (Stratagene) and sequenced individually by the dideoxy chain termination technique using a T7 sequencing methodology (Pharmacia, Piscataway, NJ). To rule out the possibility of selecting for a particular mutation, the whole procedure was repeated three times for each cellular 5S rRNA pool.

Immunoblotting:
Western blots were carried out as previously described (ROKEACH et al. 1991 ) and bound antibodies were detected using the Dupont (Wilmington, DE) Renaissance detection system, according to the manufacturer's instructions.

PCR reaction primers:
The following primers were used in PCR and RT-PCR reactions: SL1, TTTAATTACCCAAGTTTGAG;SL2, TTTTAACCCAGTTACTCAAG; XBpoly(T), CGCTCTAGAGGATCC(T)₁₅; S1CE5S, AATGTCGACGCTTACGACCATATCACG; CL1, GAACCAATCATGGCTGATGAGTTG; CL2, CTCGTCAAATGGAGAAAGTCAAGG; CL3, TGTCGAGCATACCAGCATCAGATG; CL4, TTGGAAGGCCACAATCTGTTCTGC; RI, TCACAAGCTGATCGACTCGATGCCACGTCG; RII, TTCTGAACACTGTGGTGAAG.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The allele pk93 is null for the expression of rop-1:
The strain NL733 rop-1(pk93), carrying an insertion of the transposon Tc1 in the rop-1 gene, was obtained from Ronald Plasterk (The Netherlands Cancer Institute, Amsterdam). The original strain was outcrossed 10 times with the wild-type strain N2 to ensure a wild-type genetic background as far as possible. The presence of the transposon within the rop-1 gene was confirmed by PCR after each outcross, using primer pairs CL1/RI and CL2/RII. The exact position of the Tc1 insertion was determined by sequencing the PCR product obtained following the second round of amplification. Tc1 disrupted rop-1 in the third exon, 23 nucleotides after the 3' splice site of the second intron (Figure 1). Northern blot analysis on total RNA, with the rop-1 coding sequence used as a probe, shows that the allele pk93 has a greatly reduced expression of rop-1 mRNA when compared to wild-type levels (Figure 2A). Moreover, the residual signal is most likely nonspecific hybridization since RT-PCR analysis failed to amplify any specific band from the rop-1 mutant strain (Figure 2B). Furthermore, Western blot analysis on total protein extracts, using ROP-1 specific antibodies, did not detect the presence of ROP-1 in the rop-1 mutant when compared to wild type (Figure 2C). No ROP-1 protein was detected, even when the primary antibody concentration and exposure times were greatly increased (data not shown). These results clearly demonstrate that the allele pk93 is null for the expression of rop-1.

View larger version (8K): In this window In a new window Download PPT slide   Figure 1. Schematic representation of the Tc1-transposon insertion site in allele pk93. Tc1-transposon disrupts rop-1 in the third exon, 23 nucleotides downstream from the 3' splice site of the second intron. The exons are shown as boxes and introns are depicted as lines linking the boxes. The rop-1 promoter is shown as a thick line. Numbers identify nucleotides positions (for more details, see LABBE et al. 1995 ). Scale, 1 kb.

View larger version (33K): In this window In a new window Download PPT slide   Figure 2. The allele pk93 is null for the expression of rop-1. (A) Northern blot analysis of rop-1. Total RNA was extracted from mixed stage animals and 5 µg of RNA were resolved by formaldehyde-agarose gel electrophoresis, transferred, and probed with a cDNA containing the complete rop-1 coding sequence. The arrow points to the position of the rop-1 mRNA at 1.9 kb. Lane 1, N2 total RNA; lane 2, rop-1(pk93) total RNA. (B) RT-PCR analysis of rop-1. Total RNA from N2 and rop-1(pk93) strains was reverse transcribed with primer CL3 and subjected to two rounds of PCR using both SL1 and SL2 as 5' primers, and CL3 and CL4 for each round of PCR as the 3' primer. Lane 1, N2 RT product with SL1 primer; lane 2, N2 RT product with SL2 primer; lane 3, rop-1(pk93) RT product with SL1 primer; lane 4, rop-1(pk93)RT product with SL2 primer. (C) Western blot analysis of ROP-1. Total protein was extracted from mixed-stage animals and 100 µg of extracts were resolved on SDS-PAGE, blotted, and probed with an antibody specific for ROP-1. The arrow designates the migration position of the ROP-1 protein at 65 kD. Lane 1, N2 total protein extract; lane 2, rop-1(pk93) total protein extract. Lanes M denote molecular size markers.

rop-1 mutants do not show any visible phenotype:
rop-1 mutant worms do not show any obvious phenotype. The morphology and behavior of the mutants are wild type. Since Ro60 is present in virtually every vertebrate cell, it is likely to play a ubiquitous role in cellular physiology. Its absence is expected to affect basic cellular processes that could result in phenotypes that generally affect the whole organism. Thus, we scored the brood size and the life span of rop-1 mutants, but observed no difference between wild-type and rop-1 mutant worms at either 15°, 20°, or 25° (data not shown). Therefore, under the growth conditions tested, ROP-1 does not seem to play a crucial role in C. elegans physiology.

