- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hamel, P.
- Articles by Dujardin, G.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hamel, P.
- Articles by Dujardin, G.
Mutations in the Membrane Anchor of Yeast Cytochrome c1 Compensate for the Absence of Oxa1p and Generate Carbonate-Extractable Forms of Cytochrome c1
Patrice Hamela, Claire Lemairea, Nathalie Bonnefoya, Paule Brivet-Chevillotteb, and Geneviève Dujardinaa Centre de Génétique Moléculaire du Centre National de la Recherche Scientifique, 91198 Gif-sur-Yvette Cedex, France
b Bioénergétique et Ingénierie des Protéines, Institut de Biologie Structurale et Microbiologie, Centre National de la Recherche Scientifique, 13402 Marseille Cedex 20, France
Corresponding author: Geneviève Dujardin, Centre de Génétique Moléculaire du C.N.R.S, Avenue de la terrasse, 91198 Gif-sur-Yvette Cedex, France., dujardin{at}cgm.cnrs-gif.fr (E-mail).
Communicating editor: K. J. NEWTON
| ABSTRACT |
|---|
Oxa1p is a mitochondrial inner membrane protein that is mainly required for the insertion/assembly of complex IV and ATP synthase and is functionally conserved in yeasts, humans, and plants. We have isolated several independent suppressors that compensate for the absence of Oxa1p. Molecular cloning and sequencing reveal that the suppressor mutations (CYT1-1 to -6) correspond to amino acid substitutions that are all located in the membrane anchor of cytochrome c1 and decrease the hydrophobicity of this anchor. Cytochrome c1 is a catalytic subunit of complex III, but the CYT1-1 mutation does not seem to affect the electron transfer activity. The double-mutant cyt1-1,164, which has a drastically reduced electron transfer activity, still retains the suppressor activity. Altogether, these results suggest that the suppressor function of cytochrome c1 is independent of its electron transfer activity. In addition to the membrane-bound cytochrome c1, carbonate-extractable forms accumulate in all the suppressor strains. We propose that these carbonate-extractable forms of cytochrome c1 are responsible for the suppressor function by preventing the degradation of the respiratory complex subunits that occur in the absence of Oxa1p.
IN mitochondria, five enzymatic complexes located within the inner membrane catalyze the oxidative phosphorylation. The respiratory complexes IIV transfer the electrons from NADH and succinate to oxygen; the complex V or ATP synthase utilizes the electrochemical gradient of protons generated by the electron flow to produce ATP. Complexes III (coenzyme QH2-cytochrome c reductase), IV (cytochrome c oxidase), and V each consist of 10 or more nonidentical subunits encoded by the mitochondrial or the nuclear genomes. The assembly of these oligomeric enzymes is an intricate process that also requires the action of assembly-assisting factors, also called chaperones, which are not intrinsic components of the complexes, but are required for their formation (see ![]()
![]()
![]()
![]()
Oxa1p, one of the assembly-assisting factors, appears particularly interesting because we have shown that its protein sequence is conserved between prokaryotes and eukaryotes and that it is functionally conserved in yeast, humans, and higher plants (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Interestingly, overexpression of the OXA1 gene suppresses respiratory defects associated with the single or double inactivation of RCA1 and AFG3 (![]()
![]()
![]()
![]()
![]()
![]()
In this article, we present the isolation, molecular cloning, and sequencing of five independent nuclear suppressor mutations that restore the insertion/assembly of both cytochrome c oxidase and ATPase in the absence of Oxa1p. The five suppressor mutations are all located in the membrane anchor of cytochrome c1, the catalytic subunit of complex III. However, we show that the suppressor function is independent of the electron transfer activity of cytochrome c1. As new carbonate-extractable forms of cytochrome c1 are detected in all the suppressors, we discuss the possible role of soluble forms of cytochrome c1 in preventing the degradation of subunits that occurs when the insertion/assembly of respiratory complexes is perturbed by the oxa1 inactivation.
| MATERIALS AND METHODS |
|---|
Media, strains, genetic methods and transformation:
Media used for Saccharomyces cerevisiae have been described in ![]()
![]()
![]()
|
Isolation of genetic suppressors:
Respiratory-competent revertants were selected from strains carrying an oxa1::LEU2 allele and either an intron-containing mitochondrial genome (NBT1) or an intron-free mitochondrial genome (NBT2; Table 1). Yeast cells were grown to late logarithmic phase, plated on glucose medium, and UV-irradiated in the dark for 520 sec at 254 nM. Irradiated plates were incubated for 3 days at 28°, and then replica-plated on glycerol medium. Among 3.1010 UV-mutagenized cells, six independent revertants able to grow on glycerol medium were selected.
