Characterization of Functional Regions in the Schizosaccharomyces pombe mei3 Developmental Activator

,a

Corresponding author: Maureen McLeod, State University of New York, Health Science Center, Department of Microbiology and Immunology, Morse Institute for Molecular Biology and Genetics, 450 Clarkson Ave., Brooklyn, New York 11203., mmcleod{at}netmail.hscbklyn.edu (E-mail).

Communicating editor: P. G. YOUNG

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The Schizosaccharomyces pombe mei3⁺ gene is expressed only in diploid cells undergoing meiosis. Ectopic expression of mei3⁺ in haploid cells causes meiotic catastrophe. Mei3 is an inhibitor of Ran1/Pat1 kinase and contains a nine-amino-acid motif, Mei3-RKDIII, that resembles two regions in the Ste11 substrate for Ran1/Pat1. Substitution of serine for Arg-81 within Mei3-RKDIII transforms the inhibitor into a substrate for Ran1/Pat1. Thus, it is likely that Mei3-RKDIII defines a pseudosubstrate sequence. In this study, we constructed a series of mei3 deletion mutations and assayed each for activity. This analysis indicates that the carboxy-terminal domain of Mei3 is sufficient for function in vivo. Alanine-scanning mutagenesis identifies critical residues within the inhibitory domain. Two mutations, SM1 and SM8, fail to cause meiotic catastrophe. The SM1 mutation contains alterations of amino acid residues in Mei3-RKDIII. Recombinant SM1 protein exhibits reduced ability to inhibit Ran1/Pat1 kinase in vitro and interacts inefficiently with the kinase in a two-hybrid assay. The SM8 protein binds to Ran1/Pat1 in a two-hybrid assay but fails to inhibit Ran1/Pat1 substrate phosphorylation in vitro. These findings provide evidence that Mei3-RKDIII defines a Ran1/Pat1-binding site that is necessary but not sufficient for inhibition of the kinase. Using fusions to green fluorescent protein, the cellular localization of Ran1 and Mei3 was examined in living cells. Ran1 is concentrated in the nucleus. Mei3 is also enriched in the nucleus and, consistent with the genetic and biochemical results, the inhibitory domain of Mei3 is sufficient for nuclear localization.

IN the presence of sufficient nutrients, Schizosaccharomyces pombe cells proliferate by means of mitotic cell division. However, as nutrients become limiting, cells accumulate at G₁ and those of opposite mating-type conjugate. The diploid cell formed through conjugation is able to divide vegetatively or undergo meiosis. A variety of studies indicate that Ran1/Pat1 kinase (referred to as Ran1 hereafter) functions as a pivotal regulator of all phases of sexual differentiation: G₁ delay, conjugation, premeiotic DNA synthesis, and sporulation.

Inactivation of Ran1 kinase is both necessary and sufficient to divert cells from the mitotic cell cycle into the meiotic developmental program (IINO and YAMAMOTO 1985A , IINO and YAMAMOTO 1985B ; NURSE 1985 ). Experiments examining the phenotype of cells carrying a ran1 temperature-sensitive allele suggest that regulation of each stage of this process is accomplished by step-wise inactivation of the kinase (BEACH et al. 1985 ). Limiting nutritional conditions trigger partial inactivation of Ran1. This allows cells to accumulate in G₁ (BEACH et al. 1985 ; DAVEY and NIELSEN 1994 ), the only stage of the cell cycle permissive for conjugation (EGEL 1973 ). After conjugation, continued starvation of the diploid zygote, along with the mating-pheromone signaling system, leads to full inactivation of Ran1. This promotes meiosis (WILLER et al. 1995 ). Although little is known of mechanisms regulating partial inactivation of Ran1, considerable evidence exists that complete inactivation of Ran1 occurs by its association with the Mei3 inhibitor.

Attenuation of Ran1 activity provokes expression of a set of meiosis-specific genes (NIELSEN and EGEL 1990 ) that function as elements of a cascading circuit. The most upstream of these is ste11, which is required for expression of most meiosis-specific genes. ste11 encodes a 62,000-D protein with homology to the HMG family of DNA-binding proteins (SUGIMOTO et al. 1991 ). Ste11 is an in vitro substrate for Ran1. Phosphorylation of Ste11 by Ran1 has not been demonstrated in vivo. However, high level expression of Ran1 inhibits nuclear localization of Ste11, indicating a functional interaction between the two proteins (LI and MCLEOD 1996 ). Ste11 binds to a specific sequence, the TR box, found upstream of the genes it regulates, including itself. Expression of genes at the mating-type locus is dependent on Ste11 (SUGIMOTO et al. 1991 ). The mating-type locus is not a single genetic entity, but encodes four genes. matP_c and matP_m are functional in "plus" cells, and matM_c and matM_m are functional in "minus" cells (KELLY et al. 1988 ). matP_c and matM_c control production of mating pheromones and pheromone receptors essential for conjugation (KELLY et al. 1988 ; for review see NIELSEN 1993 ). Pheromone signaling is also required for expression of matM_m and matP_m (WILLER et al. 1995 ), both of which are necessary for meiosis (KELLY et al. 1988 ). matP_m and matM_m provoke transcription of mei3 directly or indirectly (MCLEOD et al. 1987 ; WILLER et al. 1995 ). As described below, the product of the mei3 gene functions as a critical meiotic activator.

Cells containing a loss-of-function mei3 allele are able to conjugate and undergo nuclear fusion, but arrest just before premeiotic DNA synthesis (BRESCH et al. 1968 ). Both the mei3 transcript and its protein product are found only in nutritionally limited diploid cells expressing all four mating-type genes (MCLEOD et al. 1987 ). Although several of the mating-type genes encode predicted DNA-binding proteins (KELLY et al. 1988 ; DOOIJES et al. 1993 ), it is not known if any regulate mei3 expression directly. In contrast to the phenotype caused by inactivation of mei3, ectopic expression of mei3 is sufficient to divert cells from the mitotic cell cycle into meiosis (MCLEOD et al. 1987 ). Thus, even haploid cells growing on rich medium will undergo meiosis upon expression of mei3. Because meiosis excludes mitotic cell division, production of mei3 in haploid cells is lethal, a condition referred to as meiotic catastrophe. Notably, this is the same phenotype caused by inactivation of Ran1. These observations suggest that Mei3 promotes meiosis primarily through inhibition of Ran1. Biochemical data support this premise. Mei3 coimmunoprecipitates with Ran1 in yeast extracts prepared from cells expressing high levels of both proteins. Moreover, Ran1 associated with Mei3 exhibits markedly reduced kinase activity (MCLEOD and BEACH 1988 ).

Mei3 contains a nine-amino-acid region (Mei3-RKDIII) that is homologous to two regions (Ste11-RKDI and Ste11-RKDII) in the Ste11 substrate for Ran1. It has been proposed that the RKD motifs contain substrate specificity determinants. In support of this hypothesis, amino residues in Ste11-RKDI (Thr-173) and Ste11-RKDII (Ser-218) that are critical for phosphorylation by Ran1 have been identified. Substitution of the corresponding amino acid within Mei3-RKDIII (Arg-81) transforms the inhibitor into a substrate for Ran1 (LI and MCLEOD 1996 ). These lines of evidence suggest that Mei3 is a pseudosubstrate inhibitor, and that Mei3-RKDIII may interact with the active site of Ran1 to inhibit its activity. However, no compelling evidence has been presented to demonstrate a functional role for Mei3-RKDIII in meiosis or for inhibition of Ran1 in vitro. Moreover, recent studies have identified Mei2 as a substrate for Ran1 (WATANABE et al. 1997 ). Comparison of the amino acid sequences surrounding the Ran1 phosphorylation sites of Mei2 with the proposed RKD sites shows significant divergence between the two.