5S rRNA processing in the absence of ROP-1:
Ro60 has been shown to bind defective 5S rRNA copies in Xenopus oocytes (O'BRIEN and WOLIN 1994 ). It has been proposed that this binding might lead mutant 5S molecules to a degradation pathway. Consequently, the absence of Ro60 should significantly affect 5S rRNA processing. To this end, we verified the fate of 5S rRNA molecules in the rop-1 mutant worms using the following approaches.

We first analyzed the levels of 5S rRNA by Northern blotting on total RNA extracts from mixed-stage worms. Using this method, we could not observe any difference between the levels of 5S rRNA in wild-type and rop-1 mutant strains (data not shown). As a control, we also analyzed the levels of five different tRNAs, which are transcribed by RNA polymerase III via a different set of transcription factors from those used for 5S rRNA. Yet the levels of tRNA in wild type and the rop-1 mutant strain appeared the same (data not shown). Thus, the amounts of 5S rRNA seem unaffected by the absence of ROP-1.

Next we verified the quality of individual 5S rRNA molecules transcribed in wild-type and rop-1 mutant strains. To this end, both total and ribosomal RNA was extracted from each strain and 5S rRNA molecules were selectively amplified by RT-PCR using primers XB-poly(T) and S1CE5S. Since the primer S1CE5S anneals to the first 18 nucleotides of the 5S molecule, no mutation could be detected from this region. In order to minimize nucleotide misincorporation events during the PCR reactions, a thermostable DNA polymerase containing a proofreading activity was used for DNA amplification (Vent DNA polymerase, New England Biolabs). As shown in Table 1, sequencing of the individual 5S rRNA copies from total RNA extracts revealed no substantial difference between wild-type and rop-1 mutant strains, with ~8% of the 5S RNA molecules containing a single mutation. However, sequencing of 5S rRNAs extracted from ribosomes of wild type displayed only 1.6% of mutation frequency, whereas those extracted from ribosomes of rop-1 mutants showed 8% of mutation frequency. The mutations observed maintained in general the ratio of purine:pyrimidine in the 5S molecule and were principally located in the regions defined as loop B-stem III-loop C and stem V-loop E (data not shown; O'BRIEN and WOLIN 1994 ). Some mutations were found in more than one cellular pool and in both strains, demonstrating that they indeed occur in vivo and are not the result of the PCR amplification. These results suggest that ROP-1 is directly involved in the quality control of 5S rRNA. Transgenic animals expressing wild-type ROP-1 from a transgene were generated to rescue this phenotype. Nevertheless, the 5S rRNA molecules extracted from the ribosomes of these transgenic worms display 10% of mutation frequency. This lack of rescue by a rop-1 transgene could be explained either by the presence of another mutation affecting 5S rRNA processing in the MQ470 strain or by a general problem in rescuing events occurring in the germline (see below).

The levels of ROP-1-associated Y RNA are severely decreased in rop-1 mutants:
It has previously been shown that the C. elegans ROP-1 protein associates with the CeY RNA (VAN HORN et al. 1995 ). We studied the levels of CeY RNA by Northern blot analysis on C. elegans total RNA extracts. While CeY RNA is an abundant molecule in wild-type cells, its levels decrease dramatically in a rop-1 mutant background (Figure 3B; compare lanes 1 and 2). Because ROP-1 normally associates with CeY RNA, the simplest explanation would be that the absence of ROP-1 alters the stability of the small RNA. Alternatively, ROP-1 could be directly involved in the transcription of CeY RNA.