Isolation of mitochondria and respiratory chain activities:
Yeast cells were grown on YPG medium and mitochondria were purified after disrupting cells either by the enzymatic method (![]()
![]()
![]()
![]()
![]()
![]()
Western blot of mitochondrial proteins:
Mitochondria were treated with sodium carbonate according to ![]()
![]()
Construction of a yeast genomic library from the suppressor strain R14:
A new plasmid allowing a positive selection of inserts was constructed from pON163 (![]()
Cloning and sequencing of the wild-type CYT1 and suppressor alleles:
YEpPH65 (see Figure 3) was cut by HpaI and self-ligated to give YEpPH66, which only carries the CYT1 gene. YEpPH66 was cut by BstEII and SwaI, gel purified, and used to transform the strains CW30, NBT2, R101, and R118 to uracile prototrophy. Gap-repaired plasmids were characterized by restriction analysis, and the C-terminal region of the CYT1 gene was sequenced. PCR amplification was also carried out on genomic DNA extracted from the five suppressors, and the amplification products were sequenced on both strands using the sequenase PCR product sequencing kit (United States Biochemical, Cleveland).
|
|
|
Construction of a CYT1-1 OXA1 strain:
A cyt1::LEU2 strain was constructed by introducing the 2.7-kb LEU2 fragment at the NsiI site internal to CYT1 gene. Molecular and genetic analyses were carried out as described in ![]()
Construction of a cytochrome c1 gene carrying both the CYT1-1 and the cyt1-164 mutations:
YEpPH219 and YEpPH220 are multicopy plasmids carrying either the CYT1 or the CYT1-1 cDNA. PCR mutagenesis was carried out using two oligonucleotides: O1 (5'GTGAAGTTTGTGCCGCCTG3') and the mutagenic oligonucleotide O5 (5'GCGGGGGTACCATCTTCGTACTCAACCATGTCATCAAACAAGACTCTTGCTTTGCAATGGAACC3') carrying the mutation CAT to CTT (M164 to K164). The PCR product was cut with AgeI and KpnI and cloned in AgeI/KpnI-digested plasmid YEpPH220 to give YEpPH221. We have shown by DNA sequencing that the resulting cytochrome c1 gene carried by YEpPH221 contains both mutations (K164 and K216).
| RESULTS |
|---|
Extragenic suppressors can compensate for the respiratory deficiency due to the inactivation of the OXA1 gene:
In the search for genetic interactions involving the OXA1 gene, both the two-hybrid and suppressor strategies could a priori be used. However it is well known that the two-hybrid system is difficult to utilize with highly hydrophobic membrane proteins such as Oxa1p. Thus, we decided to search for suppressor genes that were able to alleviate the respiratory defect of oxa1-null mutants. We were unable to isolate any multicopy suppressors, but six independent genetic suppressor strains were isolated and characterized further (see MATERIALS AND METHODS). The six suppressor mutations all correspond to extragenic dominant nuclear mutations. Recombination was never detected between suppressor mutations from R14, R18, R101, R118, and R121, suggesting that they are probably located in the same gene, whereas R102 is not allelic to the other five. The study of the first five suppressor strains was continued further. The suppressor strains R14 to R121 (see Table 1) show different levels of growth on respiratory substrates (Figure 1A and data not shown). All seemed to display a thermosensitive growth at 36° on nonfermentable medium, suggesting that they cannot replace Oxa1p at high temperatures. Cytoduction of an intron-less mitochondrial genome in the R14 and R18 nuclear backgrounds (and, reciprocally, cytoduction of an intron-containing mitochondrial genome in the R101, R118, and R121 nuclear backgrounds) showed that the compensatory effect is always much stronger in the absence rather than in the presence of mitochondrial introns (Figure 1A). We have previously shown that the major effect of the oxa1 inactivation occurs at a post-translational stage, but that it also leads to pleiotropic secondary defects in the accumulation of intron-containing mitochondrial RNA (![]()
The activities of both the cytochrome c oxidase and ATPase complexes are restored in the suppressor strains:
As we had previously shown that Oxa1p is necessary for the activities of the cytochrome c oxidase and ATPase complexes (![]()
As shown in Figure 1B, at least 80% of the oligomycin-sensitive ATPase activity and ~3050% of cytochrome c oxidase activity were restored in the different suppressor strains. Thus, the ATPase activity is restored to nearly wild-type level, whereas cytochrome c oxidase activity is only partially recovered. A partial restoration of the cytochrome aa3 spectrum was also observed in the suppressor strains (Figure 2A and data not shown), indicating that some heme aa3 is correctly assembled within the complex IV. The activity/heme aa3 ratio measured in mitochondria shows that the turnover of complex IV is unchanged, indicating that cytochrome c oxidase is fully active but present in lower amounts in the suppressor strains. Analysis of mitochondrial translation products by 35SO4 labeling shows that Cox1p, Cox2p, and Cox3p are translated at the same level as in the wild type and that the correct proteolytic cleavage of Cox2p is fully restored in the suppressor strains (Figure 2B and data not shown). However, an analysis of the steady-state level of these three subunits by immunoblotting shows that Cox2p, which is not detectable in the oxa1::LEU2 mutant, is present in lower than wild-type amounts in the suppressor strains (Figure 2C). The same observation was made for Cox1p and Cox3p (data not shown). As a control, the nuclear-encoded subunit Cox6p, which is only slightly affected by the oxa1::LEU2 mutation, was used; Cox6p is present in normal amounts in the suppressor strains. Thus, a fully active cytochrome c oxidase complex, with a correctly matured Cox2p, is present in the suppressors but at lower levels than in the wild type, and the ATPase complex is fully active in the suppressor strains. Thus, the suppressor mutations are able to compensate for both the cytochrome c oxidase and the ATPase activity defects due to the absence of Oxa1p.
Because the suppressors compensate for both the cytochrome c oxidase and the ATPase activity defects, we have asked whether the restoration of ATPase activity could occur independently of that of cytochrome c oxidase. We have constructed a suppressor strain R14/G481 carrying the mitochondrial mutation cox1-G481. This mutation, located in the gene coding for subunit 1 of the cytochrome c oxidase gene, results in a lack of heme aa3 and cytochrome c oxidase activity consequent to the absence of the Cox1p subunit, but does not impair oligomycin-sensitive ATPase activity (![]()
The suppressor mutations are all located in the membrane anchor of cytochrome c1:
To identify the suppressor gene, we have constructed a genomic library from the suppressor strain R14 in a shuttle yeast E. coli vector, allowing a positive selection of recombinant plasmids (see MATERIALS AND METHODS). The oxa1::LEU2 strain was transformed with this library, and two respiratory-competent transformants were obtained. From these, two different recombinant plasmids, named YEpPH65 and YEpPH622, containing overlapping inserts, were isolated. YEpPH65 contains a 11.2-kb HindIII fragment with one internal HindIII site (Figure 3), while YEp-PH622 carries a larger insert that includes all the YEpPH65 insert. The cloned fragment was located on the yeast chromosomes by sequencing the two extremities of the YEpPH65 insert. Comparison to the yeast genome sequence revealed that we had cloned a fragment from chromosome XV, encompassing six open reading frames (ORFs). By deleting either the 9.5-kb HpaI or the 9.8-kb HpaI/SwaI restriction fragment from YEpPH65, we could restrict the region responsible for the suppression to the 1.3-kb HindIII/SwaI fragment with an internal HindIII site. This region contains the CYT1 gene that encodes the cytochrome c1, a catalytic subunit of complex III of the respiratory chain. The 1.3-kb fragment includes a truncated form of the CYT1 promoter, the open reading frame, and 23 bases following the stop codon.