This article presents evidence supporting the identification of RKD motifs as functional elements. Using defined deletions, we determine that the C-terminal domain of Mei3 is sufficient to cause meiotic catastrophe, to localize Mei3 to the nucleus, and to inhibit Ran1 substrate phosphorylation. Alanine scanning mutagenesis of the inhibitory domain defines two regions, SM1 and SM8, that are critical for Mei3 function in vivo and for inhibition of Ran1 in vitro. The SM1 mutation encompasses residues that reside in Mei3-RKDIII. The SM8 mutation contains alterations of amino acids distinct from Mei3-RKDIII. In vitro kinase assays show that SM1 and SM8 are each ineffective inhibitors of Ran1 substrate phosphorylation compared to the wild-type protein. Using a two-hybrid assay, we demonstrate that the RKD region is responsible for the interaction between Ran1 and Mei3. These studies indicate that Mei3-RKDIII is a pseudosubstrate motif required for efficiently binding Ran1. However, although binding is necessary, it is not sufficient to inhibit Ran1 kinase activity. One other region, defined by the SM8 mei3 allele, is required as well. Finally, using fusions to green fluorescent protein (GFP), the cellular localization of Ran1 and Mei3 was examined in living cells. Ran1 is concentrated in the nucleus of the cell. Mei3 is also enriched in the nucleus. Consistent with the genetic and biochemical results described above, the inhibitory domain of Mei3 is sufficient for nuclear localization.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains and media:
The genotypes of S. pombe strains used in this study are as follows: SP66, h⁹⁰ leu1-32 ade6-M216; SPB46, h⁹⁰ leu1-32 ade6-M216 mei2::lacZ; SPB95, h⁹⁰ leu1-32 ura4-D18 ade6-M216 mei2-ts ran1⁺O.P; SPB158, h⁹⁰ leu1-32 ura4-D18 ade6-M210 mei2-lacZ ran1⁺O.P; SPB203, h⁹⁰ leu1-32 ura4-D18 ade6-M210 mei3::ura4; SPB204, h⁹⁰ leu1-32 ura4-D18 ade6-M210 mei3::sm1; SPB205, h⁹⁰ leu1-32 ura4-D18 ade6-M210 mei3::sm8; SPB77, h⁹⁰ leu1-32 ura4-D18 ade6-M216 mei2-ts; SPB65, h⁹⁰ leu1-32 ura4-D18 ade6-M216 ste11::ura4. S. pombe cells were cultured in rich medium (YEA) or minimal defined medium (EMM) with the required amino acid supplements, as described (ALFA et al. 1993 ). Escherichia coli were grown in LB supplemented with antibiotics (SAMBROOK et al. 1989 ). Saccharomyces cerevisiae (Y190: MATa leu2-3 ura3-52 trp1-1901 his3-200 ade2-101 gal4 gal80 URA3::GAL1-LacZ LYS::GAL1-HIS3 cyh^r) was used for two-hybrid assays (HARPER et al. 1993 ).

Oligonucleotides:
The oligonucleotides used in this study were designed with assistance from the OLIGO software package (National Biosciences Inc., Plymouth, MN). The 5' complementary end of each oligonucleotide used for scanning mutagenesis has a calculated T_m of 35°. The 3' complementary end has a calculated T_m of 25° (GIBBS and ZOLLER 1991 ). Oligonucleotides were synthesized by the phosphoramidite method on an Applied Biosystems DNA synthesizer (Applied Biosystems, Foster City, CA). The sequence of each is as follows: SM1, 5'CATAGCGTTCCCATGGCAGCAACTGCACGTGTTCGCC3';

SM2, 5'CATGAAACGCACTAAAGCTGTTGCAGCAACCCCTGCAC3';

SM3, 5'CGAACCCCTGCAGCAGCAATTGCACATGAAAATAAAGA3';

SM4, 5'AACGCATTGAACATGCAGCTGCAGAAAATATTCAGAC3';

SM5, 5'TTGAACATGAAAATAAAGCAGCTATTGCAACTGAAAAGGTTTAT3';

SM6, 5'GAAAATATTCAGACTGCAGCAGTTTATGCAATTAAGCCTGTC3';

SM7, 5'GGTTTATAGGATTGCACCTGTCGCTGCAGTTCTTTCTCC3';

SM8, 5'CTTTCTCCCTCAGCACTCACTGCAGCACTAACCATCCTGG3';

SM98FS, 5'CATTGAACATGAAAATAAAGCAGCTATTGCAACTGAAAAAGGTT3';

MEI3NDE, 5'CTCGAGTATACATCTTCATCTTT;

MEI814, 5'AGAATTGCCCATATGAAACGCACTAAACGT; MEI128, 5'ATCCTGGATCCTATTTTAATAGTACGCATCG3';

HA-NHE, 5'AGATTACGCTAGCTTGGGTG3'; MEI3-p10RKD, 5'GTGGATCCTCAAACACGTTTAGTGCGTTTC3';

RAN1-NOT, 5'GTAGATCCATCTCGAAGCGGCCGCTAAAGTTACTTGCTT3';

MEI3-NOT, 5'CCGACCGTGTAAACAACAGCGGCCGCTAAGCAACTGC3';

GFP-NHE, 5'CAGCGCTAGCAGTAAAGGAGAAGAACTTTTCA3';

GFP-BAM, 5'CGGGGATCCTTATTTGTATAGTTCATCC3';

MEI3C-NHE, 5'CGGTAGCTAGCGTTCCCATGAAACG3';

MEI3-p10, 5'TGGGATCCTAGGGAACGCTATGTACCGAT3'.

Oligonucleotide mutagenesis:
SM1–SM8 and SM98FS were isolated using single-strand mutagenesis. Single-strand phage was prepared from the E. coli essentially as described (MCLEOD et al. 1987 ). Candidate mutations were identified using plasmid mini-preps and restriction enzyme analysis (SM1, NcoI; SM2, AflIII; SM3, SM4, and SM6–SM8, PstI). Alternatively, colony hybridization using the mutagenic oligonucleotide as a probe was used (SAMBROOK et al. 1989 ). The identity of the mutations was verified by dideoxy sequence analysis (Amersham Life Science, Arlington Heights, IL).

Plasmids:
pALT2 was used for expression of genes in fission yeast. pALT2 is essentially identical to pART3 (MCLEOD et al. 1987 ), except that it contains HA1 sequences fused to the adh promoter so that target genes flanked by NdeI and BamHI restriction recognition sites can be fused in-frame to the HA1 epitope tag. The HA1 epitope is derived from the hemagglutinin antigen of the influenza virus (FIELD et al. 1988 ). pART3 is a derivative of the phagemid pUC118. It contains the S. cerevisiae LEU2 gene as a selectable marker, ars1 sequences, and the adh regulatory region (RUSSELL 1983 ). A commercially obtained plasmid, pET15b (NovoLabs), was used for expression of genes in E. coli. Each gene was first fused in-frame to sequences encoding an HA1 epitope using the plasmid pALT2. The HA epitope-tagged versions of each gene were obtained as NheI/BamHI fragments and cloned directly into a pET15b vector modified to contain HA1 sequences fused in-frame to sequences encoding a (HIS)₆ tag. The green fluorescent probe variant S65T was used as a NotI/BamHI fragment. The phagemid pGC2 was used for oligonucleotide-directed mutagenesis. Exact details and genealogies of all plasmid constructions are available on request.