View larger version (68K): In this window In a new window Download PPT slide   Figure 3. The levels of CeY RNA are decreased in rop-1 mutants and are partially rescued by transgenic expression of rop-1. (A) Western blot analysis of ROP-1 in transgenic strains. A total of 100 µg of total protein extracts was resolved on SDS-PAGE, transferred, and probed with an antibody specific for ROP-1. Each transgenic strain expresses ROP-1 at a different level when compared with each other. (B) Northern blot analysis of CeY RNA in transgenic strains. A total of 5 µg RNA was resolved by formaldehyde-agarose gel electrophoresis, transferred, and probed with the complete yrn-1 gene (VAN HORN et al. 1995 ). This result shows that the levels of CeY RNA are greatly decreased in rop-1 mutant worms. These levels are also different in each transgenic strain and are proportionally related to the increase of ROP-1 in the same strain (compare corresponding lanes in A and B). (C) For quantification in Northern blot analysis, the membrane was stripped and reprobed with a cDNA encoding a portion of a gene encoding actin (plasmid pCeA103; KRAUSE et al. 1989 ), thereby demonstrating that all lanes were loaded with comparable amounts of RNA. Lane 1, N2 extracts; lane 2, rop-1(pk93) extracts; lane 3, rop-1(pk93); qmEx158 extracts; lane 4, rop-1(pk93); qmEx160 extracts; lane 5, rop-1(pk93); qmEx156 extracts; lane 6, rop-1(pk93); qmIs11 extracts.

To show that the decrease in CeY RNA is due to the absence of ROP-1, we set out to rescue its expression by reintroducing the wild-type rop-1 gene in the rop-1 mutant. We generated three strains in which each transgenic array expresses ROP-1 at a different level. In C. elegans, transgenic arrays are maintained extrachromosomally and display some mitotic instability (MELLO and FIRE 1995 ). Therefore, not all the cells of a given animal contain the transgene. To circumvent this instability, the extrachromosomal array of one of these three strains was integrated in the genome of C. elegans by -ray treatment. Western blot analysis showed that the transgenic worms were indeed producing ROP-1 in all four strains (Figure 3A). Under these conditions, the transgenic expression of wild-type rop-1 was able to partially rescue the levels of CeY RNA (Figure 3B). The quantity of CeY RNA present in each rescuing strain increased proportionally with the level of ROP-1 synthesis (compare individual lanes in Figure 3A with Figure 3B). The fact that the levels of both molecules are proportional upon reexpression of ROP-1 indicates that the CeY RNA's presence is linked to ROP-1.

To improve the rescue of the phenotypes associated with rop-1 disruption, we generated transgenic strains carrying the wild-type rop-1 gene along with a 50-fold excess of wild-type genomic DNA (KELLY et al. 1997 ). This method should generate complex arrays that are better expressed in germline. Nevertheless, the levels of CeY RNA in these strains were comparable to those observed in Figure 3B and were still much lower than in the wild type (data not shown).

CeY RNA is present at higher levels in the adult germline and in embryos:
Since the rescue of CeY RNA is partial, we further investigated this phenomenon. Even though transgenic arrays are usually well expressed in most somatic lineages, they are poorly expressed in the germline of C. elegans (KELLY et al. 1997 ). Therefore, it is difficult, at best, to rescue an event that occurs during oogenesis or early embryogenesis. To investigate this point, we analyzed the expression of RoRNP components throughout the developmental stages of the nematode by Northern blot analysis on staged-worm total RNA extracts. As shown in Figure 4A, rop-1 mRNA levels are stable during C. elegans development. Western blot analysis on staged-worm protein extracts revealed that ROP-1 levels are also stable (data not shown). However, a differential expression pattern was observed for CeY RNA. CeY RNA levels are high in the embryos, as compared to the other stages but decrease at the L1 stage (Figure 4B; compare lanes 1 and 2). These levels are maintained through all the larval stages, but increase slightly at the L4 stage and considerably at the adult stage, a time when oogenesis starts (BARTON et al. 1987 ). The fact that the CeY RNA levels start to increase at the L4 stage and peak at the adult stage suggests that the CeY RNA is highly expressed in the germline. As a control, we checked the levels of CeY RNA in glp-1(q231) mutant adults grown at the nonpermissive temperature. This temperature-sensitive mutation results in worms whose germ cell precursors fail to undergo mitosis, thereby producing animals with no germline (AUSTIN and KIMBLE 1987 ). We found that CeY RNA levels in glp-1 mutants are similar to those observed in the wild-type larval stages (Figure 4B). Taken together, these results clearly demonstrate that while rop-1 mRNA appears to be expressed at stable levels during development, CeY RNA is transcribed at higher levels in the adult germline and in embryos. Because transgenes are generally silenced in the germline, the levels of CeY RNA would not have been readily rescued by a transgene expressing wild-type rop-1.