The fragment carrying the suppressor function was sequenced and compared to the sequence of the CYT1 gene present in the control wild-type strains. Two nucleotide substitutions (TTA to AAA) were found at positions 831 and 832, corresponding to codon 216 of the CYT1 ORF, changing a leucine into a lysine residue (Figure 3). The wild-type sequence was in agreement with the sequence published by ![]()
We have cloned the other suppressor alleles by gap repair (see MATERIALS AND METHODS). Gap-repaired plasmids, as well as PCR amplification of genomic DNA, were used to sequence the suppressor mutations. All of the suppressor mutations occur in the same C-terminal domain of Cyt1p, and the same amino acid substitution is found in R14 and R101 that was isolated from two different oxa1::LEU2 strains (Figure 3). This C-terminal domain is highly hydrophobic, depicted as an
-helix in the wild type, and constitutes the anchor of cytochrome c1 in the mitochondrial inner membrane (for review see ![]()
![]()
![]()
Comparison of the amino acid sequences of cytochrome c1 from yeast and other eukaryotes (Figure 3C) shows that the membrane anchor is conserved and always highly hydrophobic. All of the suppressor mutations appear to decrease the hydrophobicity of the cytochrome c1 anchor. CYT1-1 and CYT1-2 replace a leucine residue with a lysine residue at positions 216 (L216K) and 219 (L219K), respectively. CYT1-3 mutation is due to the substitution of a leucine by an asparagine (L219N) and to the deletion of the adjacent tyrosine, leading to a shorter and less hydrophobic anchor. CYT1-4 carries three substitutions, T212K, V213M, and L216S. Such multiple mutation events are often observed at or near the sites of dimers with UV mutagenesis in the dark, particularly in A/T-rich regions. The three mutations detected in the CYT1-4 allele are located in such an A/T-rich region. The V213M substitution is probably silent because there is a methionine at this position in the yeast Kluyveromyces lactis. The substitution T212K replaces a neutral residue with a hydrophilic one, and substitution L216S replaces a hydrophobic residue with a neutral one. Finally, the CYT1-5 and CYT1-6 mutations were subsequently isolated from an oxa1::URA3 mutant: CYT1-5 replaces the leucine 216 with an arginine (L216R), and CYT1-6 corresponds to the deletion of the isoleucine 215. Both mutations also diminish the hydrophobicity of the anchor.
Carbonate-extractable forms of cytochrome c1 are present in the suppressor strains:
The fact that the suppressor activity is due to various amino acid substitutions all leading to a decrease in the hydrophobicity of the anchor domain suggests that these substitutions could modify the binding of cytochrome c1 to the membrane. A priori, two methods of fractionation, osmotic swelling and carbonate extraction, could be used to separate membrane and soluble proteins. However, it is known that upon osmotic swelling, the soluble cytochrome c stays mainly associated with the membrane through electrostatic interactions. In contrast, cytochrome c is well extracted by carbonate treatment, so we used this technique to study the binding of cytochrome c1 to the membrane in the various suppressor strains. As expected from previous work (![]()
|
The suppressor mutation CYT1-1 does not affect complexes II and III maximal activities:
Cytochrome c1 is a catalytic subunit essential for electron transfer between complex III and cytochrome c. To determine whether the suppressor mutation located in the membrane anchor of cytochrome c1 affects the activity of complex III, we constructed a strain carrying the mutation CYT1-1 in an OXA1 context (PHT31, see Table 1 and MATERIALS AND METHODS). This strain is respiratory competent, exhibits a complex III maximal activity, and cytochrome spectra similar to that of wild-type CYT1 strain (see Figure 5A and Figure B). Measurements of heme b content in mitochondria showed that the turnover of complex III is also unaffected, although a slight modification of the kinetic interaction between cytochrome c and complex III cannot presently be ruled out. ![]()
|
Carbonate extraction of CYT1-1 mitochondria (Figure 5C) reveals that all the cytochrome c1 is found in the pellet, suggesting that the cytochrome c1 insertion is not modified by the CYT1-1 mutation in a wild-type OXA1 genetic background. Thus, the carbonate-extractable forms are only detected when suppressor mutations are associated to the oxa1::LEU2 inactivation.
