- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hamada, M.
- Articles by Okada, N.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hamada, M.
- Articles by Okada, N.
Detection of the Ongoing Sorting of Ancestrally Polymorphic SINEs Toward Fixation or Loss in Populations of Two Species of Charr During Speciation
Mitsuhiro Hamadaa, Nobuyoshi Takasakia, James D. Reistb, Alfred L. DeCiccoc, Akira Gotod, and Norihiro Okadaaa Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, Midori-ku, Yokohama 226-8501, Japan,
b Department of Fisheries and Oceans Canada, Winnipeg, Manitoba R3T 2N6, Canada,
c Alaska Department of Fish and Game, Fairbanks, Alaska 98701
d Laboratory of Embryology and Genetics, Faculty of Fisheries, Hokkaido University, Hakodate 041-8611, Japan
Corresponding author: Norihiro Okada, Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama 226-8501, Japan., nokada{at}bio.titech.ac.jp (E-mail).
Communicating editor: N. TAKAHATA
| ABSTRACT |
|---|
The FokI family of short interspersed repetitive elements (SINEs) has been found only in the genomes of charr fishes (genus Salvelinus). In an analysis of the insertion of FokI SINEs using PCR, we characterized six loci at which FokI SINEs have been inserted into the genomes of Salvelinus alpinus (Arctic charr) and/or S. malma (Dolly Varden). An analysis of one locus (Fok-223) suggested that a sister relationship exists between S. alpinus and S. malma and the SINE at this locus might have been inserted in a common ancestor of these two species, being fixed in all extant populations examined. By contrast, SINEs at two other loci (Fok-211 and Fok-206) were present specifically in the genome of S. alpinus, with polymorphism among populations of this species. Moreover, the presence or absence of the SINEs of the other three loci (Fok-214, Fok-217, and Fok-600) varied among populations of these two species. The most plausible interpretation of this result is that SINEs, which were ancestrally polymorphic in the genome of a common ancestor of these two species, are involved in an ongoing process of differential sorting and subsequent fixation in the various populations of each species.
A retroposon is defined as a nucleotide sequence, present initially as a cellular RNA transcript, that has been reincorporated into the genome via a cDNA intermediate. This process is called retroposition (![]()
![]()
![]()
![]()
![]()
![]()
SINEs can be divided into two classes according to their origins. One class of SINEs is derived from the 7SL RNA (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
It is generally accepted that, in contrast to DNA transposable elements, a single unit of a SINE is never subsequently excised precisely except in cases of gross deletions. Moreover, it is believed that the insertion sites of SINE units are almost random (![]()
![]()
![]()
![]()
![]()
SINE insertion analysis is also useful for the studies of structures of populations of a species. In cases where SINEs were retroposed recently on an evolutionary time scale, they have not yet been fixed in populations of the species. For example, several Alu elements that were amplified recently have not yet been fixed within the human genome, and the distribution of these elements varies among geographically distinct groups of the world's population (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In a previous study, we characterized three different families of SINEs in the genomes of salmonid fishes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Charr species have attracted the interest of many evolutionary biologists because of their highly variable life-history strategies, phenotypic plasticity, and potential for sympatric morphological divergence. ![]()
![]()
![]()
![]()
![]()
S. alpinus and S. malma are recognized as distinct species (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
To elucidate the complex structure of populations of these two species, we attempted to analyze the insertions of FokI SINEs in S. alpinus and S. malma. As is the case for the SmaI SINEs in the genome of O. keta (![]()
| MATERIALS AND METHODS |
|---|
DNA samples:
Individuals from each of the six species of charr from various locations were examined, as shown in Table 1. Total genomic DNA of each species was extracted as described by ![]()
|
Construction and screening of genomic libraries, subcloning and sequencing:
Total genomic DNA from S. alpinus and S. malma was separately digested with EcoRI for construction of a genomic library for each species. Digests were size-fractionated by sucrose gradient (10 to 40%, w/v) centrifugation. DNA fragments of 2 to 4 kb were ligated with
gt10 arms (Stratagene, La Jolla, CA) and then packaged in vitro. Screening was performed with an end-labeled oligonucleotide, designated FokI (see positions 2040 in Figure 1), as the probe. Hybridization was allowed to proceed at 42° overnight in a solution of 6x SSC (SSC is 0.15 M NaCl, 0.015 M trisodium citrate, pH 7), 1% (w/v) SDS, 5x Denhardt's reagent [1x Denhardt's reagent is 0.02% (w/v) Ficoll 400, 0.02% (w/v) polyvinylpyrrolidone, and 0.02% (w/v) bovine serum albumin], and 100 µg/ml herring sperm DNA. Washing was performed in 2x SSC plus 1% SDS at 50° for 30 min. Positive phage clones were isolated and their inserts were subcloned into pUC18 or pUC19. Then the inserts were sequenced with primers that corresponded to or were complementary to the consensus sequence for the FokI family.