View larger version (54K): In this window In a new window Download PPT slide   Figure 4. CeY RNA is transcribed at higher levels in the adult germline and in embryos. Total RNA was prepared from staged worms and 5 µg of total RNA was resolved by formaldehyde-agarose gel electrophoresis, transferred, and probed with (A) a rop-1 cDNA, (B) the yrn-1 gene, or (C) a portion of the gene encoding actin. The levels of rop-1 mRNA and CeY RNA are both high in the embryos, but decrease at the subsequent larval stages. However, the levels of CeY RNA increase a little at the L4 stage and a lot at the adult stage. Lane 1, wild-type embryos; lane 2, wild-type L1 larvae; lane 3, wild-type L2 larvae; lane 4, wild-type L3 larvae; lane 5, wild-type L4 larvae; lane 6, wild-type nongravid adults; lane 7, glp-1(q231) mutant adults. (D) The intensity of each band obtained in (B) was determined by scanning the X-ray film with a LKB ultroscan XL enhanced laser densitometer (Pharmacia, Piscataway, NJ). Each individual band in (B) was corrected with the densitometric value obtained by scanning the band in the corresponding lane obtained in (C) with an actin probe. The corrected data were plotted on a graphical chart.

The rop-1 promoter is not active in the germline when expressed from a transgene:
To characterize the expression pattern of rop-1 from a transgene, we fused the rop-1 promoter to lacZ, with the 3' UTR of unc-54. The resulting strains express the enzyme ß-galactosidase in the cellular types where the rop-1 transgenic promoter is active. As shown in Figure 5, the expression of rop-1::lacZ is mosaic and differs from animal to animal. This irregular pattern of expression cannot be explained only by the instability of transgenic arrays, because this pattern was still observed after one of the transgenic arrays was integrated in the genome of C. elegans. Nevertheless, by comparing the expression pattern of numerous worms and strains, we observed some ß-galactosidase staining in every cell type of the nematode, except in the germline. The same results were obtained with a rop-1::gfp reporter construct (data not shown). This ubiquitous expression further supports the notion of a basic cellular role for ROP-1, compatible with its involvement in 5S rRNA quality control. Furthermore, because CeY RNA is transcribed at higher levels in the germline and in embryos, the fact that the transgenic rop-1 is not expressed in the C. elegans germline provides an explanation for the partial rescue of CeY RNA levels we observed.

View larger version (154K): In this window In a new window Download PPT slide   Figure 5. Transgenic expression pattern of rop-1. X-Gal staining of whole animals transformed with the in-frame rop-1::lacZ reporter construct pCeRo4107. Eight independent strains were assayed for ß-galactosidase staining, and the expression patterns from individual worms were compared. The transgenic rop-1 promoter is expressed in every cell type of the organism, except in the germline. This photograph shows representative results obtained by this method.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

We report here the first phenotypic characterization of an organism devoid of Ro60 protein. The C. elegans rop-1 gene was disrupted by Tc1 transposon insertion at the 5' end of its third exon. The absence of ROP-1 synthesis was confirmed by Western blot analysis on total protein extracts from the rop-1 mutant strain. There was no visible phenotype observed in association with the disruption. However, in the rop-1 mutant strain, we observed a dramatic decrease in CeY RNA levels. The CeY RNA levels were partially rescued when the wild-type rop-1 gene was reintroduced in the rop-1 mutant worms. The partial rescue is probably related to the fact that the CeY RNA is transcribed at higher levels in the adult germline and in the embryo.

rop-1 mutant worms display no visible phenotype:
The absence of a visible phenotype in rop-1 mutants is surprising considering the level of conservation of Ro60 proteins between human, mouse, frog, and nematode (LABBE et al. 1995 ; VAN HORN et al. 1995 ; WANG et al. 1996 ). The fact that the rop-1 gene has been conserved during evolution strongly suggests that ROP-1 plays some role in the nematode's cellular physiology. The lack of observed phenotype might be due to the fact that the worms are cultured under ideal conditions, rather different from those they encounter in their natural habitat. However, growing the worms at different temperatures could not induce any effect in rop-1 mutants, but rop-1 could become essential in a variety of other natural stresses yet to be defined.

RoRNP components are present at higher levels during embryogenesis:
RoRNP particles previously have been immunoprecipitated from C. elegans embryos (VAN HORN et al. 1995 ). Our results showing the high abundance of CeY RNA in embryos corroborate this evidence and further demonstrate that CeY RNA is also transcribed in the adult germline. Because rop-1 expression appears to be stable throughout development and the CeY RNA molecule is transcribed in the germline, it is not clear whether the CeY RNA is present naked, associated in RoRNP particles, or complexed to some other molecule. However, the fact that the CeY RNA is transcribed in the germline indicates that it is provided maternally to the developing oocyte. Similarly, it has been demonstrated that the multifunctional protein La also presents a developmentally regulated expression pattern in Drosophila melanogaster (BAI et al. 1994 ). Taken together, these observations suggest some function for the RoRNP complexes or individual components during early embryogenesis.

