- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Beagley, C. T.
- Articles by Wolstenholme, D. R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Beagley, C. T.
- Articles by Wolstenholme, D. R.
The Mitochondrial Genome of the Sea Anemone Metridium senile (Cnidaria): Introns, a Paucity of tRNA Genes, and a Near-Standard Genetic Code
C. Timothy Beagleya, Ronald Okimoto1,a, and David R. Wolstenholmeaa Department of Biology, University of Utah, Salt Lake City, Utah 84112
Corresponding author: David R. Wolstenholme, Department of Biology, University of Utah, Salt Lake City, Utah 84112, wolstenholme{at}biology.utah.edu (E-mail).
Communicating editor: G. B. GOLDING
| ABSTRACT |
|---|
The circular, 17,443 nucleotide-pair mitochondrial (mt) DNA molecule of the sea anemone, Metridium senile (class Anthozoa, phylum Cnidaria) is presented. This molecule contains genes for 13 energy pathway proteins and two ribosomal (r) RNAs but, relative to other metazoan mtDNAs, has two unique features: only two transfer RNAs (tRNAf-Met and tRNATrp) are encoded, and the cytochrome c oxidase subunit I (COI) and NADH dehydrogenase subunit 5 (ND5) genes each include a group I intron. The COI intron encodes a putative homing endonuclease, and the ND5 intron contains the molecule's ND1 and ND3 genes. Most of the unusual characteristics of other metazoan mtDNAs are not found in M. senile mtDNA: unorthodox translation initiation codons and partial translation termination codons are absent, the use of TGA to specify tryptophan is the only genetic code modification, and both encoded tRNAs have primary and secondary structures closely resembling those of standard tRNAs. Also, with regard to size and secondary structure potential, the mt-s-rRNA and mt-l-rRNA have the least deviation from Escherichia coli 16S and 23S rRNAs of all known metazoan mt-rRNAs. These observations indicate that most of the genetic variations previously reported in metazoan mtDNAs developed after Cnidaria diverged from the common ancestral line of all other Metazoa.
COMPLETE nucleotide sequences have been reported for mitochondrial (mt) genomes of more than 40 Metazoa (multicellular animals). About half of these mt genomes are from chordates, but the remainder are from organisms representing at least six invertebrate phyla (for references see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Exceptions to the constant gene content of metazoan mtDNAs include (1) the lack of an ATPase8 gene in mtDNAs of nematodes and of the mollusc Mytilus edulis (![]()
![]()
![]()
![]()
![]()
![]()
Metazoan mtDNAs exhibit a number of unusual features. Modifications relative to the standard genetic code are found in each of the metazoan mt genetic codes examined to date. In all metazoan mtDNAs, TGA serves to specify tryptophan rather than termination. ATA has the standard code specification of isoleucine only in mtDNAs of echinoderms ( ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In most metazoan mtDNAs, some protein genes begin with unorthodox translation initiation codons that include ATA, ATT, ATC, GTG, GTT, and TTG (![]()
![]()
![]()
Unusual wobble rules that allow the anticodon of some tRNAs to recognize all codons of a four-codon family have been suggested as the explanation for why the number of tRNAs encoded in metazoan mtDNAs is only 22, the number that under these conditions would be sufficient to translate mt protein gene transcripts (![]()
![]()
![]()
![]()
![]()
![]()
The two rRNAs encoded by metazoan mtDNAs (s-rRNA and l-rRNA) are clearly homologous to Escherichia coli 16S and 23S rRNAs (GUTTEL and FOX 1988; GUTTEL et al. 1993). The metazoan mt-s-rRNAs and mt-l-rRNAs, however, are all smaller by factors of as much as 2 and 3, respectively, than their E. coli counterparts. Nevertheless, all metazoan mt-rRNAs have the potential to fold into structures that resemble at least the core structures of the corresponding secondary structures of E. coli rRNAs (![]()
![]()
![]()
We presented previously the sequence of a 6.1-kb segment of the circular mtDNA molecule of the sea anemone Metridium senile (![]()
![]()
| MATERIALS AND METHODS |
|---|
Animals and mt nucleic acid isolations:
Specimens of the white morph of M. senile with an average size <5 cm were obtained from Dr. RIMOND C. FAY. Mitochondria were isolated by methods described previously (![]()
![]()
Restriction enzyme digestions and cloning:
M. senile mtDNA was cleaved with a combination of BamHI and Bgl II to yield five fragments of ~5.0, 4.5, 4.2, 2.8, and 1.0 kb, and each was cloned into BamHI-cleaved bacteriophage M13mp19 DNA. From the cloned fragments, nested sets of deletion clones were produced (![]()
DNA sequencing and sequence analysis:
DNA sequences of overlapping deletion clones were obtained by the method of ![]()
![]()
Determination of the 5' and 3' ends of the l-rRNA gene:
5' and 3' RACE (rapid amplification of cDNA ends) analyses (![]()
![]()
Taq Cycle Sequencing kit (Amersham). A second 5' RACE determination was made using a new 5' RACE pool prepared from cDNAs (generated as before with reverse transcriptase and random hexamers) that had been 3' polyguanylated and then polyadenylated using terminal deoxynucleotidyl transferase (Amersham). For determination of the mt-l-rRNA 3' end, 3' end regions were PCR amplified from the 3' RACE pool using primer TB17-2 and the sense oligonucleotide TBLR-2 (5' TTAAATAAAAAGTTTAGATAATGTG, nt 1614 1638, Figure 1). The double-stranded amplification product was digested with BamHI, which recognizes a site at nt 1639 (Figure 1) and in the TB17-2 sequence, and was cloned into BamHI-cleaved M13mp19. The resulting clones were screened by dot blot analysis (![]()
|
| RESULTS AND DISCUSSION |
|---|
The complete nucleotide sequence of the circular mtDNA molecule of M. senile is given in Figure 1, and gene content and organization are summarized in the map shown in Figure 2. The size of this molecule, 17,443 ntp, is within the range of sizes found for mtDNAs of other Metazoa (![]()
![]()
![]()
![]()
![]()
|
The M. senile mtDNA molecule contains the same 13 protein genes and two rRNA genes found in other metazoan mtDNAs; however, there are genes for only two tRNAs, tRNAf-Met and tRNATrp, rather than for 22 tRNAs reported for all other fully sequenced metazoan mtDNAs. In the M. senile mtDNA molecule, all genes are transcribed from the same strand of the molecule. This is also the case in nematode, bivalve mollusc, and annelid mtDNAs. In insects, echinoderms, gasteropods, and vertebrates, however, both strands are involved as gene templates.
Two of the M. senile mt protein genes, COI and ND5, each contain a group I intron. The COI intron contains a free-standing open reading frame (ORF) that appears to encode a protein homologous to homing endonucleases encoded in group I introns from a variety of organisms (![]()
![]()
![]()
Protein genes:
Four of the 13 M. senile energy pathway mt protein genes have been described previously (![]()
|
Similarity in gene arrangement between the M. senile mtDNA molecule and mtDNA molecules of other metazoans is severely limited. The gene arrangement ATPase8ATPase6 in M. senile mtDNA, where both genes are transcribed in the same direction, is conserved in mtDNAs of vertebrates, echinoderms, arthropods, and the polyplacophoran mollusc Katharina tunicata, but in vertebrate, echinoderm, and arthropod mtDNAs, the 3' end of the ATPase8 gene overlaps the 5' end of the ATPase6 gene by as many as 43 ntp (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Codon usage and the genetic code:
Codon usage among the 13 energy pathway protein genes and, separately, in the COI intron ORF are given in Table 1. All codons are used in the 13 energy pathway protein genes. The relative frequencies of nucleotides in codon third positions (T, 40.2%; A, 28.1%; G, 17.1%; C, 14.7%) are similar to the relative frequencies of all nucleotides in the sense strand of these genes (T, 38.0%; A, 24.5%; G, 20.5%; C, 17.0%). The overall A plus T content of protein gene sense strands (62.5%) is within the range of values found for other metazoan mt protein genes: 83.3% (Apis mellifera) to 54.9% (human). In the COI intron ORF, 10 codons, nine of which end in C (five) or G (four), do not occur. This is correlated with the lower overall usage of G (13.5%) and C (10.8%) in codon third positions in the COI intron ORF than in the energy pathway protein genes (G, 17.1%; C, 14.7%). As expected for a protein predicted to interact with a nucleic acid, there are much higher frequencies of lysine- and arginine-specifying codons (11.7 and 6.7%, respectively) in the COI intron ORF than in the energy pathway protein genes (2.6 and 2.5%, respectively; Table 1). In contrast to the finding that in most invertebrate and vertebrate mtDNAs either a fraction or all of the protein genes begin with various unorthodox translation initiation codons, all of the M. senile mt protein genes begin with ATG. Such a situation has been recorded previously only for the mtDNAs of the amphibian Xenopus laevis and the annelid L. terrestris (![]()