|
Amplification by PCR:
When a unit of the FokI family appeared to have been integrated at a single locus within a genome, we synthesized 5' and 3' oligonucleotide primers (Oligo1000 DNA synthesizer; Beckman, Fullerton, CA). The sequences of primers are shown in Figure 2. The reaction mixtures for amplification by PCR contained Tth buffer (TOYOBO, Tokyo, Japan), 0.2 mM dNTPs (Pharmacia, Uppsala, Sweden), 100 ng of each primer, 1 µg of genomic DNA, and 2 units of Tth DNA polymerase (TOYOBO) in a final volume of 100 µl or 50 µl. The thermal cycling involved 30 repeats of denaturation at 93° for 1 min, annealing at 55° for 1 min, and extension at 72° for 1 min. The products of PCR were analyzed by electophoresis in 2% (w/v) NuSieve GTG and 1% (w/v) Seakem GTG agarose gels (FMC BioProducts, Rockland, ME).
|
Southern hybridization:
Products of PCR were transferred from gels to GeneScreen Plus membranes (New England Nuclear Research Products, Boston) in 0.4 M NaOH and 0.6 M NaCl and then dried. For detection of a SINE unit of the FokI family, hybridization was performed with the Fok1 oligonucleotide as the probe, as described above and under the same conditions as those used for screening. For detection of orthologous loci of Fok-217, an end-labeled oligonucleotide that contained the flanking sequences of the SINE unit at that locus was used as a probe (Fok-217 flan: AGCCCTGCAGTTGCAGACGGTGCAGTTGCT). For subsequent rehybridization with a different probe, the first probe was removed by incubation in 0.4 M NaOH at 42° for 30 min.
| RESULTS |
|---|
Characterization of FokI SINEs in the genus Salvelinus:
Previous studies in our laboratory showed that the charr FokI family of SINEs appeared to be restricted to species in the genus Salvelinus, such as S. malma, S. leucomaenis leucomaenis, S. leucomaenis pluvius, and S. namaycush. This family of SINEs was presumed to have been amplified at the time at which the genus Salvelinus diverged from other genera (![]()
We constructed genomic libraries for S. alpinus from Overvatn Salangen and S. malma from Montana Creek and screened them for FokI SINEs. Five clones that contained the sequence of a FokI SINE were isolated from the genomic library of S. alpinus and they were designated Fok-(SA) 206, Fok-(SA) 211, Fok-(SA) 214, Fok-(SA) 217, and Fok-(SA) 223 (SA stands for S. alpinus). One clone was isolated from the genomic library of S. malma; it was designated Fok-(SM) 600 (SM stands for S. malma). An alignment of the SINE sequences of these clones, together with those obtained from a genomic library of S. leucomaenis leucomaenis (![]()
![]()
![]()
![]()
![]()
![]()
To estimate the times of insertion of the FokI SINEs, we performed an analysis by PCR. We determined the 5'- and 3'-flanking regions of each FokI sequence and synthesized a set of primers that flanked each unit, as shown in Figure 2. We then performed PCR using genomic DNA from S. alpinus, S. malma, S. leucomaenis, S. confluentus, S. namaycush, and S. fontinalis as templates.