Plasmid constructions:

• pMEI3.25, SM1–SM8, and SM98FS: Contain the entire HA-mei3 gene or the designated mutant mei3 allele as an NdeI/BamHI fragment (MCLEOD et al. 1987 ) in the yeast expression vector pALT2.

• pMEI3.23: PCR product formed using oligonucleotides MEI814 and MEI128 in pALT2.

• pMEI3-N: PCR product formed using oligonucleotides MEI3p10 and HA-NHE in pALT2.

• pMEI3-N/RKD: PCR product formed using oligonucleotides MEI3-p10RKD and HA-NHE in pALT2.

• pMEI3-C: An NdeI site was introduced using oligonucleotide MEI814 for expression of the C terminus in pALT2.

• WT-pET15b: Contains the entire HA-mei3 gene as an NheI/BamHI fragment in the bacterial expression vector pET15b.

• p11-pET15b: Contains the mei3 allele identical to that in MEI3-C in the bacterial expression vector pET15b.

• Mei3-GFP: A NotI site was introduced into the C terminus of HA-mei3 using oligonucleotide MEI3-NOT to create a Mei3-GFP fusion protein. The fusion was expressed as an NheI/BamHI fragment in the vector pALT2.

• Ran1-GFP: A NotI site was introduced into the C terminus of HA-ran1 using oligonucleotide RAN1-NOT to create a Ran1-GFP fusion protein. The fusion was expressed in the vector pALT2.

• GFP-2: PCR product formed using oligonucleotides GFP-NHE and GFP-BAM. The template used was GFP1-S65T (kindly provided by Dr. Jeanne Hirsch, Columbia University, New York).

• Mei3-C-GFP: PCR product formed using oligonucleotides MEI3C-NHE and GFP-BAM. The template used was Mei3-GPF.

Expression of recombinant proteins:
The plasmids used for expression of recombinant proteins were WT-pET15b (p21) and p11-pET15b (p11). The construction of plasmids is described in a preceding section. All recombinant proteins were expressed as N-terminal fusion proteins to (HIS)₆-HA1 sequences (FIELD et al. 1988 ; SMITH et al. 1988 ). Purification of recombinant proteins has been described (LI and MCLEOD 1996 ).

Yeast extracts:
In experiments using Western blots, cells were grown to a density of 1.0–2.0 x 10⁷ cells/ml in minimal selective medium. Pelleted cells were washed in HE buffer (50 mM Tris HCl, pH8.0, 5 mM EDTA, 1 mM DTT) and resuspended in 0.5 ml HE buffer containing 1 mM PMSF. After addition of sterile glass beads, the cells were broken by vortexing for 15 min at 4°. Lysates were removed to a fresh tube, and the glass beads were washed in 2.0 ml RIPA buffer (HE plus 0.5% sodium deoxycholate). Clarified lysate was obtained by centrifugation at 12,000 rpm for 30 min. Protein concentrations were determined using bovine serum albumin as a standard in a protein assay system (Bio-Rad, Richmond, CA). A permeabilized cell assay was used to measure ß-galactosidase activity in either fission or budding yeast cells (ALFA et al. 1993 ). Units of activity = (100) (OD₄₂₀)/(OD₆₀₀) (time_min).

Western blots:
Either yeast total cell lysate (100 µg) or purified recombinant protein (50 ng) were separated on a 5.0–15.5% gradient SDS-polyacrylamide gel before electrophoretic transfer to Hybond-C membranes (Amersham). Membranes were incubated for 1 hr at room temperature with 5.0% nonfat dry milk in TBST (20 mM Tris-HCl, pH 7.6, 137 mM NaCl, 0.2% Tween 20). The blocking solution was removed and replaced with primary antibody after extensive washes in TBST. The primary antibody was a mixture of R30, R48, and R99 monoclonal antibody (MCLEOD and BEACH 1988 ) diluted 1:1000 in 5% dry milk in TBST for detection of Ran1. For detection of Mei3, N8 monoclonal antibody (MCLEOD et al. 1987 ) diluted 1:1000 in 5% dry milk in TBST was used. After incubation with primary antibody at room temperature for 1 hr, membranes were washed extensively in TBST. Secondary antibody (1:10,000 dilution of anti–mouse IgG horseradish peroxidase conjugate from sheep; Amersham) in TBST was added to the membrane, and incubation was continued for 30 min at room temperature. The filter was washed using TBST. Immunoreactive proteins were visualized using the Dupont New England Nuclear (Boston) Research Products chemiluminescent kit.

Enzyme kinetic studies:
The concentrations of inhibitor proteins (p21 and p11) were determined after visualization of the protein on a SDS-polyacrylamide gel and comparison with a known protein standard. This value was confirmed using a Bio-Rad protein assay with BSA as a standard. All inhibitor proteins and the p39^ste11 substrate were judged to be 99% pure. Kinase assays were performed as described (LI and MCLEOD 1996 ), except that Mei3 or its mutated versions were preincubated with Ran1 for 5 min before initiating the reaction by the addition of p39^ste11. Radioactive incorporation was measured using a PhosphoImager.

Sporulation assay:
Cells were grown on EMM plates for 4 days at 30° as single colonies. An entire single colony was resuspended in EMM and examined using a microscope. A minimum of three individual colonies were analyzed, and 1000 cells/colony were counted.

Fluorescent microscopy:
Plasmids constructed for expression of GFP fusion protein in fission yeast are as follows: Ran1, Ran1-GFP; Mei3, Mei3-GFP; Mei3-C, Mei3C-GFP; and GFP alone, GFP-2. The plasmids were transformed into the strains indicated in the text. Transformants were grown in selective medium to a density of 5.0 x 10⁶ to 1 x 10⁷. The GFP fusion proteins were visualized in live cells using a Nikon Axiophot with a BA 520-560 filter.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The C-terminal domain of Mei3 is sufficient for function:
Previous experiments indirectly implicated the C terminus as the active region of Mei3 (MCLEOD et al. 1987 ). We directly examined Mei3 functional domains by construction of a series of specific deletion mutations (Figure 1). We assayed each mutation in vivo for the ability to induce meiotic catastrophe, which is presumably caused by inactivation of Ran1. Because meiosis excludes mitotic cell division, cells containing active alleles of mei3 are incapable of forming viable colonies. However, meiotic catastrophe can be suppressed by the presence of an inactive mei2 allele (MCLEOD et al. 1987 ). Thus, each mei3 allele expressed under control of the constitutive adh promoter was introduced into yeast on a plasmid and classified as active (MEI⁺) if transformants could be obtained in mei2^- cells but not in mei2⁺ cells (Table 1). We tested the function of the C-terminal region using pMEI3.23, which is predicted to encode a truncated Mei3 polypeptide containing amino acid residues 76–128. After transformation of pMEI3.23 into either mei2⁺ or mei2^- cells, we observed a large number of viable colonies in mei2^- cells only (Table 1). This result establishes that the C-terminal half of Mei3, which contains the RKDIII motif, is sufficient to cause meiotic catastrophe. Next, two deletion mutations were constructed to determine if the RKDIII motif is sufficient to cause meiotic catastrophe. The first mutation, pMEI3-N/RKD, contains the N-terminal half of the protein plus RKDIII (amino acid residues 1–84). The second allele, SM98FS, introduces a frameshift at amino acid position 98. Transformation of either plasmid into both mei2⁺ and mei2^- cells produced a large number of viable colonies (Table 1). Thus, both mutations prevent meiotic catastrophe. Taken together, the above experiments indicate that the functional domain of Mei3 is contained within a 52-amino-acid region located in the C-terminal half of the polypeptide. Notably, although the minimal functional region contains Mei3-RKDIII, the presence of this motif is not sufficient for Mei3 function.