Suppressor function is independent of the electron transfer activity:
To directly test the relationship between the suppressor and the electron transfer activity of cytochrome c1, we have constructed a CYT1 gene carrying both the suppressor mutation CYT1-1 and the mutation cyt1-M164K (see MATERIALS AND METHODS). The M164K mutation was chosen because it drastically decreases the complex II plus III activity without blocking cytochrome c1 assembly in complex III (![]()
|
| DISCUSSION |
|---|
Oxa1p is a mitochondrial inner membrane protein that is required for the insertion/assembly of the respiratory complexes. Oxa1p seems to be present in all aerobic organisms, and we have shown here that in yeast, it is possible to isolate suppressors which compensate for the absence of Oxa1p at 28°. In the suppressor strains, the oligomycin-sensitive ATPase activity is fully restored and there is a partial recovery of cytochrome c oxidase activity. Turnover measurements and steady-state levels of mitochondrial subunits show that the assembled complex IV is fully active but present in reduced amounts within the membranes. We have cloned the suppressor gene and shown that it corresponds to CYT1 that encodes cytochrome c1.
Cytochrome c1 is a catalytic subunit of complex III, it transfers the electrons from complex III to cytochrome c and is conserved in bacterial and eukaryotic systems. The protein has a bipartite structure with a large N-terminal hydrophilic domain (often called the soluble domain) that is located in the intermembrane space and binds the heme c1 and a short C-terminal domain composed of a stretch of hydrophobic amino acids, responsible for the binding to the mitochondrial inner membrane (![]()
![]()
![]()
![]()
![]()
![]()
It has been shown that oxa1 mutants in vivo affect the insertion/assembly of complexes IV and V and to a lesser extent of complex III, and that proteolysis occurs leading to the degradation of the mitochondrial subunits of complex IV (![]()
![]()
![]()
![]()
![]()
These new carbonate-extractable forms of cytochrome c1 are probably catalytically inactive as the association to the membrane is essential for electron transfer (![]()
![]()
![]()
![]()
|
Although further biochemical experiments will be necessary to determine if the carbonate-extractable forms of cytochrome c1 are directly responsible for the suppression by interacting with complex IV, several results favor this model. First, in a preliminary experiment, we have detected carbonate-extractable forms of cytochrome c1 in the suppressor R102 that is not allelic to CYT1 (data not shown). Second, we have shown that in the strain R14/G481 carrying the oxa1 null, the suppressor CYT1-1, and the cox1-G481 mutations, and thus displaying no active complex IV, no restoration of the ATPase activity is observed (Figure 1B), although carbonate-extractable forms of cytochrome c1 are still present (data not shown). This suggests that complex IV is also required for the suppression. Third, ![]()
![]()
Finally, both OXA1 and CYT1 are conserved through evolution, and we have cloned and inactivated the Schizosaccharomyces pombe homolog of OXA1 (N. BONNEFOY, unpublished results). Interestingly, the S. cerevisiae CYT1-1 suppressor is also able to suppress the inactivation of the OXA1 homolog in S. pombe. The fact that the suppressor can be exchanged between these two yeasts that are highly diverged suggests that the intricate relationships existing between insertion, assembly, and stability of the respiratory complex subunits are conserved through evolution.
| ACKNOWLEDGMENTS |
|---|
We are grateful to Professor P. P. Slonimski for his constant interest and to Dr. C. J. Herbert for stimulating discussions, critical reading of the manuscript, and for looking over the English. We thank Pr. T. Fox and E. Petrochilo for the gift of strains and plasmids, Dr. D. Lemesle-Meunier for fruitful discussions and advice in the measurements of enzymatic activities, Dr. O. Groudinsky for critical reading of the manuscript, M. Kermorgant and P. Tron for technical assistance, and the students C. Torchet, F. Nourrit, J.-C. Rain, E. Lerat, C. Germain, and C. Tendeng for their contribution to this work. P.H. was supported by a Ministère de l'Education Nationale de l'Enseignement Superieur, de la Recherche et de l'Insertion Professionnelle (MENRT) grant. This work was supported by grants from the Association Française contre les Myopathies.
Manuscript received December 30, 1997; Accepted for publication July 1, 1998.
| LITERATURE CITED |
|---|
ALTAMURA, N., N. CAPITANIO, N. BONNEFOY, S. PAPA, and G. DUJARDIN, 1996 The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase. FEBS lett. 382:111-115[Medline].