A link between ROP-1 and 5S rRNA processing in C. elegans:
In Xenopus oocytes, Ro60 has been shown to interact with misfolded 5S rRNA molecules that contain mutations, as well as a ~10-nucleotide extension at their 3' end (O'BRIEN and WOLIN 1994 ; SHI et al. 1996 ). In this work, we have observed that in rop-1 mutants, the level of ribosome-associated 5S rRNA mutant molecules is increased approximately fivefold. At this point, it is not clear whether this result is directly linked to the absence of ROP-1 or to another unidentified mutation present in the strain. However, because protein synthesis is performed at very high rates in the oocyte, the needs in 5S rRNA are enormous, and a substantial amount of 5S rRNA is deposited in the oocyte in a relatively short time (WOLFFE and BROWN 1988 ). Indeed, the amounts of 5S rRNA in the oocyte are such that C. elegans embryos lacking the rrs-1 locus (containing 110 tandem copies of the 5S rDNA) can develop normally and hatch only with the 5S rRNA molecules supplied maternally (FERGUSON et al. 1996 ). In this cellular context, the number of transcriptional errors in the maternal 5S rRNAs could be increased, justifying the need for an additional quality control mechanism. The fact that the fivefold increase in mutant 5S rRNAs incorporated into ribosomes was not reverted in the rop-1 mutant carrying the transgenic wild-type rop-1 may be due to the failure of transgene expression in the germline. Supporting this argument, we have shown that the levels of CeY RNA are only partially restored in the transgenic worms. Likewise, the 5S rRNA quality control function in early embryogenesis would not have been readily rescued. Taken together, these observations suggest that the Ro60-5S rRNA association might specifically occur in oocytes and that Ro60 could be involved in the quality control of 5S rRNA. Because we only detect a difference in ribosome-associated 5S rRNA mutant molecules between the wild-type and rop-1 mutant strain, this quality control would occur at the level of incorporation of 5S rRNA into the ribosomes.

	ACKNOWLEDGMENTS

We express our gratitude to Ronald Plasterk (The Netherlands Cancer Institute, Amsterdam) for providing the rop-1(pk93) strain, Barry Honda (Simon Fraser University, Vancouver, B.C., Canada) for providing a 5S rDNA clone, Marc Perry (University of Toronto) for sending us the plasmid pCeA103 containing the actin probe, and Andy Fire (Carnegie Institution of Washington, Baltimore) for the generous gift of lacZ expression vectors. We also thank Sandra Wolin (Yale University, New Haven) for sharing unpublished data and all the members of the Rokeach and Hekimi laboratories for technical advice and insightful comments on the manuscript. Some strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the National Center for Research Resources of the National Institutes of Health. J.-C.L. was supported by a studentship from the Fonds pour la Formation de Chercheurs et l'Aide à la Recherche. L.A.R. was a scholar of The Medical Research Council of Canada. This work was supported by a Canadian Arthritis Society grant to L.A.R. and a Medical Research Council of Canada grant to S.H.

Manuscript received July 15, 1998; Accepted for publication October 5, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALI, N. and A. SIDDIQUI, 1997  The La antigen binds 5' noncoding region of the hepatitis C virus RNA in the context of the initiator AUG codon and stimulates internal ribosome entry site-mediated translation. Proc. Natl. Acad. Sci. USA 94:2249-2254[Abstract/Free Full Text].

AUSTIN, J. and J. KIMBLE, 1987  glp-1 is required in the germ line for regulation of the decision between mitosis and meiosis in C. elegans.. Cell 51:589-599[Medline].

BAI, C., Z. LI, and P. P. TOLIAS, 1994  Developmental characterization of a Drosophila RNA-binding protein homologous to the human systemic lupus erythematosus-associated La/SS-B autoantigen. Mol. Cell. Biol. 14:5123-5129[Abstract/Free Full Text].

BARTON, M. K., T. B. SCHEDL, and J. KIMBLE, 1987  Gain-of-function mutations of fem-3, a sex-determination gene in Caenorhabditis elegans.. Genetics 115:107-119[Abstract/Free Full Text].

BELSHAM, G. J., N. SONENBERG, and Y. V. SVITKIN, 1995  The role of the La autoantigen in internal initiation. Curr. Top. Microbiol. Immunol. 203:85-98[Medline].

BOIRE, G. and J. CRAFT, 1989  Biochemical and immunological heterogeneity of the Ro ribonucleoprotein particles. Analysis with sera specific for the RohY5 particle. J. Clin. Invest. 84:270-279.