View larger version (21K): In this window In a new window Download PPT slide   Figure 1. Summary of mutations tested for induction of meiotic catastrophe. Amino acid residues of Mei3 are indicated in numbers on the top scale. Illustrated as a bar beneath are the sequences predicted to be encoded by various derivatives of mei3. All alleles were expressed from the adh promoter on a replicating plasmid. Mutations able to induce meiotic catastrophe (as defined in the text and in Table 1) are designated Mei+; those unable to do so are Mei-. The strain used for transformation was Ran1OP (SPB95). pMEI3.25 contains the full-length mei3+ gene. The black box represents the location of Mei3-RKDIII (as defined in LI and MCLEOD 1996 ). Deletion constructs derived from pMEI3.25 are illustrated below. The truncated allele contained on each is predicted to encode the following polypeptides: SM98FS, contains a frameshift at amino acid residue 98 (illustrated with a filled circle); pMEI3.23, amino acid residues 76–128; pMEI3-N/RKD, amino acid residues 1–82; pMEI3-C, amino acid residues 76–148. This analysis limited the inhibitory domain of Mei3 to residues 76–128 (see Table 1). The amino acid sequence of the inhibitory domain is illustrated. Clusters of mutations were introduced at defined residues in a full-length HA epitope-tagged mei3+ gene using oligonucleotide-directed mutagenesis. Charged amino acids were altered in groups of three to alanine residues (SM1–SM8).

Ran1 kinase represses sexual differentiation, at least in part, by regulation of meiosis-specific gene expression. For instance, inactivation of Ran1 provokes expression of matP_c and bypasses the usual requirement for nitrogen starvation (NIELSEN and EGEL 1990 ). Conversely, high-level expression of the kinase prevents expression of mei2, even under starvation conditions (DEVOTI et al. 1991 and Figure 2A). Regulation of meiosis-specific gene expression by Ran1 is most likely accomplished via direct regulation of the Ste11 transcription factor (LI and MCLEOD 1996 ). Thus, each mei3 plasmid was tested for the ability to overcome repression of meiosis-specific gene expression imposed by Ran1 activity. To accomplish this, a yeast strain was constructed containing a mei2-lacZ reporter gene in place of the endogenous mei2 gene. In addition, this strain (SPB158) produces high levels of Ran1 kinase under control of the adh promoter. Each mei3 plasmid was introduced into SPB158 cells by transformation. A representative number of transformants were cultured to mid-log growth in complete medium and shifted to a medium devoid of nitrogen. At various times after the shift, a portion of the culture was examined for reporter gene expression. This analysis revealed that expression of Mei3 (pMEI3.25) caused a 20-fold increase in ß-galactosidase activity compared to a control plasmid containing no Mei3 sequences (Figure 2A). Transformants containing pMEI3-C, which expresses the C-terminal Mei3 domain, were indistinguishable from those containing the full-length plasmid. On the other hand, a plasmid expressing the N-terminal domain only (MEI3-N) or the N-terminal domain plus the RKD motif (MEI3N/RKD) was unable to cause an increase in reporter gene expression.

View larger version (49K): In this window In a new window Download PPT slide   Figure 2. The C-terminal domain of Mei3 is sufficient for Inhibition of Ran1. (A) Activation of a mei2 reporter gene by mei3 mutants. Plasmids containing the indicated inserts were introduced into SPB158 cells by transformation (see Figure 1 for a description of the plasmids used). SPB158 contains a replacement of mei2 with a mei2-lacZ reporter allele and an adh-ran allele. The transformants were grown to a density of 107 cells/ml in defined medium and shifted to a nitrogen-free medium. At the indicated times, cells were quantitated, permeabilized with chloroform, and assayed for ß-galactosidase activity. (B) Inhibition of Ran1 substrate phosphorylation. Kinase reactions were assembled without Mei3 (-) or with an equivalent molar amount of either full-length Mei3 (p21) or truncated Mei3-C (p11) recombinant proteins. The amount of inhibitor added was previously determined to inhibit Ran1 substrate phosphorylation by 90%. p39 substrate was added at the Km concentration. Reactions were initiated by the addition of [32P]ATP and allowed to proceed for 5 min at 28°. The reactions were terminated by the addition of 2x Laemmli sample buffer, separated on an SDS-PAGE, and processed for autoradiography. The amount of radioactivity incorporated was determined using a PhosphoImager.

The genetic assays described above indicate that the Mei3 C-terminal domain is active. To determine if a correlation could be drawn between the in vivo function of Mei3 and its ability to inhibit Ran1 kinase, the activity of the C-terminal domain was investigated in vitro. A truncated Mei3 polypeptide corresponding to amino acid residues 75–148 was produced in bacteria as a (HIS)₆ fusion protein. Either full-length (HIS)₆-MEI3 (p21) or an equivalent molar amount of the truncated (HIS)₆-Mei3 (p11) were incubated with Ran1, Ste11 substrate (p39), and [³²P]ATP. After SDS-PAGE, we observed that both p21 and p11 inhibited Ran1 substrate phosphorylation to the same extent (Figure 2B).

Identification of critical residues in the Mei3 inhibitory region:
To further define the functional region of mei3, specific mutations were created in the inhibitory domain. Each mutation was designed to substitute a charged amino acid residue with an alanine. To increase the likelihood of obtaining inactive alleles, residues were altered in groups of three. Each plasmid-borne mutation (SM1–SM8, Figure 1) was constructed in a full-length mei3 gene, expressed under adh control, and assayed for the ability to cause meiotic catastrophe. Neither wild-type mei3⁺ nor any of the SM mutations gave rise to a significant number of viable transformants in mei2⁺ cells, although all were capable of high frequency transformation in mei2^- cells (Table 1). Thus, all the SM mutations caused meiotic catastrophe and could not be distinguished from each other or from wild-type mei3⁺ in this experiment. However, this result indicates that none of the SM mutations result in a null allele; each is active in the in vivo assay used.