![]()
|
Data obtained from analysis of the four complete mt protein genes (Cyt b, COII, ND4, and ND6) and one partial mt protein gene (ND2) of M. senile (![]()
![]()
![]()
Analysis of AGA and AGG codon usage in the full complement of M. senile mt energy pathway protein genes (Figure 3) confirmed the conclusion drawn from analysis of the M. senile COII and Cyt b genes (![]()
![]()
Analysis of ATA codon usage in the four most conserved M. senile mt protein genes (COI, COII, COIII, and Cyt b; Figure 3) also confirmed our earlier conclusion that these codons have the standard genetic code specification of isoleucine (![]()
![]()
![]()
Segments of unassigned nucleotides:
Although the tRNAf-Met and l-rRNA genes are immediately adjacent to each other (see below), segments of noncoding nucleotides occur between all other adjacent genes in the M. senile mtDNA molecule (Figure 1 and Figure 2). The largest such segment is 324 ntp between the tRNATrp and ND2 genes and, therefore, is the most likely candidate for the control region. The remaining 14 noncoding segments range from 4 to 143 ntp, and they total 614 ntp, the largest fraction (3.5%) of any known metazoan mt genome. Both the 143 ntp and 324 ntp noncoding segments have a higher A plus T content (72.0 and 70.4%, respectively) than the mt protein gene sense strands (62.5%), and RNAs transcribed from these regions in the same direction as the mt genes would have extensive, stable secondary structure potential (data not shown). This latter observation is of interest because it has been suggested that secondary structures in the mtDNA control region may play some part in the initiation of replication and transcription (see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
The M. senile mt-tRNATrp gene:
The 70 ntp sequence that begins 90 ntp downstream from the 3' end of the ND5 gene has primary structure and secondary structure potential of a gene for tRNATrp (Figure 1 and Figure 4). Almost all the nucleotides that are highly conserved among standard tRNAs (prokaryotic tRNAs and tRNAs encoded in eukaryotic nuclear and chloroplast DNAs) are found at specific positions within this structure: T8, A14, G18, G19, Pu21, Py32, T33, Pu37, Py48, G58, T54, T55, C56, A58, Py60, and C61 (![]()
![]()
![]()
![]()
C stem, and the complete 5' TTCRANY T
C loop. Also, in the M. senile mt-tRNATrp gene sequence, there are a number of nucleotides that are considered semi-invariant in standard tRNAs: Pu10, Pu13, Pu15, Pu22, Py25, Py27, and Pu43 (![]()
![]()
|
The finding that the M. senile mt-tRNATrp gene as well as the mt-tRNAf-Met gene have near-standard primary and secondary structures strengthens the view that almost all the various tRNA gene modifications found in metazoan mtDNAs postdated divergence of the cnidarian ancestral line.
The M. senile mt-l-rRNA gene:
The 5' terminus of the M. senile mt-l-rRNA gene was located using 5' RACE analysis. Comparisons of the nucleotide sequence of the RACE PCR amplification product with the mt-l-rRNA gene sequence (Figure 1) indicated that the 5' nucleotide could be any of nucleotides 7173. This was because nucleotides 71 and 72 are Ts, which cannot be distinguished from the reiterated 3' poly-T sequence (the complement of the added 3' poly-A sequence). To precisely determine the mt-l-rRNA 5' end, a further 5' RACE analysis was carried out using a second 5' RACE pool comprising double-stranded cDNAs that were first 3' polyguanylated and then 3' polyadenylated. The result (Figure 5A) indicates that the 5' nucleotide is 71, a T (Figure 1); therefore, the 5' end of the mt-l-rRNA gene is immediately adjacent to the 3' end of the tRNAf-Met gene.
|
The 3' terminus of the M. senile mt-l-rRNA was located using 3' RACE analysis. In all of the resulting eight cloned sequences of the 3' endproximal region of the mt-l-rRNA gene (Figure 5B), the position of the added poly-A sequence indicated that the 3'-terminal nucleotide of the mt-l-rRNA is nt 2260 (Figure 1). Therefore, 70 (apparently noncoding) nucleotides occur between the M. senile mt-l-r-RNA and COIII genes (Figure 1).