BOIRE, G., M. GENDRON, N. MONAST, B. BASTIN, and H. A. MÉNARD, 1995  Purification of antigenically intact Ro ribonucleoproteins: biochemical and immunological evidence that the 52-kD protein is not a Ro protein. Clin. Exp. Immunol. 100:489-498[Medline].

BRENNER, S., 1974  The genetics of Caenorhabditis elegans.. Genetics 77:71-94[Abstract/Free Full Text].

CHAN, E. K. L., J. C. HAMEL, J. P. BUYON, and E. M. TAN, 1991  Molecular definition and sequence motifs of the 52-kD component of human SS-A/Ro autoantigen. J. Clin. Invest. 87:68-76.

DEUTSCHER, S. L., J. B. HARLEY, and J. D. KEENE, 1988  Molecular analysis of the 60-kDa human Ro ribonucleoprotein. Proc. Natl. Acad. Sci. USA 85:9479-9483[Abstract/Free Full Text].

EWBANK, J. J., T. M. BARNES, B. LAKOWSKI, M. LUSSIER, and H. BUSSEY et al., 1997  Structural and functional conservation of the Caenorhabditis elegans timing gene clk-1.. Science 275:980-983[Abstract/Free Full Text].

FAN, H., A. L. SAKULICH, J. L. GOODIER, X. L. ZHANG, and J. QIN et al., 1997  Phosphorylation of the human La antigen on serine 366 can regulate recycling of RNA polymerase III transcription complexes. Cell 88:707-715[Medline].

FAN, H., J. L. GOODIER, J. R. CHAMBERLAIN, D. B. ENGELKE, and R. J. MARAIA, 1998  5' processing of tRNA precursors can be modulated by the human La antigen phosphoprotein. Mol. Cell. Biol. 18:3201-3211[Abstract/Free Full Text].

FARRIS, A. D., C. A. O'BRIEN, and J. B. HARLEY, 1995  Y3 is the most conserved small RNA component of Ro ribonucleoprotein complexes in vertebrate species. Gene 154:193-198[Medline].

FARRIS, A. D., F. PUVION-DUTILLEUL, E. PUVION, J. B. HARLEY, and L. A. LEE, 1997  The ultrastructural localization of 60-kDa Ro protein and human cytoplasmic RNAs: association with novel electron-dense bodies. Proc. Natl. Acad. Sci. USA 94:3040-3045[Abstract/Free Full Text].

FERGUSON, K. C., P. J. HEID, and J. H. ROTHMAN, 1996  The SL1 trans-spliced leader RNA performs an essential embryonic function in Caenorhabditis elegans that can also be supplied by SL2 RNA. Genes Dev. 10:1543-1556[Abstract/Free Full Text].

FIRE, A., 1992  Histochemical techniques for locating Escherichia coli beta-galactosidase activity in transgenic organisms. Genet. Anal. Tech. Appl. 9:151-158[Medline].

FIRE, A., S. W. HARRISON, and D. DIXON, 1990  A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans.. Gene 93:189-198[Medline].

GOTTLIEB, E. and J. A. STEITZ, 1989a  The RNA binding protein La influences both the accuracy and the efficiency of RNA polymerase III transcription in vitro.. EMBO J. 8:841-850[Medline].

GOTTLIEB, E. and J. A. STEITZ, 1989b  Function of the mammalian La protein: evidence for its action in transcription termination by RNA polymerase III. EMBO J. 8:851-861[Medline].

GREEN, C. D., K. S. LONG, H. SHI, and S. L. WOLIN, 1998  Binding of the 60-kDa Ro autoantigen to Y RNAs: evidence for the recognition in the major groove of a conserved helix. RNA 4:750-765[Abstract].

HUHN, P., G. J. M. PRUIJN, W. J. VAN VENROOIJ, and M. BACHMANN, 1997  Characterization of the autoantigen La (SS-B) as an dsRNA unwinding enzyme. Nucleic Acids Res. 25:410-416[Abstract/Free Full Text].

ITOH, K., Y. ITOH, and M. B. FRANK, 1991  Protein heterogeneity in the human Ro/SSA ribonucleoproteins. The 52- and 60-kD Ro/SSA autoantigens are encoded by separate genes. J. Clin. Invest. 87:177-186.

KELEKAR, A., M. R. SAITTA, and J. D. KEENE, 1994  Molecular composition of Ro small ribonucleoprotein complexes in human cells. Intracellular localization of the 60-(and 52-kD proteins. J. Clin. Invest. 93):1637-1644.

KELLY, W. G., S. Q. XU, M. K. MONTGOMERY, and A. FIRE, 1997  Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics 146:227-238[Abstract].