As a means of discriminating between the activity of each SM mutation, the following strategy was used. Because meiosis induced by expression of mei3⁺ appears to be caused solely by inhibition of Ran1 kinase, Mei3 mutations with decreased activity might be identified by an inability to induce meiotic catastrophe in cells producing high levels of Ran1. A yeast strain was constructed to produce high amounts of Ran1 under adh control. The strain was further modified to contain a thermolabile mei2 allele (mei2-ts) so that viable transformants could be obtained at a restrictive temperature for mei2ts (35°) and tested for induction of meiotic catastrophe at 30°, a permissive temperature for this allele (Figure 3A). This strain (SPB95) was transformed with plasmids expressing either Mei3 or one of the SM mutant proteins. All the plasmids gave rise to viable transformants at the restrictive temperature for mei2ts. However, when a representative number of transformants were transferred to fresh plates and incubated at the permissive temperature, none gave rise to colonies, except for the SM1 and SM8 plasmids (Figure 3B). The steady-state levels of Mei3 protein produced by each plasmid and of Ran1 were compared in an immunoblot (Figure 3C). With the exception of SM8, whole-cell extracts from each of the transformants contained comparable amounts of Mei3. As anticipated, the steady-state abundance of Ran1 was equivalent in cell extracts from all transformants examined. Taken together, these results support several conclusions. First, because high-level expression of Ran1 is required to discriminate between active and inactive mei3-SM mutations, then Mei3 most likely causes meiosis through interaction with Ran1. Thus, amino acid residues altered in SM1 (K-77, R-78, and K-80) are likely required for interaction with or inhibition of Ran1 in vivo. Notably, all three residues are located within the Mei3-RKDIII motif. One other region, defined by the SM8 mutation, is also required for Ran1 inhibition. However, because the steady-state level of the SM8 protein is reduced compared to Mei3 (or any of the SM mutations), the biochemical basis for the inability of SM8 to induce meiotic catastrophe cannot be fully assessed in this experiment.

View larger version (55K): In this window In a new window Download PPT slide   Figure 3. Induction of meiotic catastrophe. (A) Assay of meiotic catastrophe caused by expression of mei3+. SPB95 cells (h90, ran1+O.P., mei2-ts, leu1-32, and ade6-M210) were transformed with an empty vector (pALT2) or vector containing mei3+ (pmei3.25). Transformants were selected at 35° and patched to two selective media plates. One plate was incubated at the restrictive temperature for mei2-ts (35°), and the other was incubated at a permissive temperature (30°) for 2 days before photography. (B) Assay of meiotic catastrophe caused by expression of SM mutations. SPB95 transformants containing the designated plasmids (see Figure 1 for description of plasmid mutations) were obtained as described above. A representative number of individual transformants were patched to selective medium and incubated at 30° for 2 days before photography. (C) Western blot of lysates prepared from SPB95 containing the indicated plasmids. Total cell lysate was prepared from transformants grown at 35°. Proteins were separated on an SDS-polyacrylamide gel and processed for immunoblotting. The top portion of the blot was developed using an anti-Ran1 monoclonal antibody. The bottom portion was developed using an anti-Mei3 monoclonal antibody. The positions of Ran1 (p52) and Mei3 (p21) are indicated using arrows.

The above experiments define specific regions of Mei3 required to cause meiotic catastrophe in cells producing high levels of both Ran1 kinase and mutant versions of Mei3. To confirm that SM1 and SM8 are physiologically significant regions of Mei3, we replaced the endogenous mei3 allele with either sm1 or sm8 by using one-step gene replacement. h⁹⁰ cells containing a mei3 null allele are able to conjugate efficiently, but do not undergo meiosis and sporulation (BRESCH et al. 1968 and Figure 4A, panel b). In the cells containing a replacement of endogenous mei3 with either sm1 or sm8, we observed that in both cases, the cells were fully capable of conjugation, but sporulation was reduced (Figure 4A). The sm1 mutant allowed 48% of the cells to undergo meiosis. In contrast, sm8, which is less effective than sm1 as an in vitro inhibitor of Ran1, allows only 7% of the cells to sporulate (Figure 4B).

View larger version (144K): In this window In a new window Download PPT slide   Figure 4. sm1 and sm8 are defective mei3 alleles. (A) Cells containing the endogenous mei3 gene (a, SP66), mei3::ura4 (b, SBP203), mei3::sm1 (c, SPB204), or mei3::sm8 (d, SPB205) were grown on minimal medium plates at 30° for 4 days. (B) Cells were resuspended in H2O for photomicroscopy and for quantitation of spore-containing cells.

In vitro interactions between Ran1 and Mei3 proteins:
Protein kinase inhibitors function using a variety of mechanisms. In some cases, they directly hinder catalytic activity by blocking the active site of the enzyme or by interfering with residues required for nucleotide binding. In other cases, kinase activity is modulated in vivo by association with a regulatory protein that targets the enzyme to a specific location in the cell. None of these mechanisms can be distinguished from one another using meiotic catastrophe as an assay for Mei3 activity. As an initial step to define the mechanism(s) Mei3 uses for its function, we directly examined the ability of the SM1 and SM8 proteins to inhibit Ran1 substrate phosphorylation. To accomplish this, SM1 and SM8 were expressed in bacteria as (HIS)₆-tagged fusion proteins and purified to 99% homogeneity using Ni²⁺-NTA chromatography. Various amounts of either Mei3, SM1, or SM8 recombinant proteins were added to reactions containing Ran1 kinase and p39^Ste11 as substrate. This experiment revealed that wild-type Mei3 inhibited Ran1 substrate phosphorylation with an IC₅₀ value of 0.14 nM. In contrast, SM1 and SM8 inhibited the phosphorylation of p39^ste11 with IC₅₀ values of ~15 and 58 nM, respectively (Figure 5). Thus, SM1 and, to an even greater extent, SM8 are poor inhibitors of Ran1 in vitro. This result provides biochemical evidence that SM1 and SM8 define regions of Mei3 that directly interfere with Ran1 catalytic activity. Notably, there is good correlation between the biochemical and genetic data, which both indicate that the SM8 mutation is a less effective inhibitor than the SM1 mutation.

View larger version (15K): In this window In a new window Download PPT slide   Figure 5. Inhibition of Ran1 substrate phosphorylation by Mei3, SM1, or SM8. Affinity-purified Ran1 was assayed for phosphotransferase activity in the presence of increasing concentrations of Mei3 (circles), SM1 (squares), or SM8 (triangles). Kinase assays used p39ste11 for substrate as described in METHODS. Samples were incubated at 28° for 10 min before SDS-PAGE. A PhosphoImager was used to quantitate radioactive incorporation. Kinase activity is expressed as the amount of 32P incorporated into substrate using a sample containing no added inhibitor as 100% activity.

Two-hybrid interactions between Ran1 and Mei3 proteins:
Previous biochemical experiments established the significance of RKD motifs as substrate specificity determinants. Amino residues in Ste11-RKDI and Ste11-RKDII (Thr-173 and Ser-218, respectively) are critical for phosphorylation by Ran1 in vitro. Substitution of the corresponding amino acid within Mei3-RKDIII (Arg-81, LI and MCLEOD 1996 ) transforms the inhibitor into a substrate for Ran1. These results predict that RKD motifs contain Ran1-binding determinants. The SM1 mutation alters three amino acid residues in Mei3-RKDIII, indicating the functional importance of specific residues in this motif. However, no evidence has been reported indicating that Mei3-RKDIII contributes to binding between Ran1 and Mei3. On the other hand, the SM8 mutation alters residues distinct from Mei3-RKDIII. One explanation for the functional requirement of the SM8 region is that it may also be required for tight binding between Ran1 and Mei3. Alternatively, mutations in the SM8 region may interfere with other kinase regulatory mechanisms, such as ATP binding. We, therefore, examined the interaction between Ran1 and the mutant Mei3 proteins.