ARTL, H., R. TAUER, H. FELDMANN, W. NEUPERT, and T. LANGER, 1996 The YTA10-12 complex, an AAA protease with chaperon-like activity in the inner membrane of mitochondria. Cell 85:875-885[Medline].
BAUER, M., M. BEHRENS, K. ESSER, G. MICHAELIS, and E. PRATJE, 1994 PET1402, a nuclear gene required for proteolytic processing of cytochrome oxidase subunit 2 in yeast. Mol. Gen. Genet. 245:272-278[Medline].
BONNEFOY, N., F. CHALVET, P. HAMEL, P. P. SLONIMSKI, and G. DUJARDIN, 1994a OXA1 a Saccharomyces cerevisiae nuclear gene, whose sequence is conserved in prokaryotes and eukaryotes, controls cytochrome c oxidase biogenesis. J. Mol. Biol. 239:201-212[Medline].
BONNEFOY, N., M. KERMORGANT, O. GROUDINSKY, M. MINET, and P. P. SLONIMSKI et al., 1994b Cloning of a novel human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 91:11978-11982
BRASSEUR, G., J. Y. COPPEE, A. M. COLSON, and P. BRIVET-CHEVILLOTTE, 1995 Structure-function relationships of the mitochondrial bc1 complex in temperature-sensitive mutants of the cytochrome b gene, impaired in the catalytic center N. J. Biol. Chem. 270:29356-29364
BRUEL, C., R. BRASSEUR, and B. L. TRUMPOWER, 1996 Subunit 8 of the Saccharomyces cerevisiae cytochrome bc1 complex interacts with succinate-ubiquinone reductase complex. J. Bioenerg. Biomembr. 28:59-68[Medline].
DUJARDIN, G., P. PAJOT, O. GROUDINSKY, and P. P. SLONIMSKI, 1980 Long range control circuits whithin mitochondria and between nucleus and mitochondria. I. Methodology and phenomenology of suppressors. Mol. Gen. Genet. 179:469-482[Medline].
DUTTA, C. and H. L. HENRY, 1990 Detection of hemoprotein peroxidase activity on polyvinylidene difluoride membrane. Anal. Biochem. 184:96-99[Medline].
GRIVELL, L. A., 1995 Nucleo-mitochondrial interactions in mitochondrial gene expression. Crit. Rev. Biochem. Mol. Biol. 30:121-164[Medline].
HAMEL, P., W. SAKAMOTO, H. WINTZ, and G. DUJARDIN, 1997 Functional complementation of an oxa1- yeast mutation identifies an Arabidopsis thaliana cDNA involved in the assembly of respiratory complexes. Plant J. 12:101-109.
HASE, T., M. HARABAYASHI, K. KAWAI, and H. MATSUBARA, 1987a Expression of modified cytochrome c1 genes and restoration of the respiratory function in a yeast mutant lacking the nuclear cytochrome c1 gene. J. Biochem. 102:401-410
HASE, T., M. HARABAYASHI, K. KAWAI, and H. MATSUBARA, 1987b A carboxyl-terminal hydrophobic region of yeast cytochrome c1 is necessary for functionnal assembly into complex III of the respiratory chain. J. Biochem. 102:411-419
HE, S. and T. D. FOX, 1997 Membrane translocation of mitochondrially coded Cox2p: distinct requirements for export of N and C termini and dependence on the conserved protein Oxa1p. Mol. Biol. Cell 8:1449-1460[Abstract].
HELL, K., J. HERRMAN, E. PRATJE, W. NEUPERT, and R. A. STUART, 1997 Oxa1p mediates the export of the N- and C- termini of pCoxII from the mitochondrial matrix to the intermembrane space. FEBS Lett. 418:367-370[Medline].
HELL, K., J. HERRMAN, E. PRATJE, W. NEUPERT, and R. A. STUART, 1998 Oxa1p, an essential component of the N-tail export machinery in mitochondria. Proc. Natl. Acad. Sci. USA 95:2250-2255
HERRMANN, J. M., W. NEUPERT, and R. A. STUART, 1997 Insertion into the mitochondrial inner membrane of a polytopic protein, the nuclear-encoded Oxa1p. EMBO J. 16:2217-2226[Medline].