KRAUSE, M., M. WILD, B. ROSENZWEIG, and D. HIRSH, 1989  Wild-type and mutant actin genes in Caenorhabditis elegans.. J. Mol. Biol. 208:381-392[Medline].

LABBÉ, J.-C., M. JANNATIPOUR, and L. A. ROKEACH, 1995  The Caenorhabditis elegans rop-1 gene encodes the homologue of the human 60-kDa Ro autoantigen. Gene 167:227-231[Medline].

LEWIS, J. A. and J. T. FLEMING, 1995  Basic culture methods. Methods Cell Biol. 48:4-29.

LINMARQ, N. and S. G. CLARKSON, 1998  Efficient synthesis, termination and release of RNA polymerase III transcripts in Xenopus extracts depleted of La protein. EMBO J. 17:2033-2041[Medline].

MAMULA, M. J., E. D. SILVERMAN, R. M. LAXER, L. BENTUR, and B. ISACOVICS et al., 1989  Human monoclonal anti-La antibodies. The La protein resides on a subset of Ro particles. J. Immunol. 143:2923-2928[Abstract].

MARAIA, R. J., 1996  Transcription termination factor La is also an initiation factor for RNA polymerase III. Proc. Natl. Acad. Sci. USA 93:3383-3387[Abstract/Free Full Text].

MELLO, C. C. and A. FIRE, 1995  DNA transformation. Methods Cell Biol. 48:451-482[Medline].

O'BRIEN, C. A. and S. L. WOLIN, 1994  A possible role for the 60-kD Ro autoantigen in a discard pathway for defective 5S rRNA precursors. Genes Dev. 8:2891-2903[Abstract/Free Full Text].

O'BRIEN, C. A., K. MARGELOT, and S. L. WOLIN, 1993  Xenopus Ro ribonucleoproteins: members of an evolutionarily conserved class of cytoplasmic ribonucleoproteins. Proc. Natl. Acad. Sci. USA 90:7250-7254[Abstract/Free Full Text].

PRUIJN, G. J. M., R. L. SLOBBE, and W. J. VAN VENROOIJ, 1991  Analysis of protein-RNA interaction within Ro ribonucleoprotein complexes. Nucleic Acids Res. 19:5173-5180[Abstract/Free Full Text].

PRUIJN, G. J. M., P. A. E. T. M. WINGENS, S. L. M. PETERS, J. P. H. THIJSSEN, and W. J. VAN VENROOIJ, 1993  Ro RNP associated Y RNAs are highly conserved among mammals. Biochim. Biophys. Acta Gene Struct. Expression 1216:395-401[Medline].

ROKEACH, L. A., J. A. HASELBY, and S. O. HOCH, 1991  High-level bacterial expression, purification and characterization of human calreticulin. Protein Eng. 4:981-987[Abstract/Free Full Text].

SHI, H., C. A. O'BRIEN, D. J. VAN HORN, and S. L. WOLIN, 1996  A misfolded form of 5S rRNA is complexed with the Ro and La autoantigens. RNA 2:769-784[Abstract].

SLOBBE, R. L., W. PLUK, W. J. VAN VENROOIJ, and G. J. PRUIJN, 1992  Ro ribonucleoprotein assembly in vitro. Identification of RNA-protein and protein-protein interactions. J. Mol. Biol. 227:361-366[Medline].

STEFANO, J. E., 1984  Purified lupus antigen La recognizes an oligouridylate stretch common to the 3' termini of RNA polymerase III transcripts. Cell 36:145-154[Medline].

TAN, E. M., 1993  Molecular biology of nuclear autoantigens. Adv. Nephrol. 22:213-236.

TSENG, C. E., E. K. L. CHAN, E. MIRANDA, M. GROSS, and F. DIDONATO et al., 1997  The 52-kD protein as a target of intermolecular spreading of the immune response to components of the SS-A/Ro-SS-B/La complex. Arthritis Rheum. 40:936-944[Medline].

VAN GELDER, C. W. G., J. P. H. M. THIJSSEN, E. C. J. KLAASSEN, C. STURCHLER, and A. KROL et al., 1994  Common structural features of the Ro RNP associated hY1 and hY5 RNAs. Nucleic Acids Res. 22:2498-2506[Abstract/Free Full Text].

VAN HORN, D. J., D. EISENBERG, C. A. O'BRIEN, and S. L. WOLIN, 1995  Caenorhabditis elegans embryos contain only one major species of Ro RNP. RNA 1:293-303[Abstract].