The aforementioned data define the size of the M. senile mt-l-rRNA as 2189 nt. This is smaller than the E. coli 23S rRNA by 715 nt but larger than any other presently known metazoan mt-l-rRNA. Examples of other predicted metazoan mt-l-rRNA sizes are Caenorhabditis elegans, 953 nt; D. yakuba, 1326 nt; X. laevis, 1640 nt; mouse, 1582 nt (![]()
A secondary structure model for the M. senile l-rRNA based on the secondary structure model of E. coli 23S rRNA (![]()
![]()
![]()
![]()
|
| CONCLUDING REMARKS |
|---|
The M. senile mt genome has two major unusual features: (1) the absence of all but two tRNA genes and (2) the presence of two group I introns, one in the COI gene and the other in the ND5 gene.
It seems likely that retention of genes for tRNAf-Met and tRNATrp in the M. senile mt genome is related to the specific mt functions of these tRNAs. Initiation of protein synthesis in mammalian mitochondria has been shown to have the bacterial characteristic of using formyl-methionine rather than methione (![]()
A deficiency of genes in mtDNA for tRNAs necessary for protein synthesis in mitochondria has also been reported for the Protozoa Leishmania tarentollae, Trypanosoma brucei, Paramecium tetraurelia, Tetrahymena pyriformis, Acanthamoeba castellanii, and Chlamydomonas reinhardtii, as well as for some angiosperm plants, including maize (Zea mays), wheat (Triticum aestivum), and common bean (Phaseolus vulgaris). No tRNAs are encoded in mtDNAs of L. tarentollae and T. brucei (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
It seems likely that in plants and T. brucei at least, some specific nuclear DNAencoded tRNAs are used in both cytoplasmic and mt protein synthesis. In P. vulgaris, three different tRNAs in mitochondria, each specifying leucine, are identical in sequence to three leucine-specifying tRNAs in the cytoplasm, except that the G18 of each mt-tRNALeu is methylated. Similarly, three tRNAs with corresponding specificity (lycine, leucine, and tyrosine) in the mitochondria and cytoplasm of T. brucei are identical, except that C32 is modified in each mt-tRNA (![]()
![]()
![]()
The evolutionary origin of nuclear DNAencoded genes for tRNAs postulated to be imported into mitochondria in cnidaria, protozoa, and plants is undetermined. In the past, such genes might have been transferred from mtDNA to nuclear DNA either by direct gene transfer or, as seems to have occurred for some plant mt protein genes, through an RNA intermediate (![]()
Because the tRNAs encoded in all noncnidarian metazoan mtDNAs examined so far are sufficient to carry out mt translation, it seems most likely that the apparent replacement of mtDNA-encoded tRNAs with nuclear DNA-encoded tRNAs in M. senile mitochondria developed in an ancestral organism after divergence of the cnidarian line from the line leading to all other Metazoa. Therefore, because all extant Metazoa are considered to be monophyletic, it seems reasonable to argue that use of nuclear DNAencoded tRNAs to carry out mt protein synthesis in cnidarian mitochondria was developed independently from the corresponding events in Protozoa and plants. The reported involvement of tRNA synthetases in tRNALys importation into mitochondria in S. cerevisiae (![]()
The two group I introns present in the M. senile COI and ND5 genes are of particular interest for the following reasons. These are the only introns so far recorded in a metazoan mtDNA, and they are the only introns of the potentially self-splicing kinds (groups I, II, and III) to be found in Metazoa. Furthermore, we have shown that these introns appear to be limited in occurrence to members of the anthozoan order Actiniaria (![]()
![]()
The amino acid sequence of the protein encoded by the COI intron ORF includes a consensus signature sequence (RLAGLVDGEGVF) of the LAGLI-DADG family of group I intron-encoded, site-specific endonucleases designated homing endonucleases (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In contrast, maintenance of the intron in the M. senile ND5 gene, which does not encode a homing endonuclease, is ensured by the inclusion of ND1 and ND3 genes. Because these essential genes do not appear to be duplicated in the cell, the loss of the entire ND5 intron would be lethal. Therefore, elimination of the ND5 intron could only be accomplished by a multistep event, the most likely of which is transposition (directly or after duplication) of the ND1 and ND3 genes (as a unit or separately) to another nonintron location in the M. senile genome, followed by intron loss.