As shown in Figure 3, a SINE at the Fok-206 and Fok-211 loci was found specifically in the genome of S. alpinus (Figure 3A and Figure B). We also found that a SINE at another locus, namely Fok-600, was specific to S. malma (Figure 3F). SINEs at three other loci, namely, Fok-214, Fok-217, and Fok-223, were found in the genomes of both S. alpinus and S. malma (Figure 3, CE). In Figure 3A–F, the upper DNA fragments (black arrowheads) indicate the presence of a FokI SINE, while the lower DNA fragments (white arrowheads) indicate the absence of such SINEs. To confirm that orthologous loci have been faithfully amplified in these cases, we determined the sequences of the orthologous loci, which do not contain a SINE unit, of S. malma (Fok-206 and Fok-211) and S. leucomaenis (Fok-214, Fok-217, Fok-223, and Fok-600; Figure 2).
|
To examine whether these species-specific insertions and the group-specific insertions of FokI SINEs were fixed or dimorphic in other populations, we analyzed DNA from 59 specimens of S. alpinus from 5 regions and 95 specimens of S. malma from 12 regions. The results are summarized in Table 2.
|
The FokI SINEs specific to S. alpinus are dimorphic among populations of this species:
At the Fok-206 and Fok-211 loci, the FokI SINEs were not fixed among populations of S. alpinus (Table 2). For example, Figure 4 shows the results of PCR for the Fok-206 locus with specimens of S. alpinus from various populations. Individuals were scored as homozygous (+/+ or -/-) or heterozygous (+/-) for the presence of the 400-bp fragment (+) or the 238-bp fragment (-). The insertions were fixed in individuals from Maine in the United States, whereas, in the specimens from Loch Garry, Scotland, one individual was homozygous (+/+), three individuals were heterozygous (+/-), and five individuals were homozygous (-/-). Moreover, two specimens from Lake Inari, Finland, were homozygous (+/+) and five were heterozygous (+/-). No insertions were observed in the specimens from Lake 103 in the western Arctic of Canada and from Lake Hazen in the eastern Arctic of Canada.
|
As summarized in Table 2, in the case of the Fok-211 locus, insertion of a FokI SINE was only detected, with a heterozygous pattern (+/-), in the genomes of specimens of S. alpinus from Lake Inari, suggesting that the SINE was inserted very recently at this locus in an individual in this population or a closely related population. All specimens of S. malma from all populations had no insertion at either locus.
S. alpinus and S. malma form a monophyletic group:
We next examined whether the FokI SINEs that have been found to be commonly inserted into the genomes of S. alpinus and S. malma in the pilot experiment (Fok-214, Fok-217, and Fok-223; Figure 3) were fixed among populations of both species.
A SINE at the Fok-223 locus was fixed in every specimen from 17 populations examined (Table 2). Although we cannot exclude the possibility that, in the other remaining populations of both species, the SINE at this locus is dimorphic, the present results favor the conclusion that the SINE at this locus is fixed in all individuals of both species. This locus provides the first evidence, from SINE insertion analysis, that S. alpinus and S. malma form a monophyletic group.
The FokI SINEs common to S. alpinus and S. malma are not fixed among populations of the two species:
In the case of Fok-217 (Figure 5), insertion of the SINE in S. malma was observed only in a few populations, namely, those of the Klutina River/Lake and the Firth River [ Figure 5A(a)], whereas insertion of the SINE in S. alpinus was observed in every population except for that in Lake Hazen [ Figure 5B(a)]. In the case of Fok-214, insertion of the SINE were fixed in all the populations of S. alpinus examined and were presented in the population of S. malma in the Klutina Lake/River, but not presented in the populations of other S. malma (Table 2).
|
In the case of Fok-217, we confirmed the presence of the SINE in the upper fragment in Figure 5 and the validity of amplification by PCR of the orthologous locus by Southern hybridization with the FokI sequence and the flanking sequence of the SINE, respectively, as probes [ Figure 5A (b and c) and B (b and c)].