The two-hybrid system has been widely used to study protein-protein interactions, and, in some cases, point mutations that interfere with association between members of a complex can be observed in this system (LI and FIELDS 1993 ). The interactions between ran1 fused to the activation domain of GAL4 and various mei3 alleles fused to sequences encoding the GAL4 DNA-binding domain were tested in S. cerevisiae. First, we established a line of cells containing the Ran1 hybrid plasmid. This strain was then transformed with the Mei3 fusion plasmids indicated in Figure 6. Because the inhibitory domain of Mei3 is contained within the C-terminal half of the protein, and because the N-terminal region appears entirely dispensable for inhibition of Ran1 in vitro or for meiotic catastrophe induction, these were tested first. We observed that the C-terminal domain of Mei3 interacted with Ran1 to the same extent as authentic Mei3. The N-terminal domain exhibited no interaction with Ran1. These data indicate that the test system is highly specific. Significantly, addition of Mei3-RKDIII sequences to the N-terminal domain allowed the polypeptide to interact with Ran1 to nearly the same extent as full-length Mei3. Next, several Mei3 mutant proteins were tested. SM1, which contains alterations of three amino acids in the Mei3-RKDIII motif, activated expression of the reporter gene to a weaker extent than either Mei3 or the C-terminal domain. In contrast, SM8 interacted with Ran1 to the same extent as wild-type Mei3. To further investigate the role of the SM8 region, SM98FS was tested. This mutation contains the Mei3-RKDIII motif, but, because of a frameshift created at residue 98, it lacks the SM8 region. We observed that SM98FS activated expression of the reporter gene to the same extent as Mei3 or SM8. Although two-hybrid analysis does not directly measure protein-protein interactions, these data, taken together with the previous results, strongly support the identification of Mei3-RKDIII as a Ran1-binding motif, and suggest that the SM8 region is not directly required for association with Ran1.

View larger version (18K): In this window In a new window Download PPT slide   Figure 6. Two-hybrid analysis of the interaction between Ran1 and Mei3 fusion proteins. The reporter strain (Y190) permits detection of protein-protein interaction through transcriptional activation of a GAL1-lacZ gene. Y190 cells were transformed with the indicated ran1-GAL4ACT (activation domain) fusion plasmids and a plasmid expressing a mei3-GAL4DBD (DNA-binding domain) plasmid. All mei3 fusion genes contain full-length mei3 with the indicated mutations (SM1, SM8, or SM98FS) or truncated alleles of mei3 (as described in Figure 1). Transformants were grown to a density of 2 x 107 cells/ml and assayed for ß-galactosidase activity using a permeabilized cell assay. Mean values obtained using three independent transformants are shown.

Localization of Ran1 and Mei3:
In view of data supporting a direct interaction between Ran1 and Mei3, as well as experiments demonstrating that two substrates for Ran1, Mei2p and Ste11p, are localized to the nucleus (LI and MCLEOD 1996 ; WATANABE et al. 1997 ), we examined the cellular localization of Ran1 and Mei3. To accomplish this, each protein was expressed from a plasmid as a fusion to GFP (CHALFIE et al. 1994 ). Each fusion gene was judged to be active because each is able to complement its respective null allele. Microscopic examination of transformants containing a plasmid expressing GFP alone revealed that the fluorescent protein is present throughout the entire cell and is not concentrated in any particular region (Figure 7A). In contrast, both Ran1-GFP or Mei3-GFP are enriched in the nucleus (Figure 7B and Figure C). Ran1-GFP exhibits a punctate nuclear staining, but Mei3-GFP is uniformly distributed throughout the nuclear region. Next, we examined the C-terminal domain of Mei3 to determine if it is sufficient for nuclear localization of GFP. We observed that transformants expressing Mei3C-GFP concentrate the fusion protein in the nucleus, indicating that the functional domain is sufficient for nuclear localization (Figure 7D). Neither Ran1 nor Mei3 contain an obvious nuclear localization signal. Thus, we examined the localization of Ran1-GFP and Mei3-GFP in a variety of mutant cells. This experiment revealed that nuclear localization of Ran1 and Mei3 is independent of mei2 (Figure 7B and Figure C) and ste11 (Figure 7E and Figure F), both of which interact directly with Ran1 (LI and MCLEOD 1996 ; WATANABE et al. 1997 ).

View larger version (105K): In this window In a new window Download PPT slide   Figure 7. Cellular localization of Ran1 and Mei3 GFP fusion proteins. Photomicrographs of cells (SPB77, a–d) or ste11- cells (SPB65, e and f) transformed with plasmids expressing GFP alone (a), Ran1-GFP (b and f), Mei3-GFP (c and e), or Mei3-C-GFP (d). SPB65 cells were grown at a permissive temperature of 25° (a, b, and f) or at 35° for production of Mei3-GFP (c, d, and e).

For some protein kinases, high-level expression masks conditions that regulate localization of the kinase. For instance, mitogen-activated protein kinase localizes to the nucleus after activation by extracellular stimuli. High-level expression of mitogen-activated protein kinase results in nuclear accumulation in the absence of stimulation (FUKUDA et al. 1997 ). To examine the effect of increasing concentrations of Ran1-GFP or Mei3-GFP, the fusion proteins were expressed under control of the inducible nmt promoter. When cells carrying these constructs were cultured in the presence of thiamine, no fluorescence was observed. Approximately 6 hr after the cells were shifted to a derepressing condition (medium lacking thiamine), fluorescence became detectable. The pattern of nuclear fluorescence observed was identical to that observed when the fusion proteins were expressed under control of the constitutive adh promoter (data not shown). This experiment revealed that Ran1 and Mei3 are observed in the nucleus as soon as detectable amounts of fusion protein have accumulated in the cell.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The Mei3 protein is composed of two distinct domains:
The mei3 gene acts as a developmental activator in fission yeast. Expression of mei3 is sufficient to cause cells to exit the cell cycle and to undergo premeiotic DNA synthesis, both meiotic divisions and sporulation. Mei3 accomplishes this by inhibition of Ran1 kinase. We previously used in vitro assays to provide evidence that Mei3 contained a pseudosubstrate motif. Here, we show that the pseudosubstrate motif is required for Mei3 function in vivo. Deletion mutations establish that the C-terminal domain of Mei3 is sufficient to cause meiotic catastrophe. Moreover, this domain is indistinguishable from the full-length protein as an in vitro inhibitor of Ran1 substrate phosphorylation. Consistent with these observations, a polypeptide containing only the C-terminal domain associates with Ran1 in a two-hybrid assay. Thus, the C-terminal domain is sufficient for Mei3 function in vivo and for inhibition of Ran1 in vitro. These results raise a question as to the role of the N-terminal portion of the Mei3 protein. On one hand, it may be totally dispensable for Mei3 function, although it comprises half the entire protein. Alternatively, Mei3 may be required for other functions during meiosis that are not measured using meiotic catastrophe as an assay. It has been reported that meiotic catastrophe caused by loss of Ran1 produces spores with low viability, even in diploid cells. Consistent with this observation, meiotic recombination is severely reduced during meiosis caused by inactivation of Ran1 (BAHLER et al. 1991 ). Thus, meiotic catastrophe is not a faithful mimic of normal meiosis. However, the present results clearly establish that the Ran1 inhibitory region of Mei3 resides solely in the C-terminal portion of the protein.

Two independent regions in the inhibitory domain are required for activity:
The function of specific amino acid residues in the C-terminal domain was investigated using alanine-scanning mutagenesis. Two mutations, SM1 and SM8 (see Figure 1 and Figure 3), fail to cause meiotic catastrophe in cells producing high levels of Ran1 kinase. In contrast, both SM1 and SM8 cause meiotic catastrophe in cells producing normal amounts of Ran1. Because the level of Ran1 kinase affects the phenotype caused by expression of the mei3 mutations, it appears that the physiological function of Mei3 is to activate meiosis through association with and inhibition of Ran1. Mei3 does not appear to function as a nonspecific protein kinase inhibitor. The activity of cAMP-dependent protein kinase, which, like Ran1, negatively regulates sexual differentiation, is not inhibited by Mei3 in vivo (W. WANG and A. SCHETTINO, unpublished data).