KERMORGANT, M., N. BONNEFOY, and G. DUJARDIN, 1997 Oxa1p, which is required for cytochrome c oxidase and ATP synthase complex formation, is embedded in the mitochondrial inner membrane. Curr. Genet. 31:302-307[Medline].
KONISHI, K., S. R. VAN DOREN, D. M. KRAMER, and A. R. CROFTS et al., 1991 Preparation and characterization of the water-soluble heme-binding domain of cytochrome c1 from Rhodobacter sphaeroides bc1 complex. J. Biol. Chem. 266:14270-14276
LI, Y., K. LEONARD, and H. WEISS, 1981 Membrane-bound and water-soluble cytochrome c1 from Neurospora crassa. Eur. J. Biochem. 116:199-205[Medline].
MEYER, W., M. BAUER, and E. PRATJE, 1997a A mutation in cytochrome oxidase subunit 2 restores respiration of the mutant pet ts1402. Curr. Genet. 31:401-407[Medline].
MEYER, W., U. BOMER, and E. PRATJE, 1997b Mitochondrial inner membrane bound PET1402 protein is rapidly imported into mitochondria and affects the integrity of the cytochrome oxidase and ubiquinol-cytochrome c oxidoreductase complexes. Biol. Chem. 378:1373-1379[Medline].
NAKAI, M., H. ISHIWATARI, A. ASADA, M. BOGAKI, and K. KAWAI et al., 1990 Replacement of putative axial ligands of heme iron in yeast cytochrome c1 by site-directed mutagenesis. J. Biochem. 108:798-803
PAJOT, P., M. WAMBIER-KLUPPEL, Z. KOTYLAK and P. SLONIMSKI, 1976 Regulation of cytochrome oxidase formation by mutations in a mitochondrial gene for cytochrome b, pp. 443451 in Genetics and Biogenesis of Chloroplasts and Mitochondria. Elsevier, North Holland Biomedical Press, Amsterdam.
PEARCE, D. A. and F. SHERMAN, 1995a Diminished degradation of yeast cytochrome c by interactions with its physiological partners. Proc. Natl. Acad. Sci. USA 92:3735-3739
PEARCE, D. A. and F. SHERMAN, 1995b Degradation of cytochrome oxidase subunits in mutants of yeast lacking cytochrome c and suppression of the degradation by mutation of yme1. J. Biol. Chem. 270:20879-20882
PULLMAN, M., H. PENEFSKY, A. DATTA, and E. RACKER, 1960 Partial resolution of the enzyme catalyzing oxidative phosphorylation. I. Purification and properties of soluble, dinitrophenol-stimulated adenosine triphosphatase. J. Biol. Chem. 235:3322-3329
QIU, Z. H., L. YU, and C. A. YU, 1992 Spin-label electron paramagnetic resonance and differential scanning calorimetry studies of the interactions between mitochondrial cytochrome c oxidase and adenosine triphosphate synthase complex. Biochemistry 31:3297-3302[Medline].
REP, M., J. NOOY, E. GUELIN, and L. A. GRIVELL, 1996a Three genes for mitochondrial proteins suppress null-mutations in both Afg3 and Rca1 when over-expressed. Curr. Genet. 30:206-211[Medline].
REP, M. and L. A. GRIVELL, 1996b The role of protein degradation in mitochondrial function and biogenesis. Curr. Genet. 30:367-381[Medline].
SADLER, I., S. KITARU, G. SCHATZ, F. KAUDEWITZ, and A. HAID, 1984 Sequencing of the nuclear gene for the yeast cytochrome c1 precursor reveals an unusually complex amino terminal sequence. EMBO J. 3:2137-2143[Medline].
SUZUKI, C. K., M. REP, J. MAARTEEN VAN DIJL, K. SUDA, and L. A. GRIVELLL et al., 1997 ATP-dependent proteases that also chaperone protein biogenesis. Trends Biochem. Sci. 22:118-123[Medline].