The above considerations of M. senile COI and ND5 introns provide a clear-cut case of two introns that occur in the same small genome, whose continued presence seems likely to be ensured by different selective forces.
| FOOTNOTES |
|---|
1 Present address: Ronald Okimoto, Department of Poultry Science, University of Arkansas, Fayetteville, AR 72701. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank JANE L. MACFARLANE for assistance at various times. This work was supported by National Institutes of Health grant GM-18375
Manuscript received July 3, 1997; Accepted for publication November 14, 1997.
| LITERATURE CITED |
|---|
ARNASON, U., X. XU, and A. GULLBERG, 1996 Comparison between the complete mitochondrial DNA sequences of Homo and the common chimpanzee based on nonchimeric sequences. J. Mol. Evol. 42:145-152[Medline].
ASAKAWA, S., H. HIMENO, K.-I. MIURA, and K. WATANABE, 1995 Nucleotide sequence and gene organization of the starfish Asterina pectinifera mitochondrial genome. Genetics 140:1047-1060[Abstract].
BARRELL, B. G., A. T. BANKIER, and J. DROUIN, 1979 A different genetic code in human mitochondria. Nature 282:189-194[Medline].
BARRELL, B. G., S. ANDERSON, A. T. BANKIER, M. H. L. DE BRUIJN, and E. CHEN et al., 1980 Different pattern of codon recognition by mammalian mitochondrial tRNAs. Proc. Natl. Acad. Sci. USA 77:3164-3166
BEAGLEY, C. T., J. L. MACFARLANE, G. A. PONT-KINGDON, R. OKIMOTO, N. A. OKADA et al., 1995 Mitochondrial genomes of Anthozoa (Cnidaria), pp. 149153 in Progress in Cell ResearchSymposium on Thirty Years of Progress in Mitochondrial Bioenergetics and Molecular Biology, edited by F. PALMIERI, S. PAPA, C. SACCONE and N. GADALETA. Elsevier, Amsterdam.
BEAGLEY, C. T., N. A. OKADA, and D. R. WOLSTENHOLME, 1996 Two mitochondrial group I introns in a metazoan, the sea anemone Metridium senile : one intron contains genes for subunits 1 and 3 of NADH dehydrogenase. Proc. Natl. Acad. Sci. USA 93:5619-5623
BESSHO, Y., T. OHAMA, and S. OSAWA, 1992 Planarian mitochondria. II. The unique genetic code as deduced from cytochrome c oxidase subunit gene sequences. J. Mol. Evol. 34:331-335[Medline].
BIBB, M. H., R. A. VAN ETTEN, C. T. WRIGHT, M. W. WALBERG, and D. A. CLAYTON, 1981 Sequence and gene organization of mouse mitochondrial DNA. Cell 26:167-180[Medline].
BOER, P. H. and M. W. GRAY, 1988 Transfer RNA genes and the genetic code in Chlamydomonas reinhardii.. Curr. Genet. 14:583-590[Medline].
BOORE, J. L. and W. M. BROWN, 1994 Complete DNA sequence of the mitochondrial genome of the black chiton Katharina tunicata.. Genetics 138:423-443[Abstract].
BOORE, J. L. and W. M. BROWN, 1995 Complete sequence of the mitochondrial DNA of the annelid worm Lumbricus terrestris.. Genetics 141:305-319[Abstract].
BRIDGE, D., C. W. CUNNINGHAM, B. SCHIERWATER, R. DESALLE, and L. W. BUSS, 1992 Class level relationships in the phylum Cnidaria: evidence from mitochondrial genome structure. Proc. Natl. Acad. Sci. USA 89:8750-8753
BRIMACOMBE, R., B. GREUER, P. MITCHELL, M. OBWALD, J. RINKE-APPEL et al., 1990 Three dimensional structure and function of Escherchia coli 16S and 23S rRNA as studied by crosslinking techniques, pp. 93106 in The Ribosome: Structure, Function and Evolution, edited by W. E. HILL, A. DAHLBERG, R. A. GARRETT, P. B. MOORE, D. SCHLESSINGER and J. R. WARNER. ASM Press, Washington, DC.