The catalytic activity of a number of protein kinases is negatively regulated by association with pseudosubstrate sequences (for review see KEMP and PEARSON 1991 ). In some cases, the pseudosubstrate sequence is located on the same molecule as the kinase, but for other kinases, it is found as a separate polypeptide. One well-investigated example of the latter is PKI, the heat-stable inhibitor of PKA. Biochemical studies have established that the PKI pseudosubstrate region is sufficient to inhibit PKA substrate phosphorylation in vitro (CHENG et al. 1985 ; SCOTT et al. 1985 ). Crystallographic studies reveal that the inhibitor forms substrate-like interactions with the kinase that block its active site (KNIGHTON et al. 1991A , KNIGHTON et al. 1991B ). However, not all inhibitory regions that resemble phosphorylation sites use the same mechanism to obstruct kinase activity. For instance, the crystal structure of Ca²⁺/calmodulin-dependent protein kinase I suggests that its autoinhibitory domain contains two regions that make inhibitory contacts with the kinase. One of these is a pseudosubstrate-like sequence that interferes with substrate binding. The other region apparently interacts with residues in the nucleotide-binding pocket to block ATP binding (GOLDBERG et al. 1996 ). Our results suggest that although Mei3 contains a pseudosubstrate motif, it is not sufficient for inhibition of Ran1. The SM1 mutation alters three basic residues in Mei3-RKDIII, a predicted pseudosubstrate sequence. In previous studies, it was shown that Mei3-RKDIII is homologous to two distinct regions (Ste11-RKDI and RKDII) in the Ste11 substrate for Ran1. In common with other pseudosubstrate inhibitory sequences, Mei3 functions as a substrate of Ran1 when Arg-81 (Mei3-RKDIII) is substituted with a serine residue (LI and MCLEOD 1996 ). The present study establishes that residues located within Mei3-RKDIII (SM1: Arg-77, Lys-78, and Arg-80) are critical for Mei3 function. The SM1 mutation diminishes the ability of mei3 to cause meiotic catastrophe in vivo, and the recombinant protein displays reduced ability to inhibit Ran1 in vitro. The results of two-hybrid studies indicate that the SM1 protein binds inefficiently to Ran1. Taken together, these results strongly support the conclusion that Mei3 associates with Ran1 by forming substrate-like interactions with the kinase. However, although Mei3 contains a pseudosubstrate sequence that is required for activity, the present study indicates that association between Ran1 and Mei3 is not sufficient to inhibit Ran1 kinase activity. One other region, defined by the SM8 mutation, is important for Mei3 activity in vivo and in vitro. The results of two-hybrid studies suggest that SM8 binds Ran1 as well as the wild-type protein. One interpretation of this result is that the region defined by SM8 is required to inhibit Ran1 using a mechanism distinct from binding to the substrate recognition site. For instance, the SM8 region may contribute to kinase inhibition by altering the affinity of Ran1 for ATP. Alternatively, residues defined by SM8 may be required for high-affinity binding of Mei3 to Ran1. We favor the former interpretation. The SM8 mutation does not alter the ability of Mei3 to associate with Ran1 in a two-hybrid interaction assay. Nevertheless, SM8 is an even weaker inhibitor of Ran1 substrate phosphorylation than SM1, which associates weakly with Ran1 in this assay.

Evidence that Mei3 and Ran1 are localized to the nucleus:
All evidence obtained to date supports the conclusion that inactivation of Ran1 by Mei3 leads to meiosis. However, Ran1 is highly regulated to control events that occur before meiosis, such as G₁ arrest and conjugation. One means of regulating kinase activity is to direct the cellular localization of the enzyme as a means of controlling access to inhibitors or substrates. We examined the localization of Ran1 and Mei3 in living cells using GFP fusions. These studies revealed that both Ran1 kinase and the Mei3 inhibitor are able to concentrate GFP to the nucleus of the cell. Ran1-GFP is excluded from the nucleolar region, perhaps indicating that Ran1 may be tethered to a specific region of the nucleus by an as yet undescribed anchoring protein. Notably, the appearance of Ran1-GFP in the nucleus is not altered, even in the absence of Mei2 or Ste11, both of which are substrates for Ran1 and are themselves found in the nucleus.

Mei3 is also highly enriched in the nucleus of the cell. In contrast with Ran1, Mei3 is not excluded from the nucleolus and may, in fact, be concentrated in the nucleolar compartment (W. WANG, unpublished observation). This observation raises the possibility that Mei3 has an as yet undescribed function independent of inhibition of Ran1. The nuclear localization of Mei3 is especially intriguing in comparison with that of the PKI pseudosubstrate inhibitor. Both Mei3 and PKI are small proteins, presumably able to diffuse in and out of the nucleus (NAKIENLY and DREYFUSS 1997 ). However, PKI contains a leucine-rich motif that excludes the polypeptide from the nucleus (WEN et al. 1995 ). Mei3 does not contain an obvious nuclear export signal and targets GFP to the nucleus. It will be of considerable interest to define the import and export machinery that regulates the localization of Mei3 and Ran1.

	FOOTNOTES

^* Present address: New York University Medical Center, New York, NY 10003.
Present address: Schering Plough Research Institute, Kenilworth, NJ 07033.

	ACKNOWLEDGMENTS

We thank Jeanne Hirsch for the green fluorescent probe. We are grateful to Hua Chen for providing soluble Ran1, and to Steve Elledge, Christopher Hellen, and Brehon Laurent for providing yeast strains and plasmids. This work was supported by an American Heart Award (New York City affiliate) and a National Science Foundation Career Advancement Award to M.M.

Manuscript received March 6, 1998; Accepted for publication July 24, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALFA, C., P. FANTES, J. HYAMS, M. MCLEOD and E. WARBRICK, 1993 Experiments with Fission Yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BAHLER, J., P. SCHUCHERT, C. GRIMM, and J. KOHLI, 1991  Synchronized meiosis and recombination in fission yeast: observations with pat1-114 diploid cells. Curr. Genet. 19:445-451[Medline].

BEACH, D., L. RODGERS, and J. GOULD, 1985  RAN1⁺ controls the transition from mitotic division to meiosis in fission yeast. Curr. Genet. 10:297-311[Medline].

BRESCH, C., G. MULLER, and R. EGEL, 1968  Genes involved in meiosis and sporulation of a yeast. Mol. Gen. Genet. 102:301-306[Medline].

CHALFIE, M., Y. TU, G. EUSKIRCHEN, W. W. WARD, and D. PRASHER, 1994  Green fluorescent protein as a marker for gene expression. Science 263:802-805[Abstract/Free Full Text].

CHENG, H. C., S. M. VAN PATTEN, A. J. SMITH, and D. WALSH, 1985  An active twenty-two-amino-acid residue peptide derived from the inhibitor protein of the cAMP-dependent protein kinase. Biochem. J. 105:655-661.

DAVEY, J. and O. NIELSEN, 1994  Mutations in cyr1 and pat1 reveal pheromone-induced G₁ arrest in the fission yeast Schizosaccharomyces pombe.. Curr. Genet. 121:105-112.