In the case of the Fok-600 locus, we demonstrated that insertion of FokI units was dimorphic among populations of S. malma, with the exception of the population from the Yanbetsu River (Table 2). Moreover, we also found insertion of a SINE at the Fok-600 locus in individuals from one population of S. alpinus, namely, the population from Lake Hazen. Thus, the insertion of a FokI SINE at the Fok-600 locus was not specific to S. malma but was common to S. malma and S. alpinus, and it was not fixed among the populations of the two species.
Our results indicated that several insertions of FokI SINEs that were common to S. alpinus and S. malma were not fixed among populations of the two species. We found that the insertions were not only intraspecifically polymorphic but also interspecifically variable. Such intraspecific polymorphism and interspecific variation of insertions of SINEs might reflect complex processes of speciation in which two closely related (sub)species diverge by subdivision into genetically distinct populations to form the more-distinguishable species (see below).
| DISCUSSION |
|---|
SINEs can be used as efficient tools for the determination of phylogenetic relationships among species:
It is believed that a SINE is amplified in the germ cells of one individual and then spreads within a population through sexual reproduction and random genetic drift in the same manner as other changes in the DNA (![]()
![]()
![]()
![]()
![]()
|
Are populations of S. alpinus or S. malma monophyletic?
In this study, we found intraspecific polymorphism and interspecific variation when we examined the insertion of SINEs in a large number of populations of the two charr species. It is possible that such patterns of insertion directly reflect the phylogenetic relationships among the populations. For example, can the results for Fok-214 be interpreted to indicate the monophyly of the population of S. malma in Klutina Lake and of all the populations of S. alpinus? Does the population of S. malma in Klutina Lake need to be reclassified as S. alpinus? In general, species have been identified from morphological characteristics, but it is well known that morphological characteristics are plastic and can respond to variations in the environment. Such phenotypic plasticity has caused many problems in the taxonomic analysis of charr (for review, see ![]()
![]()
![]()
![]()
![]()
The interpretation, in terms of phylogeny, of the results for Fok-214 is, however, inconsistent with the interpretation of the results for Fok-600, which indicated that all populations of S. malma, with the exception of the populations in the Yanbetsu River, and S. alpinus from Lake Hazen have a SINE insertion at this locus. In addition, the interpretation of the results for Fok-600 is inconsistent with the interpretation of the results for Fok-217. Furthermore, it is very unlikely from a taxonomic perspective that the population of S. malma in Klutina Lake/River actually belongs to S. alpinus (![]()
Accordingly, we must conclude that the patterns of insertions of FokI SINEs that we found do not necessarily reflect the actual phylogenetic relationships among the populations of these species.
Ancestral polymorphism is the most plausible explanation for variations in the presence or absence of a SINE at a given locus:
To date, only two examples of intraspecific polymorphism of SINEs have been reported, namely, Alu SINEs in human populations and SmaI SINEs in populations of chum salmon, and each example has been shown to be useful for population analysis (![]()
![]()
![]()
In this study, we clearly showed that the presence or absence of insertions of FokI SINEs (Fok-214, Fok-217, and Fok-600) varied in populations of S. alpinus and S. malma. The most plausible explanation for these intraspecific and interspecific variations is that they are the result of ancestral polymorphism.
Insertions of FokI SINE at the Fok-214, Fok-217, and Fok-600 loci might have occurred in a common ancestor of S. malma and S. alpinus. Before fixation of each SINE at these loci in the ancestral species, the speciation of S. malma and S. alpinus must have occurred and the polymorphic SINEs were inherited by and sorted to populations of the two new species. After speciation, the SINEs at the Fok-214, Fok-217, and Fok-600 loci were fixed, lost, or became polymorphic as a result of random genetic drift in each population. There is a possibility of such a situation having occurred if the population size of the ancestral species was too large, or the period between the divergence of these two species and the present time was too short to be fixed in all populations of each species. Therefore, the present observations might reflect the ongoing processes of sorting of ancestrally polymorphic SINEs toward fixation or loss in populations of the two new species during speciation. The complete fixation of the SINE at the Fok-223 locus in S. malma and S. alpinus might indicate that the insertion of this SINE at this locus occurred relatively soon after divergence of the ancestral species of S. malma and S. alpinus from other species of Salvelinus (Figure 6).