BURGER, G., I. PLANTE, K. M. LONERGAN, and M. W. GRAY, 1995 The mitochondrial DNA of the amoeboid protozoon Acanthamoeba castellanii: Complete sequence, gene content and genome organization. J. Mol. Biol. 245:522-537[Medline].
BUZZO, K., D. L. FOUTS, and D. R. WOLSTENHOLME, 1978 EcoRI cleavage site variants of mitochondrial DNA molecules from rats. Proc. Natl. Acad. Sci. USA 75:909-913
CANTATORE, P., M. ROBERTI, G. RAINALDI, M. N. GADALETA, and C. SACCONE, 1989 The complete nucleotide sequence, gene organization, and genetic code of the mitochondrial genome of Paracentrotus lividus.. J. Biol. Chem. 264:10965-10975
CHANG, D. D., T. W. WONG, J. E. HIXON and D. A. CLAYTON, 1985 Regulatory sequences for mammalian mitochondrial transcription and replication, pp. 135144 in Achievements and Perspectives of Mitochondrial Research, Vol. II. Biogenesis edited by E. QUAGLIARIELLO, E. C. SLATER, F. PALMIERI, C. SACCONE and A. M. KROON. Elsevier, Amsterdam.
CHOMYN, A., M. W. HUNKAPILLAR, and G. ATTARDI, 1981 Alignment of the amino terminal amino acid sequence of human cytochrome c oxidase subunits I and II with the sequence of their putative mRNAs. Nucleic Acids Res. 9:867-877
CLARY, D. O. and D. R. WOLSTENHOLME, 1985 The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J. Mol. Evol. 22:252-271[Medline].
CLARY, D. O. and D. R. WOLSTENHOLME, 1987 Drosophila mitochondrial DNA: conserved sequences in the A+T-rich region and supporting evidence for a secondary structure model of the small ribosomal RNA. J. Mol. Evol. 25:116-125[Medline].
CLAYTON, D. A., 1991 Replication and transcription of vertebrate mitochondrial DNA. Ann. Rev. Cell Biol. 7:453-478.
CLAYTON, D. A., 1992 Transcription and replication of animal mitochondrial DNAs, pp. 217232 in Mitochondrial Genomes: International Review of Cytology, Vol. 141, edited by D. R. WOLSTENHOLME and K. W. JEON. Academic Press, New York.
COLLEAUX, L., L. D'AURIOL, F. GALIBERT, and B. DUJON, 1988 Recognition and cleavage site of the intron-encoded omega transposase. Proc. Natl. Acad. Sci. USA 85:6022-6026
CROZIER, R. H. and Y. C. CROZIER, 1993 The mitochondrial genome of the honey bee Apis melifera: complete sequence and genome organization. Genetics 133:97-117[Abstract].
DALE, R. M. K., B. MCCLURE, and J. P. HOUCHINS, 1985 A rapid single-stranded cloning strategy for producing overlapping clones for use in DNA sequencing: application to sequencing the corn mitochondrial 18S rDNA. Plasmid 13:31-40[Medline].
DAVIS, L. G., M. D. DIBNER and J. F. BALTEY, 1986 Basic Methods in Molecular Biology. Elsevier, New York.
DE BRUIJN, M. H. L., P. H. SCHREIER, I. C. EPERON, B. G. BARRELL, and E. Y. CHEN et al., 1980 A mammalian mitochondrial serine transfer RNA lacking the "dihydrouridine" loop and stem. Nucleic Acids Res. 8:5213-5222
DIETRICH, A., J. H. WEIL, and L. MARÉCHAL-DROUARD, 1992 Nuclear-encoded transfer RNAs in plant mitochondria. Annu. Rev. Cell Biol. 8:115-131.