THORNESS, P. E., K. H. WHITE, and T. D. FOX, 1993 Inactivation of YME1, a member of the ftsH-SEC18-PAS1-CDC48 family of putative ATPase-encoding genes, causes increased escape of DNA from mitochondria in Saccharomyces cerevisiae. Mol. Cell. Biol. 13:5418-5426
TRUMPOWER, B. L., 1990 Cytochrome bc1 complexes of microorganisms. Microbiol. Rev. 54:101-129
TZAGOLOFF, A., J. YUE, J. JANG, and M.-F. PAUL, 1994 A new member of a family of ATPase is essential for assembly of mitochondrial respiratory chain and ATP synthetase complexes in Saccharomyces cerevisiae. J. Biol. Chem. 269:26144-26151
VARGAS, C., A. G. MCEWAN, and J. A. DOWNIE, 1993 Detection of c-type cytochromes using enhanced chemiluminescence. Anal. Biochem. 209:323-326[Medline].
WEILGUNY, D., M. PRAETORIUS, A. CARR, R. EGEL, and O. NIELSEN, 1991 New vectors in fission yeast: application for cloning the his2 gene. Gene 99:47-54[Medline].
XIA, D., C. A. YU, H. KIM, J. Z. XIA, and A. M. KACHURIN et al., 1997 Crystal structure of the cytochrome bc1 complex from bovine heart mitochondria. Science 277:60-66
ZHANG, Z., L. HUANG, V. M. SHULMEISTER, Y. CHI, and K. K. KIM et al., 1998 Electron transfer by domain movement in cytochrome bc1. Nature 392:677-684[Medline].
This article has been cited by other articles:
![]() |
C. Nouet, M. Bourens, O. Hlavacek, S. Marsy, C. Lemaire, and G. Dujardin Rmd9p Controls the Processing/Stability of Mitochondrial mRNAs and Its Overexpression Compensates for a Partial Deficiency of Oxa1p in Saccharomyces cerevisiae Genetics, March 1, 2007; 175(3): 1105 - 1115. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Bernard, S. Quevillon-Cheruel, S. Merchant, B. Guiard, and P. P. Hamel Cyc2p, a Membrane-bound Flavoprotein Involved in the Maturation of Mitochondrial c-Type Cytochromes J. Biol. Chem., December 2, 2005; 280(48): 39852 - 39859. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Sellem, C. Lemaire, S. Lorin, G. Dujardin, and A. Sainsard-Chanet Interaction Between the oxa1 and rmp1 Genes Modulates Respiratory Complex Assembly and Life Span in Podospora anserina Genetics, March 1, 2005; 169(3): 1379 - 1389. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Williams, N. Bsat, N. Bonnefoy, C. A. Butler, and T. D. Fox Alteration of a Novel Dispensable Mitochondrial Ribosomal Small-Subunit Protein, Rsm28p, Allows Translation of Defective COX2 mRNAs Eukaryot. Cell, February 1, 2005; 4(2): 337 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lemaire, F. Guibet-Grandmougin, D. Angles, G. Dujardin, and N. Bonnefoy A Yeast Mitochondrial Membrane Methyltransferase-like Protein Can Compensate for oxa1 Mutations J. Biol. Chem., November 12, 2004; 279(46): 47464 - 47472. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Bernard, S. T. Gabilly, G. Dujardin, S. Merchant, and P. P. Hamel Overlapping Specificities of the Mitochondrial Cytochrome c and c1 Heme Lyases J. Biol. Chem., December 12, 2003; 278(50): 49732 - 49742. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Saint-Georges, N. Bonnefoy, J. P. di Rago, S. Chiron, and G. Dujardin A Pathogenic Cytochrome b Mutation Reveals New Interactions between Subunits of the Mitochondrial bc1 Complex J. Biol. Chem., December 13, 2002; 277(51): 49397 - 49402. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang and W. S. Moye-Rowley Saccharomyces cerevisiae Multidrug Resistance Gene Expression Inversely Correlates with the Status of the F0 Component of the Mitochondrial ATPase J. Biol. Chem., December 14, 2001; 276(51): 47844 - 47852. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Saint-Georges, P. Hamel, C. Lemaire, and G. Dujardin Role of positively charged transmembrane segments in the insertion and assembly of mitochondrial inner-membrane proteins PNAS, November 20, 2001; 98(24): 13814 - 13819. [Abstract] [Full Text] |