The significance of trans-species polymorphism in evolution was first indicated by Jan Klein and his colleagues (![]()
![]()
Hybridization is another possibility:
Hybridization between S. malma and S. alpinus, with successive introgression of nuclear information from one species to the other, provides another explanation for these variations, although this explanation appears less likely.
There is no good evidence of intermediates formed by hybridization between S. malma and S. alpinus (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
SINEs will be a useful tool for distinguishing one population from another:
In this study, we found that the distribution of FokI SINEs at distinct loci varied among remote populations. As described above, such patterns of insertion do not necessarily reflect the phylogenetic relationships among the populations. However, we can use them as genetic markers to distinguish genetic variations. For example, at the Fok-600 locus, among the populations of S. malma that we showed, only the population from the Yanbetsu River had no insertion of a FokI SINE. The population of S. malma in Lake Shikaribetsu and its inlet stream, the Yanbetsu River, on Hokkaido Island, Japan, is thought to be a subspecies of S. malma (S. malma miyabei). S. malma miyabei has the most numerous gill-rakers, which range in number from 23 to 29 with a mode of 26, of all species of Salvelinus (![]()
![]()
![]()
![]()
Further screening of FokI SINE loci and analysis of more samples from various regions should allow us to clarify the structures of populations and the evolutionary history of S. alpinus and S. malma.
| ACKNOWLEDGMENTS |
|---|
The authors are grateful to T. YOSHIKAWA, T. MASUDA, and M. TSUJI for their help in isolation of SINE clones. We thank N. DAVIS (Bering Sea), F. KIRCHEIS (Maine), J. VUORINEN (Finland), and M. SANEYOSHI (Japan) for providing those samples and Parks Canada for field assistance at Lake Hazen. North American field work was supported by Fisheries and Oceans Canada and Alaska Department of Fish and Game. This work was supported by a Grant-in-Aid for Specially Promoted Research from the Ministry of Education, Science, and Culture of Japan.
Manuscript received March 9, 1998; Accepted for publication April 30, 1998.
| LITERATURE CITED |
|---|
BATZER, M. A. and P. L. DEININGER, 1991 A human-specific subfamily of Alu sequences. Genomics 9:481-487[Medline].
BATZER, M. A., V. A. GUDI, J. C. MENA, D. W. FOLTZ, and R. J. HERRERA et al., 1991 Amplification dynamics of human-specific (HS) alu family members. Nucleic Acids Res. 19:3619-3623
BATZER, M. A., M. STONEKING, M. ALEGIA-HARTMAN, H. BAZAN, and D. H. KASS et al., 1994 African origin of human-specific polymorphic Alu insertions. Proc. Natl. Acad. Sci. USA 91:12288-12292
BATZER, M. A., S. S. ARCOT, J. W. PHINNEY, M. ALEGIA-HARTMAN, and D. H. KASS et al., 1996 Genetic variation of recent Alu insertions in human populations. J. Mol. Evol. 42:22-29[Medline].
BEHNKE, R. J., 1972 The systematics of salmonid fishes of recently glaciated lakes. J. Fish. Res. Board Can. 29:639-671.
BEHNKE, R. J., 1980 A systematic review of the genus Salvelinus, pp. 441481 in Charrs: Salmonid Fishes of the Genus Salvelinus, Vol. I, edited by E. K. BALON. Junk Publishers, The Hague.
BEHNKE, R. J., 1984 Organizing the diversity of the Arctic char complex, pp. 221 in Biology of the Arctic Charr, edited by L. JOHNSON and B. L. BURNS. University of Manitoba Press, Winnipeg.
BLIN, N. and D. W. STAFFORD, 1976 A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res. 3:2303-2308.
CAVENDER, T. M., 1980 Systematics of Salvelinus from the North Pacific Basin, pp. 295322 in Charrs: Salmonid Fishes of the Genus Salvelinus, Vol. I, edited by E. K. BALON. Junk Publishers, The Hague.
DEININGER, P. L., and M. A. BATZER, 1993 Evolution of retroposons, pp. 157196 in Evolutionary Biology, Vol. 27, edited by M. K. HECHT, R. J. MACINTYRE and M. T. CLEGG. Plenum Press, New York.