DIRHEIMER, G., G. KEITH, A.-P. SIBLER and R. P. MARTIN, 1979 The primary structure of tRNAs and their rare nucleosides, pp. 1941 in Transfer RNA: Structure, Properties and Recognition, edited by P. R. SCHIMMEL, D. SOLL and J. N. ABELSON. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
DOOLITTLE, R. F., 1993 The comings and goings of homing endonucleases and mobile introns. Proc. Natl. Acad. Sci. USA 90:5379-5381
FAURON, C. M.-R. and D. R. WOLSTENHOLME, 1980 Extensive diversity among Drosophila species with respect to nucleotide sequences within the adenine + thymine-rich region of mitochondrial DNA molecules. Nucleic Acids Res. 8:2439-2452
FLOOK, P. K., C. H. F. ROWELL, and G. GELLISSEN, 1995 The sequence, organization, and evolution of the Locusta migratoria mitochondrial genome. J. Mol. Evol. 41:928-941[Medline].
FROHMAN, M. A., 1990 RACE: rapid amplification of cDNA ends, pp. 2838 in PCR Protocols, A Guide to Methods and Applications, edited by M. A. INNIS, D. H. GELFAND, J. J. SNINSKY and T. J. WHITE. Academic Press, San Diego.
GRAY, M. W., D. SANKOFF, and R. J. CEDERGREN, 1984 On the evolutionary descent of organisms and organelles: A global phylogeny based on a highly conserved structural core in small subunit ribosomal RNA. Nucleic Acids Res. 12:5837-5852
GUTELL, R. and G. E. FOX, 1988 A compilation of large subunit RNA sequences presented in a structural format. Nucleic Acids Res. 16:r175-r269.
GUTELL, R. R., M. W. GRAY, and M. N. SCHNARE, 1993 A compilation of large subunit (23S and 23S-like) ribosomal RNA structures. Nucleic Acids Res. 21:3055-3074
HANCOCK, K. and S. L. HAJDUK, 1990 The mitochondrial tRNAs of Trypanosoma brucei are nuclear encoded. J. Biol. Chem. 265:19208-19215
HANCOCK, K., A. J. LEBLANC, D. DONZE, and S. L. HAJDUK, 1992 Identification of nuclear encoded precursor tRNAs within the mitochondrion of Trypanosoma brucei.. J. Biol. Chem. 267:23963-23971
HATZOGLOU, E., G. C. RODAKIS, and R. LECANIDOU, 1995 Complete sequence and gene organization of the mitochondrial genome of the land snail Albinaria coerulea.. Genetics 140:1353-1366[Abstract].
HAYASHI, J.-I., M. TAKEMITSU, Y.-I. GOTO, and I. NONAKA, 1994 Human mitochondria and mitochondrial genome function as a single dynamic cellular unit. J. Cell Biol. 125:43-50
HOFFMANN, R. J., J. L. BOORE, and W. M. BROWN, 1992 A novel mitochondrial genome organization for the blue mussel, Mytilus edulis.. Genetics 131:397-412[Abstract].
JACOBS, H. T., D. J. ELLIOT, V. B. MATH, and A. FARQUHARSON, 1988 Nucleotide sequence and gene organization of sea urchin mitochondrial DNA. J. Mol. Biol. 202:185-217[Medline].
KRETTEK, A., A. GULLBERG, and U. ARNASON, 1995 Sequence analysis of the complete mitochondrial DNA molecule of the hedgehog, Erinaceus europaeus, and the phylogenetic position of the Lipotyphla. J. Mol. Evol. 441:952-957.
LAMBOWITZ, A. M. and M. BELFORT, 1993 Introns as mobile genetic elements. Annu. Rev. Biochem. 62:587-622[Medline].







signs identify amino acids interpreted as arginine specified by AGA and AGG, respectively. Amino acids in all the sequences shown that are specified by TGA codons and interpreted as tryptophan are identified by a # sign. Group I intron insertion sites in corresponding M. senile COI and ND5 gene sequences are indicated. Percentage amino acid sequence identities of M. senile and mouse mt proteins are in the range 13.4% (ND6) to 66% (COI; mean = 39.0%), and those of M. senile and D. yakuba mt proteins are in the range 9.9% (ND6) to 67.7% (COI; mean = 37.7%).



U, and presumed pairing of G and A is indicated by G
A. The solid outlines identify either a sequence of 9 nt or more or shorter sequences in interhairpin regions that are 100% identical and in similar locations to sequences in the E. coli 23S rRNA secondary structure model (