VAN HORN, D. J., C. J. YOO, D. H. XUE, H. SHI, and S. L. WOLIN, 1997  The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation. RNA 3:1434-1443[Abstract].

VAN VENROOIJ, W. J., R. L. SLOBBE, and G. J. M. PRUIJN, 1993  Structure and function of La and Ro RNPs. Mol. Biol. Rep. 18:113-119[Medline].

WANG, D. R., J. P. BUYON, and E. K. L. CHAN, 1996  Cloning and expression of mouse 60 kDa ribonucleoprotein SS-A/Ro. Mol. Biol. Rep. 23:205-210[Medline].

WOLFFE, A. P. and D. D. BROWN, 1988  Developmental regulation of two 5S ribosomal RNA genes. Science 241:1626-1632[Abstract/Free Full Text].

WOLIN, S. L. and J. A. STEITZ, 1983  Genes for two small cytoplasmic Ro RNAs are adjacent and appear to be single-copy in the human genome. Cell 32:735-744[Medline].

WOLIN, S. L. and J. A. STEITZ, 1984  The Ro small cytoplasmic ribonucleoproteins: identification of the antigenic protein and its binding site on the Ro RNAs. Proc. Natl. Acad. Sci. USA 81:1996-2000[Abstract/Free Full Text].

YOO, C. J. and S. L. WOLIN, 1997  The yeast La protein is required for the 3' endonucleolytic cleavage that matures tRNA precursors. Cell 89:393-402[Medline].

YOUINOU, P., Y. ADLER, S. MULLER, A. LAMOUR, and D. BARON et al., 1994  Anti-Ro(SSA) and anti-La(SSB) antibodies in autoimmune rheumatic diseases. Clin. Rev. Allergy 12:253-274[Medline].

ZWAAL, R. R., A. BROEKS, J. VAN MEURS, J. T. M. GROENEN, and R. H. A. PLASTERK, 1993  Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90:7431-7435[Abstract/Free Full Text].

This article has been cited by other articles:

				J. R. Hogg and K. Collins Human Y5 RNA specializes a Ro ribonucleoprotein for 5S ribosomal RNA quality control Genes & Dev., December 1, 2007; 21(23): 3067 - 3072. [Abstract] [Full Text] [PDF]

				X. Chen, E. J. Wurtmann, J. Van Batavia, B. Zybailov, M. P. Washburn, and S. L. Wolin An ortholog of the Ro autoantigen functions in 23S rRNA maturation in D. radiodurans Genes & Dev., June 1, 2007; 21(11): 1328 - 1339. [Abstract] [Full Text] [PDF]

				C. P. Christov, T. J. Gardiner, D. Szuts, and T. Krude Functional Requirement of Noncoding Y RNAs for Human Chromosomal DNA Replication. Mol. Cell. Biol., September 1, 2006; 26(18): 6993 - 7004. [Abstract] [Full Text] [PDF]

				A. BELISOVA, K. SEMRAD, O. MAYER, G. KOCIAN, E. WAIGMANN, R. SCHROEDER, and G. STEINER RNA chaperone activity of protein components of human Ro RNPs RNA, July 1, 2005; 11(7): 1084 - 1094. [Abstract] [Full Text] [PDF]

				D. Xue, H. Shi, J. D. Smith, X. Chen, D. A. Noe, T. Cedervall, D. D. Yang, E. Eynon, D. E. Brash, M. Kashgarian, et al. A lupus-like syndrome develops in mice lacking the Ro 60-kDa protein, a major lupus autoantigen PNAS, June 24, 2003; 100(13): 7503 - 7508. [Abstract] [Full Text] [PDF]

				V. A. Kickhoefer, Y. Liu, L. B. Kong, B. E. Snow, P. L. Stewart, L. Harrington, and L. H. Rome The Telomerase/Vault-associated Protein TEP1 Is Required for Vault RNA Stability and Its Association with the Vault Particle J. Cell Biol., January 8, 2001; 152(1): 157 - 164. [Abstract] [Full Text] [PDF]

				J.-C. Labbé, J. Burgess, L. A. Rokeach, and S. Hekimi ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation PNAS, November 2, 2000; (2000) 230284297. [Abstract] [Full Text]

				X. Chen, A. M. Quinn, and S. L. Wolin Ro ribonucleoproteins contribute to the resistance of Deinococcus radiodurans to ultraviolet irradiation Genes & Dev., April 1, 2000; 14(7): 777 - 782. [Abstract] [Full Text]

				J.-C. Labbe, J. Burgess, L. A. Rokeach, and S. Hekimi ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation PNAS, November 21, 2000; 97(24): 13233 - 13238. [Abstract] [Full Text] [PDF]