DELACY, A. C. and W. M. MORTON, 1943 Taxonomy and habits of the charrs, Salvelinus malma and Salvelinus alpinus, of the Karluk drainage system. Trans. Am. Fish. Soc. 72:79-91.
FIGUEROA, F., E. GUNTHER, and J. KLEIN, 1988 MHC ploymorphism pre-dating speciation. Nature 335:265-267[Medline].
GHARRETT, A. J., A. GOTO and F. YAMAZAKI, 1991 A note on the genetic contrast of sympatric Dolly Varden (Salvelinus malma) and Arctic charr (S. alpinus) in the Karluk river system, Alaska, pp. 3748 in Reproductive Biology and Population Genetics of Dolly Varden (Salmonidae), edited by F. YAMAZAKI. Report of overseas work supported by Grant-in-Aid for Overseas Scientific Survey of the Ministry of Education, Science and Culture of Japan, during 19871990, Tokyo.
HAMADA, M., Y. KIDO, M. HIMBERG, J. D. REIST, and Y. CAO et al., 1997 A newly isolated family of short interspersed repetitive elements (SINEs) in coregonid fishes (whitefish) with sequences that are almost identical to those of the SmaI family of repeats: possible evidence for the horizontal transfer of SINEs. Genetics 146:355-367[Abstract].
HAMMER, M. F., 1994 A recent insertion of an Alu element on the Y chromosome is a useful marker for human population studies. Mol. Biol. Evol. 11:749-761[Abstract].
JOHNSON, L., 1990 Hazen Lake, pp. 19, in Data Book of World Lake Environments, edited by Lake Biwa Research Institute and International Lake Environment Committee. United Nations Environment Programme, Otsu, Japan.
KASS, D. H., C. ALEMAN, M. A. BATZER, and P. L. DEININGER, 1994 Identification of a human specific Alu insertion in the Factor XIIIB gene. Genetika 94:1-8.
KIDO, Y., M. AONO, T. YAMAKI, K. MATSUMOTO, and S. MURATA et al., 1991 Shaping and reshaping of salmonid genomes by amplification of tRNA-derived retroposons during evolution. Proc. Natl. Acad. Sci. USA 88:2326-2330
KIDO, Y., M. HIMBERG, N. TAKASAKI, and N. OKADA, 1994 Amplification of distinct subfamilies of short interspersed elements during evolution of the Salmonidae. J. Mol. Biol. 241:633-644[Medline].
KIDO, Y., M. SAITO, S. MURATA, and N. OKADA, 1995 Evolution of the active sequences of the HpaI short interspersed elements. J. Mol. Evol. 41:986-995[Medline].
KIMURA, M., 1983 The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge.
KLEIN, J., 1987 Origin of major histocompatibility polymorphism: the trans-species hypothesis. Hum. Immun. 19:155-162[Medline].
KOISHI, R. and N. OKADA, 1991 Distribution of the salmonid Hpa I family in salmonid species demonstrated by in vitro runoff transcription assay of total genomic DNA: a procedure to estimate repetitive frequency and sequence divergence of a certain repetitive family with a few known sequences. J. Mol. Evol. 32:43-52[Medline].
MAEKAWA, K., 1977 Studies on the variability of the landlocked Miyabe char, Salvelinus malma miyabei I. Development and early life history (in Japanese). Jap. J. Ecol. 27:91-102.
MAEKAWA, K., 1985 Life History Patterns of the Miyabe Charr in Shikaribetsu Lake, Japan, pp. 233250 in Biology of Arctic Charr, edited by L. JOHNSON and B. BURNS. University of Manitoba Press, Winnipeg.
MATSUMOTO, K., K. MURAKAMI, and N. OKADA, 1986 Gene for lysine tRNA1 may be a progenitor of the highly repetitive and transcribable sequences present in the salmon genome. Proc. Natl. Acad. Sci. USA 83:3156-3160
MCPHAIL, J. D., 1961 A systematic study of the Salvelinus alpinus complex in North America. J. Fish. Res. Board Can. 18:793-816.