DEVOTI, J., G. SEYDOUX, D. BEACH, and M. MCLEOD, 1991  Interaction between ran1⁺ protein kinase and cAMP-dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J. 10:3759-3768[Medline].

DOOIJES, D., M. VAN DE WETERING, L. KNIPPELS, and H. CLEVERS, 1993  The Schizosaccharomyces pombe mating-type gene mat-M_c encodes a sequence-specific DNA-binding high mobility group box protein. J. Biol. Chem. 268:24813-24817[Abstract/Free Full Text].

EGEL, R., 1973  Commitment to meiosis in fission yeast. Mol. Gen. Genet. 121:277-284.

FIELD, J., J. I. NIKAWA, D. BROEK, B. MACDONALD, and L. RODGERS et al., 1988  Purification of a ras-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8:2159-2165[Abstract/Free Full Text].

FUKUDA, M., Y. GOTOH, and E. NISHIDA, 1997  Interaction of MAP kinase with MAP kinase kinase: its possible role in the control of nucleocytoplasmic transport of MAP kinase. EMBO J. 16:1901-1908[Medline].

GIBBS, C. S. and M. J. ZOLLER, 1991  Rational scanning mutagenesis of a protein kinase identifies functional regions involved in catalysis and substrate interactions. J. Biol. Chem. 266:8923-8931[Abstract/Free Full Text].

GOLDBERG, J., A. C. NAIRN, and J. KURIYAN, 1996  Structural basis for the autoinhibition of calcium/calmodulin-dependent protein kinase I. Cell 84:875-887[Medline].

HARPER, J. W., G. R. ADAMI, K. KEYOMARSI, and S. ELLEDGE, 1993  The p21 CDK-interacting protein is a potent inhibitor of G₁ cyclin-dependent kinases. Cell 75:805-816[Medline].

IINO, Y. and M. YAMAMOTO, 1985a  Mutants of Schizosaccharomyces pombe which sporulate in the haploid state. Mol. Gen. Genet. 198:416-421.

IINO, Y. and M. YAMAMOTO, 1985b  Negative control for the initiation of meiosis in Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 82:2447-2451[Abstract/Free Full Text].

KELLY, M., J. BURKE, M. SMITH, A. KLAR, and D. BEACH, 1988  Four mating-type genes control sexual differentiation in the fission yeast. EMBO J. 7:1537-1547[Medline].

KEMP, B. E. and R. B. PEARSON, 1991  Intrasteric regulation of protein kinases and phosphatases. Biochim. Biophys. Acta 1094:67-76[Medline].

KNIGHTON, D. R., J. ZHENG, L. F. TEN EYCK, V. A. ASHFORD, and N. H. XUONG et al., 1991a  Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science 253:407-414[Abstract/Free Full Text].

KNIGHTON, D. R., J. ZHENG, L. F. TEN EYCK, N. H. XUONG, and S. S. TAYLOR et al., 1991b  Structure of a peptide inhibitor bound to the catalytic subunit of cyclic adenosine phosphate dependent protein kinase. Science 253:414-420[Abstract/Free Full Text].

LI, B. and S. FIELDS, 1993  Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB J. 7:957-963[Abstract].

LI, P. and M. MCLEOD, 1996  Molecular mimicry in development: identification of ste11⁺ as a substrate and mei3⁺ as a pseudosubstrate inhibitor of ran1⁺ kinase. Cell 87:869-880[Medline].

MCLEOD, M. and D. BEACH, 1988  A specific inhibitor of the ran1⁺ protein kinase regulates entry into meiosis in Schizosaccharomyces pombe.. Nature 332:509-514[Medline].

MCLEOD, M., M. STEIN, and D. BEACH, 1987  The product of the mei3⁺ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast. EMBO J. 6:729-736[Medline].

NAKIENLY, S. and G. DREYFUSS, 1997  Nuclear import of proteins and RNA. Curr. Opin. Cell Biol. 9:420-429[Medline].

NIELSEN, O., 1993  Signal transduction during mating and meiosis in S. pombe.. Trends Cell Biol. 3:60-65.

NIELSEN, O. and R. EGEL, 1990  The pat1 protein kinase controls transcription of the mating-type genes in fission yeast. EMBO J. 9:1401-1406[Medline].

NURSE, P., 1985  Mutants of the fission yeast Schizosaccharomyces pombe which alter the shift between cell proliferation and sporulation. Mol. Gen. Genet. 198:497-502.

RUSSELL, R. P., 1983  Evolutionary divergence of the mRNA transcription initiation mechanism in yeast. Nature 301:167-169[Medline].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCOTT, J. D., E. H. FISCHER, J. D. DEMAILLE, and E. G. KREBS, 1985  Identification of an inhibitory region of the heat-stable protein inhibitor of the cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 82:4379-4383[Abstract/Free Full Text].

SMITH, M. C., T. C. FURMAN, T. D. INGOLIA, and C. PIDGEON, 1988  Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins. J. Biol. Chem. 263:7211-7214[Abstract/Free Full Text].

SUGIMOTO, A., Y. IINO, T. MAEDA, Y. WATANABE, and M. YAMAMOTO, 1991  Schizosaccharomyces pombe ste11⁺ encodes a transcription factor with an HMG motif that is a critical regulator of sexual development. Genes Dev. 5:1990-1999[Abstract/Free Full Text].

WATANABE, Y., S. SHINOZAKI-YABANA, Y. CHIKASHIGE, Y. HIRAOKA, and M. YAMAMOTO, 1997  Phosphorylation of RNA-binding protein controls cell cycle switch from mitotic to meiotic in fission yeast. Nature 386:187-190[Medline].

WEN, W., S. S. TAYLOR, and J. L. MEINKOTH, 1995  The expression and intracellular distribution of the heat-stable protein kinase inhibitor is cell cycle regulated. J. Biol. Chem. 270:2041-2046[Abstract/Free Full Text].

WILLER, M., L. HOFFMANN, U. STYRKARDOTTIR, R. EGEL, and J. DAVEY et al., 1995  Two-step activation of meiosis by the mat1 locus in Schizosaccharomyces pombe.. Mol. Cell. Biol. 15:4964-4970[Abstract].

This article has been cited by other articles:

				K. Tanabe, N. Ito, T. Wakuri, F. Ozoe, M. Umeda, S. Katayama, K. Tanaka, H. Matsuda, and M. Kawamukai Sla1, a Schizosaccharomyces pombe Homolog of the Human La Protein, Induces Ectopic Meiosis when Its C Terminus Is Truncated Eukaryot. Cell, December 1, 2003; 2(6): 1274 - 1287. [Abstract] [Full Text] [PDF]

				J. Qin, W. Kang, B. Leung, and M. McLeod Ste11p, a High-Mobility-Group Box DNA-Binding Protein, Undergoes Pheromone- and Nutrient-Regulated Nuclear-Cytoplasmic Shuttling Mol. Cell. Biol., May 1, 2003; 23(9): 3253 - 3264. [Abstract] [Full Text] [PDF]

				M. McLeod, B. Shor, A. Caporaso, W. Wang, H. Chen, and L. Hu Cpc2, a Fission Yeast Homologue of Mammalian RACK1 Protein, Interacts with Ran1 (Pat1) Kinase To Regulate Cell Cycle Progression and Meiotic Development Mol. Cell. Biol., June 1, 2000; 20(11): 4016 - 4027. [Abstract] [Full Text]