MITSUBOSHI, T., A. GOTO, and F. YAMAZAKI, 1992 Genetic differentiation of the Dolly Varden Salvelinus malma in Hokkaido, Japan. Bull. Fac. Fish. Hokkaido Univer. 43:153-161.
MORROW, J. E., 1980 Analysis of the dolly varden charr, Salvelinus malma, of northwestern North America and northeastern Siberia, pp. 323338 in Charrs, Salmonid Fishes of the Genus Salvelinus, edited by E. K. BALON. Junk Publishers, The Hague.
MURATA, S., N. TAKASAKI, M. SAITOH, and N. OKADA, 1993 Determination of the phylogenetic relationships among Pacific salmonids by using short interspersed elements (SINEs) as temporal landmarks of evolution. Proc. Natl. Acad. Sci. USA 90:6995-6999
MURATA, S., N. TAKASAKI, M. SAITOH, H. TACHIDA, and N. OKADA, 1996 Details of retropositional genome dynamics that provide a rationale for a generic division: the distinct branching of all the Pacific salmon and trout (Oncorhynchus) from the Atlantic salmon and trout (Salmo). Genetics 142:915-926[Abstract].
OKADA, N., 1991a SINEs: short interspersed repeated elements of the eukaryotic genome. Trends Ecol. Evol. 6:358-361.
OKADA, N., 1991b SINEs. Curr. Opin. Genet. Dev. 1:498-504[Medline].
OKADA, N., and K. OHSHIMA, 1995 Evolution of tRNA-derived SINEs, pp. 6179 in The Impact of Short Interspersed Elements (SINEs) on the Host Genome, edited by R. J. MARAIA. R. G. Landes Company, Austin, TX.
PERNA, N. T., M. A. BATZER, P. L. DEININGER, and M. STONEKING, 1992 Alu insertion polymorphism: a new type of marker for human population studies. Hum. Biol. 64:641-648[Medline].
PHILLIPS, R. B., and T. H. OAKLEY, 1997 Phylogenetic relationships among the Salmoninae based on nuclear and mitochondrial DNA sequences, pp. 145162 in Molecular Systematics of Fishes, edited by T. D. KOCHER and C. A. STEPIEN. Academic Press, San Diego, USA.
PHILLIPS, R. B., K. A. PLEYTE, and M. R. BROWN, 1992 Salmonid phylogeny inferred from ribosomal DNA restriction maps. Can. J. Fish. Aquat. Sci. 49:2345-2353.
PHILLIPS, R. B., S. L. SAJDAK, and M. J. DOMANICO, 1995 Relationships among charrs based on DNA sequences. Nordic J. Freshwater Res. 71:378-391.
REIST, J. D., E. GYSELMAN, J. A. BABALUK, J. D. JOHNSON, and R. WISSINK, 1995 Evidence for two morphotypes of Arctic char (Salvelinus alpinus (L.)) from Lake Hazen, Ellesmere Island, Northwest Territories, Canada. Nordic J. Freshwater Res. 71:396-410.
REIST, J. D., J. D. JOHNSON, and T. J. CARMICHAEL, 1997 Variation and specific identity of char from Northwestern Arctic Canada and Alaska. Am. Fish. Soc. Sym. 19:250-261.
ROGERS, J. H., 1985 The origin and evolution of retroposons. Int. Rev. Cytol. 93:187-279[Medline].
SAVVAITOVA, K. A., 1980 Taxonomy and biogeography of charrs in the Paleoarctic, pp. 281294 in Charrs, Salmonid Fishes of the Genus Salvelinus, edited by E. K. BALON. Junk Publishers, The Hague.
SAVVAITOVA, K. A., 1995 Patterns of diversity and processes of speciation in Arctic char. Nordic J. Freshwater Res. 71:81-91.
SCHMID, C. and R. MARAIA, 1992 Transcriptional regulation and transpositional selection of active SINE sequences. Curr. Opin. Genet. Dev. 2:874-882[Medline].
SHIMAMURA, M., H. YASUE, K. OHSHIMA, H. ABE, and H. KATO et al., 1997 Molecular evidence from retroposons that whales form a clade within even-toed ungulates. Nature 388:666-670[Medline].
SINGER, M. F., 1982 SINEs and LINEs: highly repeated short and long interspersed sequences in mammalian genomes. Cell 28:433-434[Medline].
STEARLEY, R. F. and G. R. SMITH, 1993 Phylogeny of the Pacific trouts and salmons (Oncorhynchus) and genera of the family Salmonidae. Trans. Am. Fish. Soc. 122:1-33.
TAKASAKI, N., S. MURATA, M. SAITOH, T. KOBAYASHI, and L. PARK et al., 1994 Species-specific amplification of tRNA-derived short interspersed repetitive elements (SINEs) by retroposition: a process of parasitization of entire genomes during the evolution of salmonids. Proc. Natl. Acad. Sci. USA 91:10153-10157
TAKASAKI, N., L. PARK, M. KAERIYAMA, A. J. GHARRETT, and N. OKADA, 1996 Characterization of species-specifically amplified SINEs in three salmonid specieschum salmon, pink salmon, and kokanee: the local environment of the genome may be important for the generation of a dominant source gene at a newly retroposed locus. J. Mol. Evol. 42:103-116[Medline].
TAKASAKI, N., T. YAMAKI, M. HAMADA, L. PARK, and N. OKADA, 1997 The salmon SmaI family of short interspersed repetitive elements (SINEs): Interspecific and intraspecific variation of the insertion of SINEs in the genomes of chum and pink salmon. Genetics 146:369-380[Abstract].
ULLU, E. and C. TSCHUDI, 1984 Alu sequences are processed 7SL RNA genes. Nature 312:171-172[Medline].
VOLOBUYEV, V. V., E. D. VASILYEVA, and K. A. SAVVAITOVA, 1979 Systematic status of the anadromous Chukotsk charr of the genus Salvelinus. Voprosy Ikhtiologii 19:408-418. (in Russian)..
WALTER, P. and G. BLOBEL, 1982 Signal recognition particle contains a 7S RNA essential for protein transcription across the endoplasmic reticulum. Nature 299:691-698[Medline].
WEINER, A. M., 1980 An abundant cytoplasmic 7S RNA is complementary to the dominant interspersed middle repetitive DNA sequence family in the human genome. Cell 22:209-218[Medline].
WEINER, A. M., P. L. DEININGER, and A. EFSTRATIADIS, 1986 Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55:631-661[Medline].
This article has been cited by other articles:
![]() |
D. A. Ray, H. J. T. Pagan, M. L. Thompson, and R. D. Stevens Bats with hATs: Evidence for Recent DNA Transposon Activity in Genus Myotis Mol. Biol. Evol., March 1, 2007; 24(3): 632 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Terai, K. Takahashi, M. Nishida, T. Sato, and N. Okada Using SINEs to Probe Ancient Explosive Speciation: "Hidden" Radiation of African Cichlids? Mol. Biol. Evol., June 1, 2003; 20(6): 924 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cheng, R. Motohashi, S. Tsuchimoto, Y. Fukuta, H. Ohtsubo, and E. Ohtsubo Polyphyletic Origin of Cultivated Rice: Based on the Interspersion Pattern of SINEs Mol. Biol. Evol., January 1, 2003; 20(1): 67 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takahashi, Y. Terai, M. Nishida, and N. Okada Phylogenetic Relationships and Ancient Incomplete Lineage Sorting Among Cichlid Fishes in Lake Tanganyika as Revealed by Analysis of the Insertion of Retroposons Mol. Biol. Evol., November 1, 2001; 18(11): 2057 - 2066. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Cantrell, B. J. Filanoski, A. R. Ingermann, K. Olsson, N. DiLuglio, Z. Lister, and H. A. Wichman An Ancient Retrovirus-like Element Contains Hot Spots for SINE Insertion Genetics, June 1, 2001; 158(2): 769 - 777. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hamada, M.
- Articles by Okada, N.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hamada, M.
- Articles by Okada, N.




x174 DNA, loaded as a source of size markers. Lengths of DNA fragments are shown in base pairs.


